Anti‑apoptotic effects of glycosaminoglycans via inhibition of ERK/AP‑1 signaling in TNF‑α‑stimulated human dermal fibroblasts

  • Authors:
    • Jungtae Na
    • Dong‑Ho Bak
    • Song I Im
    • Hyangtae Choi
    • Jung Hyun Hwang
    • Su Yeon Kong
    • Yeon A No
    • Yonghee Lee
    • Beom Joon Kim
  • View Affiliations

  • Published online on: February 12, 2018     https://doi.org/10.3892/ijmm.2018.3483
  • Pages: 3090-3098
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

It has been established that glycosaminoglycans (GAGs) serve an important role in protecting the skin against the effects of aging. A previous clinical trial by our group identified that a cream containing GAGs reduced wrinkles and increased skin elasticity, dermal density and skin tightening. However, the exact molecular mechanism underlying the anti‑aging effect of GAGs has not yet been fully elucidated. The present study assessed the influence of GAGs on cell viability, collagen synthesis and collagen synthesis‑associated signaling pathways in tumor necrosis factor‑α (TNF‑α)‑stimulated human dermal fibroblasts (HDFs); an in vitro model of aging. The results demonstrated that GAGs restored type I collagen synthesis and secretion by inhibiting extracellular signal‑regulated kinase (ERK) signaling in TNF‑α‑stimulated HDFs. However, GAGs did not activate c‑jun N‑terminal kinase or p38. It was determined that GAGs suppressed the phosphorylation of downstream transcription factors of ERK activation, activator protein‑1 (AP‑1; c‑fos and c‑jun), leading to a decrease in matrix metalloproteinase‑1 (MMP‑1) levels and the upregulation of tissue inhibitor of metalloproteinase‑1 in TNF‑α‑stimulated HDFs. In addition, GAGs attenuated the apoptosis of HDFs induced by TNF‑α. The current study revealed a novel mechanism: GAGs serve a crucial role in ameliorating TNF‑α‑induced MMP‑1 expression, which causes type I collagen degeneration via the inactivation of ERK/AP‑1 signaling in HDFs. The results of the present study indicate the potential application of GAGs as effective anti‑aging agents that induce wrinkle reduction.

Introduction

Collagen degradation is the primary cause of skin aging. The modulation of collagen synthesis/degradation is thus a pivotal target for anti-wrinkle agents. Glycosaminoglycans (GAGs) are highly charged polysaccharides that are an important structural component of the extracellular matrix (ECM) and are often used in cosmetic products (1-3). In a previous clinical trial, it was identified that a cream containing GAGs regulated wrinkles, skin elasticity, dermal density and skin tightening (4). However, although GAGs serve important roles in skin aging, their regulatory mechanism of action has not yet been fully elucidated.

Skin wrinkles develop as a result of intrinsic and extrinsic aging processes (5,6). Intrinsic aging, which is characterized by a smooth, thinned epidermis that exhibits fine wrinkles, naturally occurs over time and is dependent on the accumulation of inflammatory mediators. Extrinsic aging, characterized by a roughened texture, skin laxity and mottled pigmentation with deep wrinkles, occurs due to solar irradiation, smoking and poor nutrition (7,8). These alterations may also be caused by ECM destruction as a dermal fibroblast aging that occur during intrinsic and extrinsic aging (9). Dermal fibroblasts serve an important role in the production of ECM, including the production of ground substance, collagen fibers and elastins (10). Therefore, the disruption of fibroblast function affects the mechanical properties of skin connective tissue. Inflammatory mediators, including cytokines, serve a crucial role in stimulating skin aging (11). The expression of a gene cluster associated with inflammation (12) and the quantity of halogenated tyrosine produced following inflammation are increased in aging skin (13). Specifically, exposure to ultraviolet B promotes the production of tumor necrosis factor (TNF)-α from dermal fibroblasts, macrophages and epidermal keratinocytes, resulting in increased inflammation and the degradation of ECM components via the activation of matrix metalloproteinases (MMPs) (14-18). Sustained exposure to TNF-α induces the expression of MMP-1, MMP-3 and MMP-9 (also known as collagenase, stromelysin and gelatinase, respectively), causing irreparable damage to the epidermis and dermis (19-21). In particular, MMP-1 activation in dermal fibroblasts may cause collagen fragmentation and functional alterations in dermal fibroblasts (22). Thus, regulating TNF-α activity may be a novel therapeutic strategy of treating inflammatory skin diseases and reversing skin aging.

Type I collagen, the primary component of ECM in the skin, is synthesized and secreted by dermal fibroblasts. Type I collagen is responsible for the strength and elasticity of skin (23). In addition to aging, the stimulation of various cytoplasmic signal transduction pathways, including transforming growth factor (TGF)-β/Smad, mitogen-activated protein kinase (MAPK) and nuclear factor (NF)-κB, cause fibroblasts to lose their proliferative potential. Fibroblasts then synthesize reduced levels of ECM, meaning that the secretion of type I collagen is also reduced (24-28). Impairments in dermal fibroblast functions during aging contribute to skin thinning, as they cause reductions in the quantity of collagen in aged human skin (29). Previous studies have demonstrated that various MAPKs, including extracellular signal-regulated kinase (ERK), c-jun N-terminal kinase (JNK) and p38, are associated with skin aging (26,30-32). The phosphorylation of ERK 1/2 mediates the inhibition of type I collagen synthesis in human skin fibroblasts (32,33). TNF-α increases MMP-1 expression via MAPK and activator protein-1 (AP-1) pathways in rheumatoid arthritis synovial fibroblasts (34) and HCS-2/8 chondrocytes (35). Furthermore, it has been demonstrated that compound K suppresses ERK activation, resulting in reduced MMP-1 secretion and increased type I procollagen secretion in TNF-α-stimulated human skin fibroblasts, suggesting that compound K acts as an anti-aging agent (36). However, to the best of our knowledge, there have been no previous studies assessing the ability of GAGs on attenuating TNF-α-induced type I collagen denaturation or the molecular mechanisms underlying the anti-inflammatory effects in human dermal fibroblasts.

