Introduction
Acute lung injury (ALI)/acute respiratory distress
syndrome (ARDS) refers to the acute progressive respiratory
insufficiency or respiratory failure caused by various factors,
including trauma, blood transfusion and infection (1); this is a common respiratory crisis,
pathologically characterized by pulmonary edema, pulmonary
hemorrhage and severe respiratory impairment (1). The mortality rate of ALI/ARDS may be
as high as 30–50% (2). Due to the
undefined pathogenesis, there are no effective therapeutic drugs in
clinical practice at present (2).
Supportive treatment remains the principal treatment option
(3). A series of ALI animal
models have been established to simulate the status of ALI caused
by diverse pathogeneses (3).
Among them, the majority of studies have focused on
lipopolysaccharide (LPS), one of the primary causative factors of
ALI caused by bacterial infections, particularly Gram-negative
bacteria (3). As the active
component of bacterial endotoxin, LPS is an important pathogenic
factor in ALI (4). In LPS-induced
ALI animal models, the excessive inflammatory reaction of
neutrophils leads to extensive damage and even mortality (4).
The NACHT, LRR and PYD domains-containing protein 3
(NLRP3) inflammasome is a multiprotein large-cytoplasmic complex,
which is composed of NLRP3, apoptosis-associated speck-like
proteins and pro-caspase-1 (5).
NLRP3 serves a critical role in regulating the relevant components
of the inflammatory complex, including apoptosis-associated
speck-like proteins and pro-caspase-1 (6). It has been reported that in acute
injury, the stimulated intracellular reactive oxygen species may
activate the NLRP3 inflammasome and caspase-1, and promote the
cleavage and maturation of pro-interleukin (IL)-1β and pro-IL-18.
As a result, inflammatory cytokines are released, resulting in
damage to lung tissue (7,8).
Alterations in microRNA (miRNA/miR) expression are
associated with immune responses, inflammatory signaling pathways
and the pathogenesis of inflammatory lung diseases, including ALI.
Therefore, miRNAs are novel promising therapeutic targets (9). miRNA-induced changes in gene
expressions are generally modest (9). However, the results may affect the
expression of a large number of subsequent genes, which further
affect multiple biological processes. Therefore, it is feasible to
utilize miRNAs as markers (10).
miRNA expression has been verified to be dynamic, which reflects
alterations in the internal and external environments, and cell
signals (10). Therefore, it is
promising to use miRNAs as biomarkers to represent a specific
disease state or the underlying pathophysiological processes at
different stages. In addition, miRNAs may be detected in a variety
of specimens, including tissue, blood or other body fluids
(11). miRNAs are also fairly
stable and are virtually unaffected by errors in sample handling,
making miRNAs more attractive biomarkers (11). Intriguingly, miRNAs in plasma have
been used as biomarkers to diagnose and monitor a variety of
inflammatory lung diseases, including ALI. Neudecker et al
(12) suggested that miRNA-223
deficiency was associated with severe lung inflammation. In the
present study, the anti-inflammatory effect of miRNA-223 on
inflammation in ALI, and the possible mechanism, was
demonstrated.
Materials and methods
Mice and histopathological assay
Male C57BL/6 mice (5–6 weeks; 18–20 g) were obtained
from Shandong University Laboratory Animal Center (Jinan, China).
All mice were housed at 22–23°C, 55–60% humidity, on a 12-h
light/dark cycle with free access to food/water. All mice were
randomly assigned to two groups: Control and ALI mice. All ALI
model mice were injected with 35 mg/kg pentobarbital sodium
[intraperitoneal (i.p.)] and injected with LPS at 5 mg/kg
(Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) into the chest.
After 1 day, all mice were injected with 35 mg/kg pentobarbital
sodium and sacrificed via decollation. Lung tissue was acquired and
washed with PBS, and fixed with 4% paraformaldehyde for 24 h at
room temperature. The lung tissue was dehydrated using 100–75%
ethyl alcohol for 5 min at 4°C, and cut into 5-µM sections. Lung
tissue sections were stained with hematoxylin and eosin (HE) for 5
min at room temperature, and were finally examined under a light
microscope (Nikon Eclipse TE2000-U; Nikon Corporation, Tokyo,
Japan) at ×100 magnification. The experimental procedures in the
present study were performed with the approval of Binzhou Medical
University Hospital (Liaocheng, China).
Cytokine detection
Serum samples were centrifuged at 1,000 × g for 10
min and used to measure TNF-α (cat. no. H052), IL-1β (cat. no.
