Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
July-2017 Volume 40 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2017 Volume 40 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Identification of a novel hypertrophic cardiomyopathy-associated mutation using targeted next-generation sequencing

  • Authors:
    • Yue Zhao
    • Yue Feng
    • Xiaoxue Ding
    • Shuwei Dong
    • Hong Zhang
    • Jiahuan Ding
    • Xueshan Xia
  • View Affiliations / Copyright

    Affiliations: Faculty of Life Science and Technology, Research Center for Molecular Medicine in Yunnan Province, Kunming University of Science and Technology, Kunming, Yunnan 650500, P.R. China, Department of Cardiology, The First People's Hospital of Yunnan Province, Kunming, Yunnan 650034, P.R. China
    Copyright: © Zhao et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 121-129
    |
    Published online on: May 11, 2017
       https://doi.org/10.3892/ijmm.2017.2986
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Hypertrophic cardiomyopathy (HCM), one of the most common forms of myocardial diseases, is the major cause of sudden cardiac death in young adults and competitive athletes. Analyses of gene mutations associated with HCM are valuable for its molecular diagnosis, genetic counseling, and management of familial HCM. To dissect the relationship between the clinical presentation and gene mutations of HCM, the genetic characterizations of 19 HCM-related genes in 18 patients (8 cases from 6 pedigrees with familial HCM and 10 cases without familial HCM) were detected using next-generation sequencing (NGS). As a result, 12 disease-related mutations were identified in the 18 subjects, including 6 single mutations and 3 double mutations [MYBPC3 (p.Gln998Glu) plus TNNI3 (p.Arg145Gly), PRKAG2 (p.Gly100Ser) plus MYBPC3 (p.Lys1209Serfs*28) and TNNI3 (p.Glu124Gln) plus GLA (p.Trp47*)]. The 3 heterozygous double mutations were discovered for the first time in the malignant familial HCM patients. Of the 6 single mutations, a novel mutation was found in tafazzin (TAZ, p.Ile208Val), and a mutation in β-myosin heavy chain gene (MYH7, p.Arg54Gln), which was reported as rare in the general population, was firstly found in one HCM patient. Identification of novel and rare mutations in HCM patients have added new data to the spectrum of gene mutations associated with this disease. These findings provide an essential basis for the molecular diagnosis and better management of family members at risk of familial HCM.

Introduction

Hypertrophic cardiomyopathy (HCM: OMIM 192600) is one of the most common inherited cardiac diseases characterized by marked thickening of the left ventricle or/and interventricular septum. HCM may affect groups of all ages and ethnicity, with an incidence of 1 in 500 individuals in the general population worldwide (1). In China, at least one million individuals are expected to be diagnosed with this disease (2). It has been considered as the major cause of sudden cardiac death in young adults and competitive athletes. Most HCM patients experience obvious clinical symptoms, including shortness of breath, palpitations, angina and syncope. However, HCM also presents with high variability in clinical presentation due to the genetic heterogeneity of the patients. It is predominantly inherited in an autosomal dominant pattern, but fewer HCM patients present with X-linked inheritance or Mendelian autosomal recessive disease. The first mutation highly associated with HCM was discovered in the β-myosin heavy chain gene (MYH7) in 1990 (3). To date, over 1,400 responsible mutations have been documented in more than 25 genes (4,5). Genetic testing can provide more accurate information for clinical diagnosis, especially for those ambiguous HCM cases, and for evaluation of the risk of disease occurrence of individuals with familial HCM (6).

Compared to the traditional genetic testing method, Sanger sequencing, which is costly and time-consuming, recently developed next-generation sequencing (NGS) technologies can improve cost effectiveness. NGS is highly feasible for massive parallel sequencing and is suitable for inherited disease testing (7–9), including cardiomyopathies (10–12). Yunnan Province, located in southwestern China, consists of diverse ethnic groups (13). However, the genetic characterizations of HCM in this region have been poorly studied (14,15). In the present study, we used NGS technology to perform genetic screening of the entire exon sequence and the flanking regions of 19 most common HCM causative genes in a Yunnan population. One novel mutation in tafazzin (TAZ, p.Ile208Vla), a single rare mutation in MYH7 (p.Arg54Gln), and three double mutations responsible for HCM were respectively detected in our HCM patients. The prevalence and spectrum of gene mutations associated with HCM in Yunnan were systematically described.

Materials and methods

Subjects and clinical evaluation

From September 2013 to December 2015, 18 patients with HCM, including 8 cases from 6 pedigrees with familial HCM and 10 cases without familial HCM, and 100 healthy controls were recruited at the Department of Cardiology, The First People's Hospital of Yunnan Province. Written informed consent was obtained from all subjects. The demographic data including age, gender, and history of cardiovascular diseases and other familial diseases were recorded simultaneously with sample collection. According to the 2011 American College of Cardiology Foundation (ACCF) and the American Heart Association (AHA) guideline for the diagnosis of HCM (16), a left ventricular septum (LVS) or/and interventricular septal thickness (IVST) ≥15 mm in the absence of any other condition that could explain the hypertrophy was diagnosed as HCM. This research project was approved by the Ethics Committee of the First People's Hospital of Yunnan Province, and performed in compliance with the principles of the Declaration of Helsinki.