The present study assessed the effect of GAGs on the collagen synthesis process in TNF-α-stimulated human dermal fibroblasts (HDFs). The results demonstrated that the molecular mechanism underlying the inhibitory effect of GAGs is associated with the inhibition of ERK/AP-1 signaling. These data indicate that GAGs may serve a critical role in the attenuation of skin inflammation and aging.

Materials and methods

Materials

Recombinant human TNF-α (cat. no. RC214-12) was purchased from Bio Basic, Inc. (Markham, ON, Canada). PD98059 (cat. no. P215) was purchased from Sigma-Aldrich; Merck KGaA (Darmstadt, Germany). Antibodies against phosphorylated (p)-ERK (cat. no. #9101), ERK (cat. no. #9102), p-p38 (cat. no. #4511), p38 (cat. no. #9212), JNK (cat. no. #9252), p-c-fos (cat. no. #5348), c-fos (cat. no. #2250), p-c-jun (cat. no. #9164), c-jun (cat. no. #9165), total caspase-3 (cat. no. #9662), cleaved caspase-3 (cat. no. #9662) and TIMP-1 (cat. no. #8946) were all purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA). The antibody against MMP-1 (cat. no. ab137332) was purchased from Abcam (Cambridge, UK) and the antibodies against Bax (cat. no. sc-7480), Bcl-2 (cat. no. sc-492) and β-actin (cat. no. sc-47778) were purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA). The antibody against collagen type I (cat. no. NB600-408) was purchased from Novus Biologicals, LLC (Littleton, CO, USA) and the antibody against p-JNK (cat. no. 612541) was purchased from BD Transduction Laboratories; BD Biosciences (Franklin Lakes, NJ, USA). GAG complexes were provided by Taeyoung cosmetics (Elensilia, Seongnam, Korea).

Cell cultures and cell viability assay

HDFs were obtained by skin biopsy from one healthy male donor aged 12 years old on September 2014 (Chung-Ang University Hospital, Seoul, Seoul, Korea). The present study was approved by the Ethical Committee of Chung-Ang University Hospital. Written informed consent was obtained from the legal guardians of the donor prior to enrolment. Primary explant cultures were established in 60-cm2 culture flasks in Dulbecco's modified Eagle's medium (DMEM; Welgene, Inc., Gyeongsan, Korea) supplemented with 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA), 100 U/ml penicillin and 10 μg/ml streptomycin. HDFs were maintained at 37°C in a humidified atmosphere of 95% air and 5% CO2. HDFs at passages 3-8 were used for experiments. To investigate the effect of GAGs, HDFs were pretreated with GAGs (0, 0.1, 0.5, and 1%) for 30 min and were then stimulated with TNF-α (20 ng/ml) for 24 h. Cell viability was determined using an MTT assay following the method described by Twentyman and Luscombe (37), with minor modifications. HDFs were seeded at a density of 5×104 cells/well in 24-well plates. Prior to treatment, cells were cultured for 24 h in serum-free DMEM, which was followed by treatment with GAGs (0, 0.1, 0.5, and 1%) for 24 h. HDFs were then incubated with 5 mg/ml MTT for 4 h prior to addition of dimethyl sulfoxide (Sigma-Aldrich; Merck KGaA) was added to dissolve the formazan crystals. Following MTT assays, absorbance was measured at 570 nm using a SpectraMax i3 microplate reader (Molecular Devices, Sunnyvale, CA, USA).

Enzyme-linked immunosorbent assay (ELISA)

ELISA was performed using a procollagen type I C-peptide ELISA assay kit (cat. no. MK101; Takara Bio, Inc., Otsu, Japan) and an MMP-1 ELISA kit (cat. no. DY900-05; R&D Systems, Inc., Minneapolis, MN, USA) following the manufacturer's protocol. HDFs were pretreated with GAGs (0, 0.1, 0.5, and 1%) for 30 min and were then stimulated with TNF-α (20 ng/ml) for 24 h. Other HDFs were pretreated with 20 μM PD98059 (an ERK inhibitor) for 1 h and were then stimulated with TNF-α (20 ng/ml) for 24 h. Collected supernatants (obtained from conditioned media) were used for ELISA and relative absorbance was measured at 450 nm using the SpectraMax i3 microplate reader.

Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from HDFs using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc.). First-strand cDNA synthesis from the total RNA template was performed using the PrimeScript™ RT master mix (Takara Bio, Inc.). The reverse transcription product was subsequently diluted with 200 μl H2O. The resulting cDNA was subjected to quantitative PCR using TOPreal™ qPCR 2X PreMIX SYBR (Enzynomics, Daejeon, Korea) with a CFX-96 Touch™ Real-Time PCR Detection system (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The thermocycling conditions used to amplify all genes were as follows: 10 min at 95°C, 40 cycles of 95°C for 15 sec, 60°C for 30 sec and 72°C for 30 sec. Expression data were calculated from the cycle threshold (Cq) value using the ΔΔCq method of quantification (38). Gene expression values were normalized to the expression of GAPDH. The sequences of the oligonucleotide primers used for qPCR are presented in Table I.

Table I

Oligonucleotide primers used for quantitative polymerase chain reaction.

Table I

Oligonucleotide primers used for quantitative polymerase chain reaction.

GeneForward (5′-3′)Reverse (5′-3′)
GAPDH C ACCCACTCCTCCACCTTTGAC GTCCACCACCCTGTTGCTGTAG
COL1A1 ATCAACCGGAGGAATTTCCGT CACCAGGACGACCAGGTTTTC
MMP-1 GATGTGGCTCAGTTTGTCCTCAC C TTGGCAAATCTGGCGTGTAAT

[i] CoL1A1, collagen type I α-1; MMP-1, matrix metalloprotease-1.