H002), IL-6 (cat. no. H007) and IL-18 (cat. no. H0015) levels using
ELISA kits (Nanjing Jiancheng Bioengineering Institute, Nanjing,
China). Cells were lysed with radioimmunoprecipitation assay buffer
for 15 min and protein concentrations in the extracts were measured
by bicinchoninic acid assay. Proteins (10 µg) were centrifuged at
1,000 × g for 10 min and collected to measure TNF-α, IL-1β, IL-6
and IL-18 levels using ELISA kits.
Measurement of miRNA and mRNA
expression
Total RNA was extracted from lung tissues or cells
using TRIzol reagent, according to the manufacturer's instructions
(Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA).
cDNA was synthesized using a qScript cDNA Synthesis kit (QuantaBio,
Beverly, MA, USA) at 37°C for 60 min and at 82°C for 5 sec. Reverse
transcription-quantitative polymerase chain reaction (RT-qPCR)
analysis was executed using a SYBR Green Detection system (Bio-Rad
Laboratories, Inc., Hercules, CA, USA) on a 7500 real-time PCR
systems (Applied Biosystems; Thermo Fisher Scientific, Inc.).
Primer sequences were as follows: miR-223 forward,
5′-GTGCAGGGTCCGAGGT-3′ and reverse, 5′-CGGGCTGTCAGTTTGTCA-3′; U6
forward, 5′GCTTCGGCAGCACATATACTAAAAT3′ and reverse,
5′CGCTTCACGAATTTGCGTGTCAT3. The PCR conditions were 95°C for 30
sec, followed by 40 cycles of 95°C for 20 sec, 60°C for 30 sec and
72°C for 30 sec. Analysis of relative gene expression data was
performed using the 2−ΔΔCq method (13).
Microarray analysis
Isolated RNA was cleaned up using an RNeasy Mini kit
(Qiagen, Inc., Valencia, CA, USA) and biotin-labeled cRNA was
produced by metal-induced hydrolysis at 94°C and hybridized onto
the Affymetrix Human Genome U133 Plus 2.0 Array (Affymetrix; Thermo
Fisher Scientific, Inc.) at 45°C for 16 h. Fluidic Station-450 and
GeneChip were performed using the Affymetrix GeneChip Scanner 7G
(Affymetrix; Thermo Fisher Scientific, Inc.). Data were analyzed
using GeneSpring GX 10 software (Silicon Genetics; Agilent
Technologies, Inc., Santa Clara, CA, USA).
Cell culture and transfection
Lung adenocarcinoma A549 cells were obtained from
the Shanghai Cell Bank of the Chinese Academy of Sciences
(Shanghai, China), and maintained in Dulbecco's modified Eagle's
medium (high glucose; Invitrogen; Thermo Fisher Scientific, Inc.)
supplemented with 10% fetal bovine serum (Gibco; Thermo Fisher
Scientific, Inc.). A549 cells were treated with 100 ng LPS and 2 mM
adenosine 5′-triphosphate (ATP) for 4 h for the ALI model.
miRNA-223, anti-miRNA-223, RHOB plasmid and negative mimics were
purchased from Sangon Biotech Co., Ltd. (Shanghai, China). A549
cells (1×106 cells/ml) were co-trans-fected with 0.1 µg
miRNA-223 (5′-UGUCAGUUUGUCAAAUACCCCA-3′), anti-miRNA-223
(5′-TGTCAGTTTGTCAAATACCCCAT-3′), RHOB plasmid
(5′-CGCTCATGGAGGCCATCCGC-3′ and 5′-CTGCAATGCTATGAGGGC-3′; Sangon
Biotech Co., Ltd.) and negative mimics
(5′-AGGUCGAACUACGGGUCAAUC-3′) using Lipofectamine® 2000
(Invitrogen; Thermo Fisher Scientific, Inc.). After 6 h,
trans-fected cells were treated with 100 ng LPS (Sigma-Aldrich;
Merck KGaA, Darmstadt, Germany) and 2 mM ATP (Sigma-Aldrich; Merck
KGaA, Darmstadt, Germany) for 4 h for the ALI model.
Luciferase reporter gene assay
TargetScan (http://www.targetscan.org/vert_61/), online
bioinformatics software, concluded that NLRP3 is a downstream
target gene of miR-223. A549 cells were co-transfected with
miRNA-223, anti-miRNA-223, pMIR-REPORT-RhoB-3′-untranslated region
(UTR) luciferase reporter plasmid (Huayueyang Biotechnology Co.,
Ltd., Beijing, China) and pMIR-REPORT-NLRP3-3′-UTR (Huayueyang
Biotechnology Co., Ltd.) luciferase reporter plasmid using
Lipofectamine 2000. A total of 24 h after transfection, cells were
treated with 100 ng LPS and 2 mM ATP for 4 h, and luciferase
activity was measured using the Dual-luciferase reporter assay kit
(Promega Corporation, Madison, WI, USA) in comparison with
Renilla luciferase.