DNA isolation and sequencing

Genomic DNA was isolated from the peripheral whole blood of 18 HCM patients and 100 healthy controls using a genomic DNA Miniprep kit (AxyPrep; Axygen, Union City, CA, USA) following the manufacturer's protocol. OD260/280 of DNA samples was ~1.8 after purification with AMPure XP reagents (Beckman Coulter, Fullerton, CA, USA). The DNA concentration was measured using the Qubit dsDNA HS assay kit (Life Technologies, Carlsbad, CA, USA). Whole coding exons and in exon-intron boundaries of 19 HCM-related genes were amplified and then sequenced on Ion Torrent PGM (Life Technologies). These genes were MYH7, myosin binding protein C (MYBPC3), α-actinin 2 (ACTN2), desmin (DES), α-galactosidase A (GLA), lysosome-associated membrane protein 2 (LAMP2), LIM domain-binding 3 (LDB3), α-myosin heavy chain (MYH6), regulatory myosine light chain 2 (MYL2), regulatory myosine light chain 3 (MYL3), TAZ, myopalladin (MYPN), AMP-activated protein kinase (PRKAG2), sodium channel, voltage-gated type V α-subunit (SCN5A), Titin-cap (TCAP), troponin I 3 (TNNI3), troponin T 2 (TNNT2), α-tropomyosin 1 (TPM1), and vinculin (VCL).

Molecular genetic analysis

Low quality reads of which the read depth was less than 30× were discarded (17,18), and qualified sequences were mapped to human reference genome (hg19). The variants of the 19 genes in each sample were annotated using online software Ion Reporter (https://ionreporter.lifetechnologies.com/ir/secure/home.html). The missense variant was considered to be possibly related with HCM on the basis of the following criteria (19,20): i) the variant has been reported as an HCM-related mutation according to the documents or Human Gene Mutation Database (HGMD, http://www.hgmd.cf.ac.uk/ac/index.php), and/or ii) the predicted amino acid showed a change in a highly conserved evolution site across many species; iii) the missense variant was absent in the 100 healthy controls and its minor allele frequency (MAF) was <5% in the 1000 Genomes Project (http://www.1000genomes.org/), HapMap (http://hapmap.ncbi.nlm.nih.gov/) and/or Exome Aggregation Consortium (ExAC) databases (http://exac.broadinstitute.org/); iv) it was predicted as a disease-related mutation by Mutation Taster (21).

All mutations potentially related with HCM were further confirmed by conventional dideoxy sequencing using the BigDye Terminator v.3.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA), and the obtained sequences were analyzed using ABI 3130 Genetic Analyzer (Life Technologies). Specific primers were applied to amplify the fragments of genomic DNA containing identified candidate variations (Table II).

Table II

Sequences of primers used for validation of target genes.

Table II

Sequences of primers used for validation of target genes.

Gene symbolTranscript nameExonNucleotide changesPrimer (5′ to 3′)PCR fragment (bp)
MYH7NM_000257.23c.161G>ASense: CCAAAGCCAGCCTATGGAACTCT2,348
Antisense: GGTCCCCAATGGCTGCAATAAC
MYH7NM_000257.28c. [730T>C, 732C>T]Sense: CTTGCTGGTCTCCAGTAGTATTGT536
Antisense: GGCTGAGCCTAGCAGATTCAT
MYH6NM_00247112c.1087A>TSense: CTGGAGGTGGATGGAGGATGA2,155
Antisense: GGTTGAGGAGTTGGGATTGTGGT
SCN5ASCN5A21c.3575G>ASense: CATCTCTTCAACCATCCAACCTTCTGC275
Antisense: TCCCTGCCACAACCCTGCATC
TNNI3NM_000363.46c.370G>CSense: AGGTCTCCCTGTTTTTGGTTCC1,076
Antisense: GGACCTTCATGTACCTCTTTGCTCT
GLANM_0001691c.140G>ASense: CTGGTATGGAAATAGGGCGGGTC682
Antisense: CCTGATTCGGGACAGTTTGCTGG
MYBPC3NM_000256.327c.2992C>GSense: TATGTGACCAGTGGGCAGTTC1,093
Antisense: GGGTCTTGTGACTGCACAAAG
MYH7NM_000257.222c.2572C>TSense: GCTAATCAGTGACAAAGCCAGGATC1,434
Antisense: AGGGTGGAAGAGCCAACAGTAGC
TNNI3NM_000363.46c.433C>GSense: AGGTCTCCCTGTTTTTGGTTCC1,076
Antisense: GGACCTTCATGTACCTCTTTGCTC
PRKAG2NM_000116.43c.298G>ASense: CAGTCCTGTGTGGTCAGAACTTGG907
Antisense: GGACCAGAAGGATTACGCTTTGAT
MYBPC3NM_000256.331c.3624delCSense: AGAGGCTCTCGGCATCAGGAAG906
Antisense: ACATAGATGCCCCCGTCAAAGG
TAZNM_000116.48c.622A>GSense: TCAGGGCCCAGCTTATGCTAAC441
Antisense: TTTAATGTCTCGGTGCCAGGAAG

[i] MYH7, β-myosin heavy chain; SCN5A, sodium channel, voltage-gated type V α-subunit; TNNI3, troponin I 3; GLA, α-galactosidase A; MYBPC3, myosin binding protein C; PRKAG2, AMP-activated protein kinase; TAZ, tafazzin.