Cell lysate preparation and western blot analysis

Cell extracts were prepared as described previously (39). Treated whole cell extracts were lysed in radioimmunoprecipitation buffer [50 mM Tris (pH 7.4), 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate] containing a protease inhibitor cocktail (Roche Diagnostics, Indianapolis, IN, USA). Protein concentrations were determined using a BCA assay kit (Thermo Fisher Scientific Inc.). For western blot analysis, cell lysates, each containing 20-30 μg protein, were resolved using 8-12% SDS-PAGE and were then transferred to polyvinylidene fluoride membranes. Membranes were soaked in 5% skim milk blocking buffer for 1 h at room temperature. Subsequently, membranes were incubated with anti-collagen I (1:1,000), anti-MMP-1 (1:2,500), anti-TIMP-1 (1:2,500), anti-p-ERK (1:2,500), anti-ERK (1:2,500), anti-p-p38 (1:2,500), anti-p38 (1:2,500), anti-p-JNK (1:2,500), anti-JNK (1:2,500), anti-p-c-Fos (1:2,500), anti-c-Fos (1:2,500), anti-p-c-Jun (1:2,500), anti-c-Jun (1:2,500), anti-Bax (1:1,000), anti-Bcl-2 (1:1,000), anti-total caspase-3 (1:2,500), anti-cleaved caspase-3 (1:2,500) and anti-β-actin (1:1,000; loading control) antibodies overnight at 4°C. Then, the membrane was incubated with anti-mouse (cat. no. PI-2000, 1:10,000), anti-rabbit (cat. no. PI-1000, 1:10,000; Vector Labs Inc., Burlingame, CA, USA) secondary antibodies conjugated to horseradish peroxidase for 1 h at room temperature. Membranes were developed using enhanced chemiluminescence western blot detection reagents (GE Healthcare, Chicago, IL, USA). Immunoblots were analyzed using ImageJ 1.44 software (National Institutes of Health, Bethesda, MD, USA).

Statistical analyses

All quantitative data are presented as the mean ± standard error of the mean for three independent experiments. Statistical analyses were performed using the statistical package for SPSS software version 10.0 (SPSS, Inc., Chicago, IL, USA). Differences between the two groups were evaluated using a paired t-test. For multiple comparisons, one-way analysis of variance was used followed by Tukey's multiple comparisons test. P<0.05 was considered to indicate a statistically significant result.

Results

GAGs regulate t ype I collagen production in TNF-α-stimulated human dermal fibroblasts

Firstly, to measure the cytotoxic effect of GAGs, HDFs were serially treated for 24 h with various concentrations of GAGs (0, 0.1, 0.5 and 1%). The results demonstrated that GAGs had no significant effect on cell viability at any of the tested concentrations (Fig. 1A). To identify the protective effect of GAGs against factors that influence skin aging, the effect of GAGs on TNF-α-induced type I collagen production in HDFs were assessed. HDFs were pretreated with GAGs for 30 min and were then stimulated with TNF-α (20 ng/ml) for 24 h. The expression of type I collagen decreased significantly following stimulation with TNF-α (Fig. 1B). However, treatment with GAGs significantly reversed this decrease in type I collagen expression in a dose-dependent manner (Fig. 1B and C). Furthermore, type I collagen secretion by HDFs following stimulation was significantly decreased; this decrease was reversed following treatment with GAGs (Fig. 1D). These results suggest that GAGs regulate the production of type I collagen in TNF-α-stimulated HDFs.

GAGs enhance type I collagen production via MMP-1 inhibition

The results demonstrated that GAGs reversed the reduction in type I collagen levels that occurred in TNF-α-stimulated HDFs (Fig. 1). The regulatory proteins of collagen degradation were further assessed as many enzymes, including MMPs and tissue inhibitors of metalloproteinase (TIMPs), are directly and indirectly involved in collagen type I degradation (40-43). The results demonstrated that GAGs inhibited MMP-1 gene activation (Fig. 2A and B) and also MMP-1 secretion (Fig. 2C) in TNF-α-stimulated HDFs in a dose-dependent manner. However, the expression of TIMP-1, a tissue inhibitor of metalloproteinases, decreased in TNF-α-stimulated HDFs, but increased following GAG treatment, peaking following treatment with 0.5% GAGs (Fig. 2B). Subsequently, the molecular mechanism by which MMP-1 production is inhibited in HDFs by GAGs following stimulation with TNF-α was assessed.

GAGs inhibit MMP-1 expression via suppression of the ERK signaling pathway

Previous studies have indicated that MAPK pathways, specifically those induced by TNF-α, serve an important role in the regulation of procollagen synthesis (26,30-32,35,44). Thus, the present study assessed TNF-α induced MAPK signaling. The results demonstrated that TNF-α activated the phosphorylation of ERK, JNK and p38, peaking at 30 min and then the signal gradually weakened (Fig. 3A). To determine whether GAGs suppressed the activation of MAPK, HDFs were pretreated for 30 min with GAGs (0, 0.1, 0.5 and 1%) and then stimulated with TNF-α for a further 30 min. The results demonstrated that GAGs attenuated ERK phosphorylation but did not affect the phosphorylation of JNK and p38 (Fig. 3B). In addition, GAGs markedly attenuated the phosphorylation of AP-1, including c-fos and c-jun, the major transcription factors downstream of ERK that are responsible for the expression of MMP-1 (Fig. 3C). The results confirmed that MMP-1 activation and type I collagen regulation is dependent on ERK signaling using the MEK/ERK inhibitor PD98059 in HDFs. Treatment with PD98059 (20 μM) significantly attenuated the upregulation of MMP-1 by TNF-α (Fig. 3D). Furthermore, treatment with PD98059 resulted in recovered type I collagen secretion (Fig. 3D). These results confirmed that GAGs inhibit MMP-1 expression via ERK inactivation, followed by an increase in type I collagen production.

GAGs inhibit the TNF-α-induced-apoptosis of HDFs

TNF-α is a pleiotropic cytokine with diverse cellular responses. TNF-α induces apoptosis in different types of cells, including fibroblasts (45-47). Therefore, the present study assessed whether GAGs inhibit TNF-α-induced HDF apoptosis. HDFs were pretreated with GAGs for 30 min and then stimulated with TNF-α for 24 h. Cell apoptosis was then evaluated by assessing the expression of the apoptosis-associated proteins caspase-3, Bcl-2-associated X protein (Bax) and B-cell lymphoma 2 (Bcl-2). Caspase-3 serves a key role in TNF-α-mediated apop-tosis (48,49). The results demonstrated that TNF-α stimulation markedly increased cleaved caspase-3 levels (as indicated by the bottom band on the western blot in Fig. 4A) and pro-apoptotic Bax levels. However, treatment with GAGs markedly abolished these increases (Fig. 4A). Additionally, GAGs treatment did not alter levels of the anti-apoptotic protein Bcl-2, but restored the Bax/Bcl-2 ratio following stimulation with TNF-α in HDFs, in a dose-dependent manner (Fig. 4A and B). These results indicate that GAGs protect HDFs against the apoptosis induced by TNF-α.