Evolutionary conservation analysis of the rare and novel mutations, which were performed in many species (including Macaca mulatta, Mus musculus, Danio rerio, Drosophila melanogaster, Xenopus tropicalis, Bos taurus and Loxodonta), was conducted using Clustal W (http://www.genome.jp/tools/clustalw/) and the Weblogo (http://weblogo.berkeley.edu/logo.cgi) (15). Based on the lowest energy theory, the structure of the proteins with a rare mutation found in this study was predicted by using Robetta (http://robetta.bakerlab.org/) and SWISS-MODEL (http://www.swissmodel.expasy.org/) online program, and the result was visualized using the Visual Molecular Dynamics (VMD) software package (version 1.9.2, http://www.ks.uiuc.edu/Research/vmd/index.html).

Results

Demographic and clinical characteristics

From September 2013 to December 2015, a total of 18 HCM patients were recruited, including 11 (61%) males and 7 (39%) females. Among these, 8 patients were from 6 pedigrees with familial HCM, and the remaining 10 patients did not have familial HCM. Their mean age at diagnosis was 45 years (range 23–79) with a standard deviation (SD) of 16 years. The detailed demographic and clinical characteristics of the patients are shown in Table I. All the investigated patients presented typical clinical manifestations of HCM. The mean left ventricular ejection fraction (LVEF) was increased to 67.1% (SD=9.9), and the IVST was 18.8±2.7 mm, the left ventricular septum thickness (LVST) was 26.3±9.7 mm, and the median left ventricular posterior wall (LVPWT) was 11.7±1.9 mm as measured by doppler echocardiography.

Table I

Clinical characteristics of the HCM patients as determined by echocardiography.

Table I

Clinical characteristics of the HCM patients as determined by echocardiography.

Patient no.GenderAge (years)Family historyIVST (mm)LVPWT (mm)LVED (mm)LVST (mm)LVEF (%)
A14F44N17.68.842.736.668
8F58N17.315.960.745.350
9M34NNANANANANA
15M50N15.612.144.727.070
16M57N16.313.549.626.278
24M44N15.89.141.530.353
25F58N19.014.143.622.979
26F79NNANANANANA
56M77NNANANANANA
57F57N21.09.035.0NA65
Family A, III:2F42Y (HCM)22.611.240.928.3NA
Family A, III:4F36Y (HCM)22.112.042.428.0NA
Family A, III:5M34Y (HCM)22.010.944.231.7NA
Family B, II:1M23N15.612.1NANANA
Family C, III:1M27Y (HCM)22.811.547.712.6NA
Family D, III:1M26Y (SCD)21.112.040.316.074
Family E, II:1M47Y (HCM)16.411.353.013.573
Family F, II:1M28Y (SCD)22.012.643.115.161
Mean ± SDNA45±16NA18.8±2.711.7±1.944.9±6.226.3±9.767.1±9.9

[i] F, female; M, male; Y, Yes; N, No; HCM, hypertrophic cardiomyopathy; IVST, interventricular septal thickness; LVED, left ventricular end-diastolic diameter; LVPWT, left ventricular posterior wall thickness; LVEF, left ventricular ejection fraction; LVST, left ventricular septal thickness; SCD, sudden cardiac death; NA, not applicable.

Sequence alignment and annotation analysis

Exons and in exon-intron boundaries of 19 HCM-related genes were sequenced using Ion Torrent PGM (Life Technologies). There were 383 variants obtained from qualified reads, with single nucleotide polymorphisms, insertions or/and deletions. The mean depth of coverage over all missense variants was 165.4-fold (ranged from 30 to 498) as shown in Fig. 1. Those variants were annotated and the synonymous variants were filtered out using Ion Reporter online software (https://ionre-porter.lifetechnologies.com/ir/secure/home.html). As a result, 86 non-synonymous variants were detected in the 18 HCM patients (data available upon request).

Figure 1

Sequencing coverage of mutation sites in the coding region of 19 hypertrophic cardiomyopathy (HCM)-related genes. The sequence coverages for each gene ranged from 30 to 498× in 16 HCM patients, and the mean coverage was 165.4× for overall selected target genes.

Screening for variants with higher potential association with HCM

We next focused on the variants which were potentially related with HCM. Based on the potentially pathogenic criteria (mentioned in Materials and methods), 12 mutations were selected from 13 HCM patients and further confirmed by Sanger sequencing (Table II). There were 6 single mutations and 3 double mutations which were most frequently found in MYBPC3 and MYH7 with a prevalence of 38.5% (5/13) and 23.1% (3/13), respectively. Other variants, including TNNI3, SCN5A, GLA, TAZ, PRKAG2 and MYH6, were found in 53.8% (7/13) of the patients (Figs. 2 and 4). One novel single mutation in TAZ (p.Ile208Val) was found neither in the 1000 Genomes Project databases (http://www.1000genomes.org/) nor in the 100 healthy control chromosomes. One reported single mutation in MYH7 (p.Arg54Gln), considered as rare in the general population, was firstly found in a patient without familial HCM and did not exist in the databases and the control group mentioned above. The mutations identified in highly conserved amino acids among many species may have influenced the structure and function of the proteins (Fig. 5). Therefore, the predicted protein structure of a mutant MYH7 (p.Arg54Gln) was compared to the corresponding wild-type. The homology modeling analysis showed that the amino acid change resulted in the structural differences between the wild-type and mutant MYH7 (Figs. 5 and 6). In addition, the 3 double mutations were found in MYBPC3 (p.Gln998Glu) plus TNNI3 (p.Arg145Gly), PRKAG2 (p.Gly100Ser) plus MYBPC3 (p.Lys1209Serfs*28), and TNNI3 (p.Glu124Gln) plus GLA (p.Trp47*) (Table III and Fig. 2).

Figure 2

The genetic analyses of target gene mutations in patients from 6 pedigrees with familial hypertrophic cardiomyopathy (HCM) (families A, B, C, D, E and F). Squares, male family members; circles, female family members; open symbols, normal individuals; solid symbols, affected individuals; black arrow, proband; plus (+) signs, the presence of disease mutation; minus (−) signs, the absence of disease mutation. Both (+) and (−) indicate members for whom the PCR and Sanger sequencing validation were carried out.

Figure 4

Identification of potential disease mutations in hypertrophic cardiomyopathy (HCM). Nucleotide mutation sites are shown with arrows. (A) A double heterozygous mutation at the nucleotide position c. (730T>C, 732C>T) of the β-myosin heavy chain gene (MYH7) gene in HCM patient 8. (B) A mutation at the nucleotide position c.161G>A of the MYH7 gene in HCM patient A14. (C) A heterozygous mutation at the nucleotide position c.1087A>T of the α-myosin heavy chain (MYH6) gene in patient 9. (D) A heterozygous mutation at the nucleotide position c.3575G>A of the sodium channel, voltage-gated type V α-subunit (SCN5A) gene in patient 25 and 26.

Figure 5

As determined using Clustal W, (A and B) the synonymous mutations -p.Ile208Val and p.Arg54Gln involved an amino acid in tafazzin (TAZ) and β-myosin heavy chain (MYH7) genes that were highly conserved across many species, respectively.

Figure 6

The structure modeling of predicted β-myosin heavy chain gene (MYH7) with wild-type and mutant. (A and B) Wild-type MYH7 (codon 1 to 841) and mutant p.Arg54Gln, respectively. The wild-type and mutated site are emphasized by a red circle and are locally zoomed.

Table III

Mutations identified in target genes of the patients with HCM.

Table III

Mutations identified in target genes of the patients with HCM.

SubjectsGene nameAmino acid changeMutation typeProtein locationFrequency
A14MYH7p.Arg54GlnMissenseMyosin N-terminal SH3-like domain1
9MYH6p.Met363LeuMissenseClass II myosins, motor domain1
25, 26SCN5Ap.Arg1192GlnMissenseSodium ion transport-associated region2
8MYH7p.Phe244LeuMissenseMyosin motor domain1
Family A, III:2, III:4 and III:5; family C, III:1MYBPC3p.Gln998GluMissenseIg-like C2-type 64
Family B, II:1MYH7p.Arg858CysMissenseTropomyosin1
Family C, III:1TNNI3p.Arg145GlyMissenseTroponin1
Family F, II:1TAZp.Ile208ValMissense LPLAT_AGPAT-like1
Family D, III:1MYBPC3 p.Lys1209Serfs*28Frame shiftIg-like C2-type 71
Family D, III:1PRKAG2p.Gly100SerMissenseN-terminal binding1
Family E, II:1GLAp.Trp47*Terminationα-galactohydrolase activity1
Family E, II:1TNNI3p.Glu124GlnMissenseCardiac troponin C-binding domain1

[i] MYH7, β-myosin heavy chain gene; SCN5A, sodium channel, voltage-gated type V α-subunit gene; TNNI3, troponin I 3 gene; GLA, α-galactosidase A gene; MYBPC3, myosin binding protein C gene; PRKAG2, AMP-activated protein kinase; TAZ, tafazzin.