Discussion

The various anti-aging benefits of GAGs have contributed to their widespread inclusion in cosmetic and pharmaceutical products (50,51). GAGs, including hyaluronic acid, chondroitin sulfate, dermatan sulfate and keratan sulfate are abundant structural components of extracellular structures and regulate many biological processes, including cell growth, migration, differentiation, adhesion and lipid synthesis in the dermis and epidermis (1,52-56). The contents of GAGs change during intrinsic and extrinsic aging (57-60). Specifically, GAGs containing proteoglycans, including versican, decorin and biglycan, serve important roles in the synthesis and maintenance of collagen and elastin (61-64). It has been demonstrated that the removal of collagen-attached GAGs affects collagen-olysis via cathepsin K (65). However, few studies have reported the molecular mechanisms of GAGs underlying the anti-aging effects on the skin.

To the best of our knowledge, the present study is the first to demonstrate that GAGs significantly inhibit TNF-α-induced type I collagen denaturation in HDFs. It has been demonstrated that versican, a member of the chondroitin sulfate proteoglycan (PG) family, binds to collagens and controls fibril formation (64). In addition, deficiencies in decorin and biglycan, which are members of the dermatan sulfate PG family, cause abnormal collagen fibril formation and result in thin and fragile skin (61-63). The keratan sulfate PGs, lumican and fibromodulin, are also able to regulate the formation of collagen fibrils (66).

The molecular components of the ECM are remodeled by matrix metalloproteinases released from fibroblasts (67). Collagen degradation can be induced by MMP-1 and the expression and activity of MMP-1 may become elevated as a result of intrinsic and extrinsic aging (68,69). The present study demonstrated that GAGs inhibit the TNF-α-induced increase in MMP-1 expression in HDFs. However, the results demonstrated that levels of TIMP-1, an inhibitor of MMP-1, increased along with the concentration of GAGs in HDFs stimulated with TNF-α. The results of the present study therefore support the conclusion that MMPs and TIMPs are directly and indirectly involved in the synthesis of collagen type I (40-43).

The present study also assessed the upstream signal transduction pathways of collagen synthesis via the regulation of MMP-1 and TIMP-1. Previous studies have demonstrated that MAPK signaling pathways serve pivotal roles in controlling various cellular functions, including cell growth, MMP expression and collagen synthesis (26,30-32). In addition, several studies have revealed that MMP-1 expression is enhanced by activated MAPK in dermal fibroblasts following stimulation with particular stimuli (70,71). The present study demonstrated that GAG treatment resulted in the suppression of ERK phosphorylation (but not the phosphorylation of JNK or p38) in TNF-α-induced HDFs, leading to the reduced phosphorylation of AP-1. It has also demonstrated that tensile force induces the expression of type I collagen and MMP-1, and activates MAPKs in periodontal ligament fibroblasts (72). In particular, the inhibition of ERK, but not JNK or p38 MAPK, negatively regulates the tensile force-mediated activation of NF-κB and MMP-1 expression (72). The TNF-α-induced expression of MMP-9 was increased via the Ras/ERK-regulated activation of NF-κB and AP-1 in human vascular smooth muscle cells (73). In addition, various cytokines, including interleukin (IL)-1β, IL-6, IL-8 and inducible nitric oxide synthase induced by MAPKs, are involved in the inflammation associated with skin diseases (74,75). Thus, further studies are required to assess the anti-inflammatory effect of GAGs in skin diseases or in conditions associated with aging.

Finally, the current study confirmed the anti-apoptotic effects of GAGs in HDF stimulated with TNF-α. It has established that TNF-α stimulates a variety of responses, including inflammation and apoptosis in vitro and in vivo (76-78). The present study demonstrated that GAGs exert anti-apoptotic effects in HDFs stimulated with TNF-α. Furthermore, a previous study determined that TNF-α-induced ERK activation mediates p53 activation in apoptotic and autophagic L929 cells (79). In addition, PD98059 has been demonstrated to significantly reduced the cytotoxic effect of TNF-α in L929 and U251 cells (80).

In conclusion, the results of the current study indicate that GAGs serve an important role in type I collagen production. Specifically, GAGs reduced MMP-1 expression and elevated TIMP-1 expression by inhibiting the ERK/AP-1 cascade in TNF-α-stimulated HDFs. In addition, a protective effect of GAGs against cell apoptosis was observed. A previous study demonstrated that a cream comprised of GAGs positively regulated wrinkles, skin elasticity, dermal density and skin tightening in a clinical trial (4). Given that the expression of various proinflammatory cytokine/chemokines are significantly elevated and the expression of type I collagens is decreased in aged skin dermis, the current study suggests that GAGs may be used as anti-inflammatory and anti-aging agents for skin.

Acknowledgments

Not applicable.

Notes

[1] Funding

The present study was supported by Elensilia, Taeyoung Co., Korea (grant no. 20130994).

[2] Availability of data and materials

The analyzed data sets generated during the study are available from the corresponding author on reasonable request.

[3] Authors' contributions

BJK, YL, and JN designed the research. JN, DHB, and SII conducted the research. BJK, YL, JN, DHB, HC, JHH, SYK, and YAN analyzed the data. All authors read and approved the final manuscript.

[4] Ethical approval and consent to participate

The Ethical committee of Chung-Ang University Hospital Institute Review Board [IRB no. C2015051 (1509)] approved the present study. Written informed consent was obtained from the legal guardians of the donor prior to enrolment.

[5] Consent for publication

Not applicable.

[6] Competing interests

The authors declare that they have no competing interests.