Mutations and phenotypes of patients with familial HCM

Family A, B and F were of the Han ethnic group; family C, D and E were of the Yi, Naxi and Pumi ethnic groups, respectively. Our results showed that 3 single mutations and 3 double mutations were found in 6 pedigrees with familial HCM (Fig. 2). A 28-year-old male HCM patient, experiencing palpitation and chest tightness, was found to carry a novel mutation (TAZ, p.Ile208Val). A mutation of p.Gln998Glu in MYBPC3 was detected in a proband patient (family A, III:5) who was diagnosed as having HCM at age 34, with intermittent chest tightness and shortness of breath, and a typical thick IVST (22 mm). His 2-year-older sisters were respectively diagnosed as HCM patients at age 36 and 42 years, and his father and grandmother had undergone sudden death. Another proband (family B, II:1) having MYH7 p.Arg858Cys was diagnosed as HCM at age 23 years and experienced chest pain, but his father and mother did not have disease phenotype. More importantly, the third proband (family C, III:1) carrying a double mutation (MYBPC3, p.Gln998Glu plus TNNI3, p.Arg145Gly) had a greater IVST (18.8; >15 mm), and his father, aunt and female cousin were diagnosed with HCM a fewer years ago. A proband (family D, III:1) carrying a double mutation (PRKAG2, p.Gly100Ser plus MYBPC3, p.Lys1209Serfs*28) was diagnosed with HCM at age 26, and his mother and grandmother had undergone sudden cardiac death. A proband (family E, II:1) carrying a double mutation (TNNI3, p.Glu124Gln plus GLA, p.Trp47*) presented with heart failure at age 47 years, and the echocardiography showed that he had a high IVST (Figs. 2 and 3A).

Figure 3

Two-dimensional echocardiography of hypertrophic cardiomyopathy (HCM) patients. (A and B) The echocardiogram of the four chambers of proband family F (patient II: 1) and patient A14, respectively. White arrows indicate areas of hypertrophy.

Discussion

In the present study, we described the molecular characterization of 18 HCM patients in Yunnan Province via targeted NGS technology. A total of 383 variants were identified with an average read depth of 165.4-fold (Fig. 1). Generally, a read of a targeted nucleotide with read depth ≥30× reads was considered as qualified (17,18). By filtering out synonymous variations of the targeted genes, 86 qualified non-synonymous variations were obtained (data available upon request). This indicated the feasibility of NGS for genetic testing of 19 HCM-targeted genes.

There were 12 mutations identified in 13 HCM patients (Table III). The overall genetic diagnostic rate was 72.2% (13/18) and the frequency of disease-causing mutations in the HCM cohort were much higher than previous documentations (22–24), including an American cohort (54.2%), French cohort (60.6%) and Japanese cohort (67%) (25–27). Mutations in the MYBPC3 gene were the most prevalent that were detected in 5 of the 13 patients (38.5%). It has been reported that mutations in the MYBPC3 gene are present in close to 20–30% of HCM cases (4,20,28), and our results were consistent with these previous studies. The second most prevalent mutations were found in MYH7 in 3 patients (3/13, 23.1%), which were followed by mutations in TNNI3 (15.4%). The respective mutation rate of SCN5A, PRKAG2, MYH6, TAZ and GLA genes was close to 7.7%.

It is noteworthy that two single mutations were found for the first time in HCM patients. One in TAZ (p.Ile208Val) was novel and was found in a familial HCM male patient of 28 years. The other single mutation was in MYH7 (p.Arg54Gln), which has been rarely reported in the general population but had not been previously found in HCM patients. This mutation had a very low minor allele frequency (1/60,659) in ExAC browser Beta database (http://exac.broadinstitute.org/). Both TAZ (p.Ile208Val) and MYH7 (p.Arg54Gln) mutations resulted in polarity changes in the altered amino acids and these 2 mutations were not detected in 200 normal chromosomes. It has been speculated that these mutations may have a significant impact on the structure and function of the corresponding proteins. Indeed, the homology modeling analysis showed that, compared to wild-type MYH7, the structure of mutant MYH7 was altered at the mutated site. More detailed data are needed to detect whether these mutations influence the pathogenicity of HCM.

In the 6 pedigrees with familial HCM, 3 of them (50%) were found to carry double mutations, which were firstly discovered in this study. These double mutations were in MYBPC3 (p.Gln998Glu) plus TNNI3 (p.Arg145Gly), PRKAG2 (p.Gly100Ser) plus MYBPC3 (p.Lys1209Serfs*28), and TNNI3 (p.Glu124Gln) plus GLA (p.Trp47*), respectively. According to previous literature, ~15% of familial HCM patients carry a double heterozygous mutation (29), which was far less than our results. This implies that special molecular genetic mechanisms exist in Yunnan patients with familial HCM. There are 26 ethnic groups in Yunnan Province and consanguineous marriages are widely acceptable. The higher consanguineous marriage percentage than that of the same groups in developed regions of China (30) has led to the accumulation of defective gene mutations making the offspring at higher disease risks.

Of these 18 patients, the relationships between the phenotype and the genetics of HCM in familial HCM patients carrying double mutations were further analyzed. The 27-year-old patient (family C, III:1) showed a severe phenotype (IVST=22.8 mm), and had double mutations in MYBPC3 (p.Gln998Glu) plus TNNI3 (p.Arg145Gly). A 'double dose effect' of gene mutation (15) was speculated to lead to a more malignant clinical phenotype and an early onset of HCM. The patient (family D, III:1) with the PRKAG2 (p.Gly100Ser) plus MYBPC3 (p.Lys1209Serfs*28) mutations was characterized as having relatively severe hypertrophy and an early onset of HCM, the same feature of the patient from family E (TNNI3, p.Glu124Gln plus GLA, p.Trp47*). The TNNI3 (p.Glu124Gln) mutation was originally reported in Taiwanese patients with familial HCM (29). The Taiwanese are the descendants of early settlers from the southeast coast of China during the last few centuries (31). The present study showed its second appearance in Chinese HCM patient. Moreover, the children of HCM probands (family C, III:1; family D, III:1; and family E, II:1) would have a higher risk rate of this disease and similar mutations. According to our results, it is recommended that these probands should implement prenatal screening for the mutations of MYBPC3, p.Gln998Glu plus TNNI3, p.Arg145Gly; PRKAG2, p.Gly100Ser plus MYBPC3, p.Lys1209Serfs*28; and TNNI3, p.Glu124Gln plus GLA, p.Trp47*, respectively. For family B, the proband (II:1, 23 years of age) with the MYH7, p.Arg858Cys mutation did not show a severe phenotype, but his parents had no disease phenotype and the genetic testing was negative. This suggests that MYH7 (p.Arg858Cys) is a de novo mutation.

This study described the mutational spectrum of patients with HCM in Yunnan, China. However, the number of HCM patients was limited and the obtained clinical data were not consistent for all subjects. A large-scale study of HCM patients in Yunnan is needed to further confirm our results.

In conclusion, in the present study, 2 single and 3 double mutations were firstly found in HCM patients. The 3 double mutations were detected in different ethnic groups and a novel single mutation was found in TAZ (p.Ile208Val). The mutation in MYH7 (p.Arg54Gln), previously reported as being rare in the general population and having a very low minor allele frequency, was found in a female patient without familial HCM. Our results add new data to the mutational spectrum of Yunnan HCM patients. It provides useful information for the presymptomatic intervention of HCM and the management of patients with familial HCM.

Acknowledgments

The authors would like to thank the staff of the First People's Hospital of Yunnan Province for providing their support. The present study was supported by the New Products Project of Yunnan Province, China (grant no. 2016BC003) and Major Program of Applied Basic Research of Yunnan Province, China (grant no. 2013FC007).

References

1 

Ackerman MJ, Priori SG, Willems S, Berul C, Brugada R, Calkins H, Camm AJ, Ellinor PT, Gollob M, Hamilton R, et al Heart Rhythm Society (HRS); European Heart Rhythm Association (EHRA): HRS/EHRA expert consensus statement on the state of genetic testing for the channelopathies and cardiomyopathies: This document was developed as a partnership between the Heart Rhythm Society (HRS) and the European Heart Rhythm Association (EHRA). Europace. 13:1077–1109. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Zou Y, Song L, Wang Z, Ma A, Liu T, Gu H, Lu S, Wu P, Zhang Y, Shen L, et al: Prevalence of idiopathic hypertrophic cardiomyopathy in China: A population-based echocardiographic analysis of 8080 adults. Am J Med. 116:14–18. 2004. View Article : Google Scholar : PubMed/NCBI

3 

Geisterfer-Lowrance AA, Kass S, Tanigawa G, Vosberg HP, McKenna W, Seidman CE and Seidman JG: A molecular basis for familial hypertrophic cardiomyopathy: A beta cardiac myosin heavy chain gene missense mutation. Cell. 62:999–1006. 1990. View Article : Google Scholar : PubMed/NCBI

4 

Pinto YM, Wilde AA, van Rijsingen IA, Christiaans I, Deprez RH and Elliott PM: Clinical utility gene card for: Hypertrophic cardiomyopathy (type 1–14). Eur J Hum Genet. 19:192011. View Article : Google Scholar

5 

Seidman CE and Seidman JG: Identifying sarcomere gene mutations in hypertrophic cardiomyopathy: A personal history. Circ Res. 108:743–750. 2011. View Article : Google Scholar : PubMed/NCBI

6 

Brauch KM, Karst ML, Herron KJ, de Andrade M, Pellikka PA, Rodeheffer RJ, Michels VV and Olson TM: Mutations in ribonucleic acid binding protein gene cause familial dilated cardiomyopathy. J Am Coll Cardiol. 54:930–941. 2009. View Article : Google Scholar : PubMed/NCBI

7 

Zhao Y, Feng Y, Zhang YM, Ding XX, Song YZ, Zhang AM, Liu L, Zhang H, Ding JH and Xia XS: Targeted next-generation sequencing of candidate genes reveals novel mutations in patients with dilated cardiomyopathy. Int J Mol Med. 36:1479–1486. 2015.PubMed/NCBI

8 

Gómez J, Reguero JR, Morís C, Martín M, Alvarez V, Alonso B, Iglesias S and Coto E: Mutation analysis of the main hyper-trophic cardiomyopathy genes using multiplex amplification and semiconductor next-generation sequencing. Circ J. 78:2963–2971. 2014. View Article : Google Scholar

9 

Wu W, Lu CX, Wang YN, Liu F, Chen W, Liu YT, Han YC, Cao J, Zhang SY and Zhang X: Novel phenotype-genotype correlations of restrictive cardiomyopathy with myosin-binding protein C (MYBPC3) gene mutations tested by next-generation sequencing. J Am Heart Assoc. 4:42015.