References

1 

Chajra H, Auriol D, Joly F, Pagnon A, Rodrigues M, Allart S, Redziniak G and Lefevre F: Reactivating the extracellular matrix synthesis of sulfated glycosaminoglycans and proteoglycans to improve the human skin aspect and its mechanical properties. Clin Cosmet Investig Dermatol. 9:461–472. 2016. View Article : Google Scholar : PubMed/NCBI

2 

Kim YS, Jo YY, Chang IM, Toida T, Park Y and Linhardt RJ: A new glycosaminoglycan from the giant African snail Achatina fulica. J Biol Chem. 271:11750–11755. 1996. View Article : Google Scholar : PubMed/NCBI

3 

Shim JY, Lee YS, Jung SH, Choi HS, Shin KH and Kim YS: Pharmacological activities of a new glycosaminoglycan, acharan sulfate isolated from the giant African snail Achatina fulica. Arch Pharm Res. 25:889–894. 2002. View Article : Google Scholar

4 

Kim BJ, No YA, Lee Y, Kim MN, Hong CK, Yoo KH, Kim YM, Hwang JH and Kong SY: Use of cream containing mucus secreted by snails has an anti-aging effect on skin. Korean J Dermatol. 53:430–436. 2015.

5 

Zeng JP, Bi B, Chen L, Yang P, Guo Y, Zhou YQ and Liu TY: Repeated exposure of mouse dermal fibroblasts at a sub-cytotoxic dose of UVB leads to premature senescence: A robust model of cellular photoaging. J Dermatol Sci. 73:49–56. 2014. View Article : Google Scholar

6 

Gaur M, Dobke M and Lunyak VV: Mesenchymal stem cells from adipose tissue in clinical applications for dermatological indications and skin aging. Int J Mol Sci. 18:pii:E208. 2017. View Article : Google Scholar : PubMed/NCBI

7 

El-Domyati M, Attia S, Saleh F, Brown D, Birk DE, Gasparro F, Ahmad H and Uitto J: Intrinsic aging vs. photoaging: A comparative histopathological, immunohistochemical, and ultrastructural study of skin. Exp Dermatol. 11:398–405. 2002. View Article : Google Scholar : PubMed/NCBI

8 

Svobodová A, Psotová J and Walterová D: Natural phenolics in the prevention of UV-induced skin damage. A review. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 147:137–145. 2003. View Article : Google Scholar

9 

Fisher GJ, Varani J and Voorhees JJ: Looking older: Fibroblast collapse and therapeutic implications. Arch Dermatol. 144:666–672. 2008. View Article : Google Scholar : PubMed/NCBI

10 

Quan T and Fisher GJ: Role of Age-associated alterations of the dermal extracellular matrix microenvironment in human skin aging: A Mini-review. Gerontology. 61:427–434. 2015. View Article : Google Scholar : PubMed/NCBI

11 

Borg M, Brincat S, Camilleri G, Schembri-Wismayer P, Brincat M and Calleja-Agius J: The role of cytokines in skin aging. Climacteric. 16:514–521. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Chung JH, Seo AY, Chung SW, Kim MK, Leeuwenburgh C, Yu BP and Chung HY: Molecular mechanism of PPAR in the regulation of age-related inflammation. Ageing Res Rev. 7:126–136. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Ishitsuka Y, Maniwa F, Koide C, Kato Y, Nakamura Y, Osawa T, Tanioka M and Miyachi Y: Increased halogenated tyrosine levels are useful markers of human skin ageing, reflecting proteins denatured by past skin inflammation. Clin Exp Dermatol. 37:252–258. 2012. View Article : Google Scholar : PubMed/NCBI

14 

Bashir MM, Sharma MR and Werth VP: UVB and proinflammatory cytokines synergistically activate TNF-alpha production in keratinocytes through enhanced gene transcription. J Invest Dermatol. 129:994–1001. 2009. View Article : Google Scholar

15 

Agius E, Lacy KE, Vukmanovic-Stejic M, Jagger AL, Papageorgiou AP, Hall S, Reed JR, Curnow SJ, Fuentes-Duculan J, Buckley CD, et al: Decreased TNF-alpha synthesis by macrophages restricts cutaneous immunosurveillance by memory CD4+ T cells during aging. J Exp Med. 206:1929–1940. 2009. View Article : Google Scholar : PubMed/NCBI

16 

Dada LA and Sznajder JI: Mitochondrial Ca2+ and ROS take center stage to orchestrate TNF-α-mediated inflammatory responses. J Clin Invest. 121:1683–1685. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Han YP, Tuan TL, Wu H, Hughes M and Garner WL: TNF-alpha stimulates activation of pro-MMP2 in human skin through NF-(kappa)B mediated induction of MT1-MMP. J Cell Sci. 114:131–139. 2001.

18 

Buommino E, De Filippis A, Gaudiello F, Balato A, Balato N, Tufano MA and Ayala F: Modification of osteopontin and MMP-9 levels in patients with psoriasis on anti-TNF-α therapy. Arch Dermatol Res. 304:481–485. 2012. View Article : Google Scholar : PubMed/NCBI

19 

Youn UJ, Nam KW, Kim HS, Choi G, Jeong WS, Lee MY and Chae S: 3-Deoxysappanchalcone inhibits tumor necrosis factor-α-induced matrix metalloproteinase-9 expression in human keratinocytes through activated protein-1 inhibition and nuclear factor-kappa B DNA binding activity. Biol Pharm Bull. 34:890–893. 2011. View Article : Google Scholar

20 

Fisher GJ, Datta SC, Talwar HS, Wang ZQ, Varani J, Kang S and Voorhees JJ: Molecular basis of sun-induced premature skin ageing and retinoid antagonism. Nature. 379:335–339. 1996. View Article : Google Scholar : PubMed/NCBI

21 

Dasu MR, Barrow RE, Spies M and Herndon DN: Matrix metal-loproteinase expression in cytokine stimulated human dermal fibroblasts. Burns. 29:527–531. 2003. View Article : Google Scholar : PubMed/NCBI

22 

Xia W, Hammerberg C, Li Y, He T, Quan T, Voorhees JJ and Fisher GJ: Expression of catalytically active matrix metalloproteinase-1 in dermal fibroblasts induces collagen fragmentation and functional alterations that resemble aged human skin. Aging Cell. 12:661–671. 2013. View Article : Google Scholar : PubMed/NCBI

23 

Di Lullo GA, Sweeney SM, Korkko J, Ala-Kokko L and San Antonio JD: Mapping the ligand-binding sites and disease-associated mutations on the most abundant protein in the human, type I collagen. J Biol Chem. 277:4223–4231. 2002. View Article : Google Scholar

24 

Cho JW, Il KJ and Lee KS: Downregulation of type I collagen expression in silibinin-treated human skin fibroblasts by blocking the activation of Smad2/3-dependent signaling pathways: Potential therapeutic use in the chemoprevention of keloids. Int J Mol Med. 31:1148–1152. 2013. View Article : Google Scholar : PubMed/NCBI

25 

Helenius M, Mäkeläinen L and Salminen A: Attenuation of NF-kappaB signaling response to UVB light during cellular senescence. Exp Cell Res. 248:194–202. 1999. View Article : Google Scholar : PubMed/NCBI

26 

Jin MH, Park SG, Hwang YL, Lee MH, Jeong NJ, Roh SS, Lee Y, Kim CD and Lee JH: Cedrol enhances extracellular matrix production in dermal fibroblasts in a MAPK-dependent manner. Ann Dermatol. 24:16–21. 2012. View Article : Google Scholar : PubMed/NCBI

27 

Kim DS, Park SH and Park KC: Transforming growth factor-beta1 decreases melanin synthesis via delayed extracellular signal-regulated kinase activation. Int J Biochem Cell Biol. 36:1482–1491. 2004.PubMed/NCBI

28 

Lee DJ, Rosenfeldt H and Grinnell F: Activation of ERK and p38 MAP kinases in human fibroblasts during collagen matrix contraction. Exp Cell Res. 257:190–197. 2000. View Article : Google Scholar : PubMed/NCBI

29 

Uitto J: Connective tissue biochemistry of the aging dermis. Age-related alterations in collagen and elastin. Dermatol Clin. 4:433–446. 1986.PubMed/NCBI

30 

Katiyar SK and Meeran SM: Obesity increases the risk of UV radiation-induced oxidative stress and activation of MAPK and NF-kappaB signaling. Free Radic Biol Med. 42:299–310. 2007. View Article : Google Scholar

31 

Muthusamy V and Piva TJ: The UV response of the skin: A review of the MAPK, NFkappaB and TNFalpha signal transduction pathways. Arch Dermatol Res. 302:5–17. 2010. View Article : Google Scholar

32 

Ghosh AK: Factors involved in the regulation of type I collagen gene expression: Implication in fibrosis. Exp Biol Med. 227:301–314. 2002. View Article : Google Scholar

33 

Reunanen N, Foschi M, Han J and Kahari VM: Activation of extracellular signal-regulated kinase 1/2 inhibits type I collagen expression by human skin fibroblasts. J Biol Chem. 275:34634–34639. 2000. View Article : Google Scholar : PubMed/NCBI

34 

Yun HJ, Yoo WH, Han MK, Lee YR, Kim JS and Lee SI: Epigallocatechin-3-gallate suppresses TNF-alpha-induced production of MMP-1 and-3 in rheumatoid arthritis synovial fibroblasts. Rheumatol Int. 29:23–29. 2008. View Article : Google Scholar : PubMed/NCBI

35 

Fushimi K, Nakashima S, You F, Takigawa M and Shimizu K: Prostaglandin E2 downregulates TNF-alpha-induced production of matrix metalloproteinase-1 in HCS-2/8 chondrocytes by inhibiting Raf-1/MEK/ERK cascade through EP4 prostanoid receptor activation. J Cell Biochem. 100:783–793. 2007. View Article : Google Scholar

36 

Lee CS, Bae IH, Han J, Choi GY, Hwang KH, Kim DH, Yeom MH, Park YH and Park M: Compound K inhibits MMP-1 expression through suppression of c-Src-dependent ERK activation in TNF-α-stimulated dermal fibroblast. Exp Dermatol. 23:819–824. 2014. View Article : Google Scholar : PubMed/NCBI

37 

Twentyman PR and Luscombe M: A study of some variables in a tetrazolium dye (MTT) based assay for cell growth and chemo-sensitivity. Br J Cancer. 56:279–285. 1987. View Article : Google Scholar : PubMed/NCBI

38 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 25:402–408. 2001. View Article : Google Scholar

39 

Na J, Lee K, Na W, Shin JY, Lee MJ, Yune TY, Lee HK, Jung HS, Kim WS and Ju BG: Histone H3K27 demethylase JMJD3 in cooperation with NF-κB regulates keratinocyte wound healing. J Invest Dermatol. 136:847–858. 2016. View Article : Google Scholar : PubMed/NCBI

40 

Song KC, Chang TS, Lee H, Kim J, Park JH and Hwang GS: Processed panax ginseng, Sun ginseng increases type I collagen by regulating MMP-1 and TIMP-1 expression in human dermal fibroblasts. J Ginseng Res. 36:61–67. 2012. View Article : Google Scholar : PubMed/NCBI

41 

Xia W, Quan T, Hammerberg C, Voorhees JJ and Fisher GJ: A mouse model of skin aging: Fragmentation of dermal collagen fibrils and reduced fibroblast spreading due to expression of human matrix metalloproteinase-1. J Dermatol Sci. 78:79–82. 2015. View Article : Google Scholar : PubMed/NCBI

42 

Fisher GJ, Quan T, Purohit T, Shao Y, Cho MK, He T, Varani J, Kang S and Voorhees JJ: Collagen fragmentation promotes oxidative stress and elevates matrix metalloproteinase-1 in fibroblasts in aged human skin. Am J Pathol. 174:101–114. 2009. View Article : Google Scholar : PubMed/NCBI

43 

Majewska N, Zareba I, Surazynski A and Galicka A: Methylparaben-induced decrease in collagen production and viability of cultured human dermal fibroblasts. J Appl Toxicol. 37:1117–1124. 2017. View Article : Google Scholar : PubMed/NCBI

44 

Tsai CL, Chen WC, Lee IT, Chi PL, Cheng SE and Yang CM: c-Src-dependent transactivation of PDGFR contributes to TNF-α-induced MMP-9 expression and functional impairment in osteoblasts. Bone. 60:186–197. 2014. View Article : Google Scholar