10 

Mango R, Luchetti A, Sangiuolo R, Ferradini V, Briglia N, Giardina E, Ferrè F, Helmer Citterich M, Romeo F, Novelli G, et al: Next heneration sequencing and linkage analysis for the molecular diagnosis of a novel overlapping syndrome characterized by hypertrophic cardiomyopathy and typical electrical instability of Brugada syndrome. Circ J. 80:938–949. 2016. View Article : Google Scholar

11 

Glotov AS, Kazakov SV, Zhukova EA, Alexandrov AV, Glotov OS, Pakin VS, Danilova MM, Poliakova IV, Niyazova SS, Chakova NN, et al: Targeted next-generation sequencing (NGS) of nine candidate genes with custom AmpliSeq in patients and a cardiomyopathy risk group. Clin Chim Acta. 446:132–140. 2015. View Article : Google Scholar : PubMed/NCBI

12 

Millat G, Chanavat V and Rousson R: Evaluation of a new NGS method based on a custom AmpliSeq library and Ion Torrent PGM sequencing for the fast detection of genetic variations in cardiomyopathies. Clin Chim Acta. 433:266–271. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Zhang J, He J, Zeng XH, Ge SJ, Huang Y, Su J, Ding XM, Yang JQ, Cao YJ, Chen H, et al: Genetic heterogeneity of the β-globin gene in various geographic populations of Yunnan in southwestern China. PLoS One. 10:e01229562015. View Article : Google Scholar

14 

Zhao Y, Feng Y, Zhang YM, Ding XX, Song YZ, Zhang AM, Liu L, Zhang H, Ding JH and Xia XS: Targeted next-generation sequencing reveals hot spots and doubly heterozygous mutations in chinese patients with familial Cardiomyopathy. BioMed Res Int. 2015:5618192015.PubMed/NCBI

15 

Zhao Y, Cao H, Song Y, Feng Y, Ding X, Pang M, Zhang Y, Zhang H, Ding J and Xia X: Identification of novel mutations including a double mutation in patients with inherited cardiomyopathy by a targeted sequencing approach using the Ion Torrent PGM system. Int J Mol Med. 37:1511–1520. 2016.PubMed/NCBI

16 

Gersh BJ, Maron BJ, Bonow RO, Dearani JA, Fifer MA, Link MS, Naidu SS, Nishimura RA, Ommen SR, Rakowski H, et al American College of Cardiology Foundation/American Heart Association Task Force on Practice Guidelines: 2011 ACCF/AHA Guideline for the Diagnosis and Treatment of Hypertrophic Cardiomyopathy: a report of the American College of Cardiology Foundation/American Heart Association Task Force on Practice Guidelines. Developed in collaboration with the American Association for Thoracic Surgery, American Society of Echocardiography, American Society of Nuclear Cardiology, Heart Failure Society of America, Heart Rhythm Society, Society for Cardiovascular Angiography and Interventions, and Society of Thoracic Surgeons. J Am Coll Cardiol. 58:e212–e260. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Sikkema-Raddatz B, Johansson LF, de Boer EN, Almomani R, Boven LG, van den Berg MP, van Spaendonck-Zwarts KY, van Tintelen JP, Sijmons RH, Jongbloed JD, et al: Targeted next-generation sequencing can replace Sanger sequencing in clinical diagnostics. Hum Mutat. 34:1035–1042. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Tarabeux J, Zeitouni B, Moncoutier V, Tenreiro H, Abidallah K, Lair S, Legoix-Né P, Leroy Q, Rouleau E, Golmard L, et al: Streamlined ion torrent PGM-based diagnostics: BRCA1 and BRCA2 genes as a model. Eur J Hum Genet. 22:535–541. 2014. View Article : Google Scholar :

19 

Maron BJ, Maron MS and Semsarian C: Genetics of hypertrophic cardiomyopathy after 20 years: Clinical perspectives. J Am Coll Cardiol. 60:705–715. 2012. View Article : Google Scholar : PubMed/NCBI

20 

Liu X, Jiang T, Piao C, Li X, Guo J, Zheng S, Zhang X, Cai T and Du J: Screening Mutations of MYBPC3 in 114 Unrelated Patients with Hypertrophic Cardiomyopathy by Targeted Capture and Next-generation Sequencing. Sci Rep. 5:114112015. View Article : Google Scholar : PubMed/NCBI

21 

Schwarz JM, Rödelsperger C, Schuelke M and Seelow D: MutationTaster evaluates disease-causing potential of sequence alterations. Nat Methods. 7:575–576. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Zou Y, Wang J, Liu X, Wang Y, Chen Y, Sun K, Gao S, Zhang C, Wang Z, Zhang Y, et al: Multiple gene mutations, not the type of mutation, are the modifier of left ventricle hypertrophy in patients with hypertrophic cardiomyopathy. Mol Biol Rep. 40:3969–3976. 2013. View Article : Google Scholar : PubMed/NCBI

23 

Millat G, Bouvagnet P, Chevalier P, Dauphin C, Jouk PS, Da Costa A, Prieur F, Bresson JL, Faivre L, Eicher JC, et al: Prevalence and spectrum of mutations in a cohort of 192 unrelated patients with hypertrophic cardiomyopathy. Eur J Med Genet. 53:261–267. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Arai S, Matsuoka R, Hirayama K, Sakurai H, Tamura M, Ozawa T, Kimura M, Imamura S, Furutani Y, Joho K, et al: Missense mutation of the beta-cardiac myosin heavy-chain gene in hypertrophic cardiomyopathy. Am J Med Genet. 58:267–276. 1995. View Article : Google Scholar : PubMed/NCBI

25 

Van Driest SL, Vasile VC, Ommen SR, Will ML, Tajik AJ, Gersh BJ and Ackerman MJ: Myosin binding protein C mutations and compound heterozygosity in hypertrophic cardiomyopathy. J Am Coll Cardiol. 44:1903–1910. 2004. View Article : Google Scholar : PubMed/NCBI

26 

Richard P, Charron P, Carrier L, Ledeuil C, Cheav T, Pichereau C, Benaiche A, Isnard R, Dubourg O, Burban M, et al: EUROGENE Heart Failure Project: Hypertrophic cardiomyopathy: Distribution of disease genes, spectrum of mutations, and implications for a molecular diagnosis strategy. Circulation. 107:2227–2232. 2003. View Article : Google Scholar : PubMed/NCBI

27 

Kubo T, Kitaoka H, Okawa M, Baba Y, Hirota T, Hayato K, Yamasaki N, Matsumura Y, Otsuka H, Arimura T, et al: Genetic screening and double mutation in Japanese patients with hypertrophic cardiomyopathy. Circ J. 75:2654–2659. 2011. View Article : Google Scholar : PubMed/NCBI

28 

Emrahi L, Tabrizi MT, Gharehsouran J, Ardebili SM and Estiar MA: Spectrum of MYBPC3 gene mutations in patients with hypertrophic cardiomyopathy, reporting two novel mutations from north-west of Iran. Clin Lab. 62:757–764. 2016. View Article : Google Scholar : PubMed/NCBI

29 

Chiou KR, Chu CT and Charng MJ: Detection of mutations in symptomatic patients with hypertrophic cardiomyopathy in Taiwan. J Cardiol. 65:250–256. 2015. View Article : Google Scholar

30 

Honglin W: An investigation on consanguineous marriage in nine ethnic groups of Yunnan province. Acta Anthropologica Sinica. 4:0121998.

31 

Lin M, Chu CC, Chang SL, Lee HL, Loo JH, Akaza T, Juji T, Ohashi J and Tokunaga K: The origin of Minnan and Hakka, the so-called 'Taiwanese', inferred by HLA study. Tissue Antigens. 57:192–199. 2001. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhao Y, Feng Y, Ding X, Dong S, Zhang H, Ding J and Xia X: Identification of a novel hypertrophic cardiomyopathy-associated mutation using targeted next-generation sequencing. Int J Mol Med 40: 121-129, 2017.
APA
Zhao, Y., Feng, Y., Ding, X., Dong, S., Zhang, H., Ding, J., & Xia, X. (2017). Identification of a novel hypertrophic cardiomyopathy-associated mutation using targeted next-generation sequencing. International Journal of Molecular Medicine, 40, 121-129. https://doi.org/10.3892/ijmm.2017.2986
MLA
Zhao, Y., Feng, Y., Ding, X., Dong, S., Zhang, H., Ding, J., Xia, X."Identification of a novel hypertrophic cardiomyopathy-associated mutation using targeted next-generation sequencing". International Journal of Molecular Medicine 40.1 (2017): 121-129.
Chicago
Zhao, Y., Feng, Y., Ding, X., Dong, S., Zhang, H., Ding, J., Xia, X."Identification of a novel hypertrophic cardiomyopathy-associated mutation using targeted next-generation sequencing". International Journal of Molecular Medicine 40, no. 1 (2017): 121-129. https://doi.org/10.3892/ijmm.2017.2986
Copy and paste a formatted citation
x
Spandidos Publications style
Zhao Y, Feng Y, Ding X, Dong S, Zhang H, Ding J and Xia X: Identification of a novel hypertrophic cardiomyopathy-associated mutation using targeted next-generation sequencing. Int J Mol Med 40: 121-129, 2017.
APA
Zhao, Y., Feng, Y., Ding, X., Dong, S., Zhang, H., Ding, J., & Xia, X. (2017). Identification of a novel hypertrophic cardiomyopathy-associated mutation using targeted next-generation sequencing. International Journal of Molecular Medicine, 40, 121-129. https://doi.org/10.3892/ijmm.2017.2986
MLA
Zhao, Y., Feng, Y., Ding, X., Dong, S., Zhang, H., Ding, J., Xia, X."Identification of a novel hypertrophic cardiomyopathy-associated mutation using targeted next-generation sequencing". International Journal of Molecular Medicine 40.1 (2017): 121-129.
Chicago
Zhao, Y., Feng, Y., Ding, X., Dong, S., Zhang, H., Ding, J., Xia, X."Identification of a novel hypertrophic cardiomyopathy-associated mutation using targeted next-generation sequencing". International Journal of Molecular Medicine 40, no. 1 (2017): 121-129. https://doi.org/10.3892/ijmm.2017.2986
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team