45 

Laster SM, Wood JG and Gooding LR: Tumor necrosis factor can induce both apoptic and necrotic forms of cell lysis. J Immunol. 141:2629–2634. 1988.PubMed/NCBI

46 

Fehsel K, Kolb-Bachofen V and Kolb H: Analysis of TNF alpha-induced DNA strand breaks at the single cell level. Am J Pathol. 139:251–254. 1991.PubMed/NCBI

47 

Alikhani M, Alikhani Z, Raptis M and Graves DT: TNF-alpha in vivo stimulates apoptosis in fibroblasts through caspase-8 activation and modulates the expression of pro-apoptotic genes. J Cell Physiol. 201:341–348. 2004. View Article : Google Scholar : PubMed/NCBI

48 

Beyaert R, Kidd VJ, Cornelis S, Van de Craen M, Denecker G, Lahti JM, Gururajan R, Vandenabeele P and Fiers W: Cleavage of PITSLRE kinases by ICE/CASP-1 and CPP32/CASP-3 during apoptosis induced by tumor necrosis factor. J Biol Chem. 272:11694–11697. 1997. View Article : Google Scholar : PubMed/NCBI

49 

Jaeschke H, Fisher MA, Lawson JA, Simmons CA, Farhood A and Jones DA: Activation of caspase 3 (CPP32)-like proteases is essential for TNF-alpha-induced hepatic parenchymal cell apoptosis and neutrophil-mediated necrosis in a murine endotoxin shock model. J Immunol. 160:3480–3486. 1998.PubMed/NCBI

50 

Oh JH, Kim YK, Jung JY, Shin JE and Chung JH: Changes in glycosaminoglycans and related proteoglycans in intrinsically aged human skin in vivo. Exp Dermatol. 20:454–456. 2011. View Article : Google Scholar : PubMed/NCBI

51 

Lee DH, Oh JH and Chung JH: Glycosaminoglycan and proteoglycan in skin aging. J Dermatol Sci. 83:174–181. 2016. View Article : Google Scholar : PubMed/NCBI

52 

Carrino DA, Onnerfjord P, Sandy JD, Cs-Szabo G, Scott PG, Sorrell JM, Heinegård D and Caplan AI: Age-related changes in the proteoglycans of human skin. Specific cleavage of decorin to yield a major catabolic fragment in adult skin. J Biol Chem. 278:17566–17572. 2003. View Article : Google Scholar : PubMed/NCBI

53 

Zimmermann DR, Dours-Zimmermann MT, Schubert M and Bruckner-Tuderman L: Versican is expressed in the proliferating zone in the epidermis and in association with the elastic network of the dermis. J Cell Biol. 124:817–825. 1994. View Article : Google Scholar : PubMed/NCBI

54 

Knott A, Reuschlein K, Lucius R, Stäb F, Wenck H and Gallinat S: Deregulation of versican and elastin binding protein in solar elastosis. Biogerontology. 10:181–190. 2009. View Article : Google Scholar

55 

Bourguignon LY: Matrix hyaluronan-activated CD44 signaling promotes keratinocyte activities and improves abnormal epidermal functions. Am J Pathol. 184:1912–1919. 2014. View Article : Google Scholar : PubMed/NCBI

56 

Anderegg U, Simon JC and Averbeck M: More than just a filler-the role of hyaluronan for skin homeostasis. Exp Dermatol. 23:295–303. 2014. View Article : Google Scholar : PubMed/NCBI

57 

Oh JH, Kim YK, Jung JY, Shin JE, Kim KH, Cho KH, Eun HC and Chung JH: Intrinsic aging- and photoaging-dependent level changes of glycosaminoglycans and their correlation with water content in human skin. J Dermatol Sci. 62:192–201. 2011. View Article : Google Scholar : PubMed/NCBI

58 

Meyer LJ and Stern R: Age-dependent changes of hyaluronan in human skin. J Invest Dermatol. 102:385–389. 1994. View Article : Google Scholar : PubMed/NCBI

59 

Tzellos TG, Sinopidis X, Kyrgidis A, Vahtsevanos K, Triaridis S, Printza A, Klagas I, Karakiulakis G and Papakonstantinou E: Differential hyaluronan homeostasis and expression of proteoglycans in juvenile and adult human skin. J Dermatol Sci. 61:69–72. 2011. View Article : Google Scholar

60 

Willen MD, Sorrell JM, Lekan CC, Davis BR and Caplan AI: Patterns of glycosaminoglycan/proteoglycan immunostaining in human skin during aging. J Invest Dermatol. 96:968–974. 1991. View Article : Google Scholar : PubMed/NCBI

61 

Corsi A, Xu T, Chen XD, Boyde A, Liang J, Mankani M, Sommer B, Iozzo RV, Eichstetter I, Robey PG, et al: Phenotypic effects of biglycan deficiency are linked to collagen fibril abnormalities, are synergized by decorin deficiency, and mimic Ehlers-Danlos-like changes in bone and other connective tissues. J Bone Miner Res. 17:1180–1189. 2002. View Article : Google Scholar : PubMed/NCBI

62 

Danielson KG, Baribault H, Holmes DF, Graham H, Kadler KE and Iozzo RV: Targeted disruption of decorin leads to abnormal collagen fibril morphology and skin fragility. J Cell Biol. 136:729–743. 1997. View Article : Google Scholar : PubMed/NCBI

63 

Li Y, Xia W, Liu Y, Remmer HA, Voorhees J and Fisher GJ: Solar ultraviolet irradiation induces decorin degradation in human skin likely via neutrophil elastase. PLoS One. 8:e725632013. View Article : Google Scholar : PubMed/NCBI

64 

Carrino DA, Sorrell JM and Caplan AI: Age-related changes in the proteoglycans of human skin. Arch Biochem Biophys. 373:91–101. 2000. View Article : Google Scholar : PubMed/NCBI

65 

Panwar P, Butler GS, Jamroz A, Azizi P, Overall CM and Brömme D: Aging-associated modifications of collagen affect its degradation by matrix metalloproteinases. Matrix Biol. Jun 17–2017.Epub ahead of print. PubMed/NCBI

66 

Shin JE, Oh JH, Kim YK, Jung JY and Chung JH: Transcriptional regulation of proteoglycans and glycosaminoglycan chainsynthe-sizing glycosyltransferases by UV irradiation in cultured human dermal fibroblasts. J Korean Med Sci. 26:417–424. 2011. View Article : Google Scholar : PubMed/NCBI

67 

Visse R and Nagase H: Matrix metalloproteinases and tissue inhibitors of metalloproteinases: Structure, function, and biochemistry. Circ Res. 92:827–839. 2003. View Article : Google Scholar : PubMed/NCBI

68 

Brenneisen P, Sies H and Scharffetter-Kochanek K: Ultraviolet-B irradiation and matrix metalloproteinases: From induction via signaling to initial events. Ann N Y Acad Sci. 973:31–43. 2002. View Article : Google Scholar : PubMed/NCBI

69 

Hwang E, Lee TH, Park SY, Yi TH and Kim SY: Enzyme-modified Panax ginseng inhibits UVB-induced skin aging through the regulation of procollagen type I and MMP-1 expression. Food Funct. 5:265–274. 2014. View Article : Google Scholar

70 

Park CH, Moon Y, Shin CM and Chung JH: Cyclic AMP suppresses matrix metalloproteinase-1 expression through inhibition of MAPK and GSK-3beta. J Invest Dermatol. 130:2049–2056. 2010. View Article : Google Scholar : PubMed/NCBI

71 

Reunanen N, Westermarck J, Häkkinen L, Holmström TH, Elo I, Eriksson JE and Kähäri VM: Enhancement of fibroblast collagenase (matrix metalloproteinase-1) gene expression by ceramide is mediated by extracellular signal-regulated and stress-activated protein kinase pathways. J Biol Chem. 273:5137–5145. 1998. View Article : Google Scholar : PubMed/NCBI

72 

Kook SH, Jang YS and Lee JC: Involvement of JNK-AP-1 and ERK-NF-κB signaling in tension-stimulated expression of type I collagen and MMP-1 in human periodontal ligament fibroblasts. J Appl Physiol. 111:1575–1583. 2011. View Article : Google Scholar

73 

Moon SK, Cha BY and Kim CH: ERK1/2 mediates TNF-alpha-induced matrix metalloproteinase-9 expression in human vascular smooth muscle cells via the regulation of NF-kappaB and AP-1: Involvement of the ras dependent pathway. J Cell Physiol. 198:417–427. 2004. View Article : Google Scholar : PubMed/NCBI

74 

Sebastiani S, Albanesi C, De PO, Puddu P, Cavani A and Girolomoni G: The role of chemokines in allergic contact dermatitis. Arch Dermatol Res. 293:552–559. 2002. View Article : Google Scholar : PubMed/NCBI

75 

Mattii M, Ayala F, Balato N, Filotico R, Lembo S, Schiattarella M, Patruno C, Marone G and Balato A: The balance between pro- and anti-inflammatory cytokines is crucial in human allergic contact dermatitis pathogenesis: The role of IL-1 family members. Exp Dermatol. 22:813–819. 2013. View Article : Google Scholar : PubMed/NCBI

76 

Ruan W, Xu JM, Li SB, Yuan LQ and Dai RP: Effects of down-regulation of microRNA-23a on TNF-α-induced endothelial cell apoptosis through caspase-dependent pathways. Cardiovasc Res. 93:623–632. 2011. View Article : Google Scholar

77 

Markelic M, Velickovic K, Golic I, Otasevic V, Stancic A, Jankovic A, Vucetic M, Buzadzic B, Korac B and Korac A: Endothelial cell apoptosis in brown adipose tissue of rats induced by hyperinsulinaemia: The possible role of TNF-α. Eur J Histochem. 55:e342011. View Article : Google Scholar

78 

Skoog T, Dichtl W, Boquist S, Skoglund-Andersson C, Karpe F, Tang R, Bond MG, de Faire U, Nilsson J, Eriksson P and Hamsten A: Plasma tumour necrosis factor-alpha and early carotid atherosclerosis in healthy middle-aged men. Eur Heart J. 23:376–383. 2002. View Article : Google Scholar : PubMed/NCBI

79 

Cheng Y, Qiu F, Tashiro S, Onodera S and Ikejima T: ERK and JNK mediate TNFalpha-induced p53 activation in apoptotic and autophagic L929 cell death. Biochem Biophys Res Commun. 376:483–488. 2008. View Article : Google Scholar : PubMed/NCBI

80 

Harhaji L, Mijatovic S, Maksimovic-Ivanic D, Popadic D, Isakovic A, Todorovic-Markovic B and Trajkovic V: Aloe emodin inhibits the cytotoxic action of tumor necrosis factor. Eur J Pharmacol. 568:248–259. 2007. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

May 2018
Volume 41 Issue 5

Print ISSN: 1107-3756
Online ISSN:1791-244X

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Na, J., Bak, D., Im, S., Choi, H., Hwang, J., Kong, S. ... Kim, B. (2018). Anti‑apoptotic effects of glycosaminoglycans via inhibition of ERK/AP‑1 signaling in TNF‑α‑stimulated human dermal fibroblasts. International Journal of Molecular Medicine, 41, 3090-3098. https://doi.org/10.3892/ijmm.2018.3483
MLA
Na, J., Bak, D., Im, S., Choi, H., Hwang, J., Kong, S., No, Y., Lee, Y., Kim, B."Anti‑apoptotic effects of glycosaminoglycans via inhibition of ERK/AP‑1 signaling in TNF‑α‑stimulated human dermal fibroblasts". International Journal of Molecular Medicine 41.5 (2018): 3090-3098.
Chicago
Na, J., Bak, D., Im, S., Choi, H., Hwang, J., Kong, S., No, Y., Lee, Y., Kim, B."Anti‑apoptotic effects of glycosaminoglycans via inhibition of ERK/AP‑1 signaling in TNF‑α‑stimulated human dermal fibroblasts". International Journal of Molecular Medicine 41, no. 5 (2018): 3090-3098. https://doi.org/10.3892/ijmm.2018.3483