Western blot analysis
Cells were lysed with radioimmunoprecipitation assay
buffer for 15 min and protein concentrations in the extracts were
measured by bicinchoninic acid assay. Proteins (50 µg) were
separated by electrophoresis on 10% SDS-polyacrylamide gels and 3%
polyacrylamide gels and transferred onto nitrocellulose membranes.
Membranes were blocked with 5% bovine serum albumin (BSA; Beyotime
Institute of Biotechnology, Haimen, China) in TBS at 37°C for 1 h
and incubated with the indicated antibodies: Toll-like receptor 4
(TLR4; 1:2,000; cat. no. ab13556; Abcam, Cambridge, UK), nuclear
factor (NF)-κB (1:2,000; cat. no. 8242; Cell Signaling Technology,
Inc., Danvers, MA, USA), NLRP3 (1:2,000; cat. no. 13158; Cell
Signaling Technology, Inc.), caspase-1 (1:1,000; cat. no. 3866;
Cell Signaling Technology, Inc.), RHOB (1:2,000; cat. no. 2098;
Cell Signaling Technology, Inc.) and GAPDH (1:5,000; cat. no. 5174;
Cell Signaling Technology, Inc.) overnight at 4°C. Following three
washes with TBS with Tween-20 (TBST) for 15 min, the membranes were
incubated with anti-rabbit horseradish peroxidase-coupled secondary
antibodies (cat. no. 7074; 1:5,000; Cell Signaling Technology,
Inc.) at room temperature for 1 h. The membrane was washed with
TBST and detected by enhance chemiluminescence (Pierce; Thermo
Fisher Scientific, Inc.), and quantified using Image Lab 3.0
(Bio-Rad Laboratories, Inc., Hercules, CA, USA).
Immunofluorescence staining
Cells (1×105 cells/ml) were washed with
PBS and fixed with 4% paraformaldehyde in PBS for 15 min at room
temperature. Cells were permeabilized with 0.1% Triton X-100 in PBS
for 15 min at room temperature and blocked with 5% BSA in PBS for 1
h. Subsequently, the cells were incubated with anti-RHOB (1:100;
cat. no. 2098; Cell Signaling Technology, Inc.) overnight at 4°C.
The cells were washed with PBS, and incubated with goat anti-rabbit
IgG-CFL 555 secondary antibodies (cat. no. sc-362272; 1:100; Santa
Cruz Biotechnology, Inc., Dallas, TX, USA) for 1 h at room
temperature. Cells were stained with DAPI for 15 min in the dark at
room temperature and washed with PBS. Cells were examined under a
Zeiss LSM 510 confocal microscope (Carl Zeiss AG, Oberkochen,
Germany).
Statistical analysis
All the experiments were performed at least three
times independently (n=3) using SPSS 17.0 (SPSS, Inc., Chicago, IL,
USA). A Student's t-test was used to determine statistical
significance between two groups. One-way analysis of variance and
Tukey's post hoc test were performed for parametric multivariable
analysis. P<0.05 was considered to indicate a statistically
significant difference.
Results
miRNA-223 expression in ALI mice
To investigate the function of miR-223 in ALI mice,
the alterations in miR-223 was analyzed in ALI mice. As presented
in Fig. 1A, HE staining
indicated that pulmonary alveoli were damaged in ALI mice compared
with control mice. The levels of TNF-α, IL-1β, IL-6 and IL-18 were
increased in ALI mice, in comparison with the control group
(Fig. 1B-E). A gene chip assay
was used to analyze the alterations in miRNAs, which revealed that
miR-223 expression was decreased in ALI mice compared with the
control group (Fig. 1F). The
RT-qPCR assay demonstrated that miR-223 expression was decreased in
ALI mice compared with the control group (Fig. 1G). Therefore, miR-223 expression
may be associated with inflammation in ALI.
miR-223 expression in ALI in vitro
Moreover, the levels of IL-1β and IL-18 were
increased in A549 cells following treatment with LPS, compared with
the control group (Fig. 2A and
B). miR-223 expression was reduced in A549 cells following
treatment with LPS, compared with the control group (Fig. 2C). To analyze the function of
miR-223 in ALI, miR-223 and anti-miR-223 mimics were used to
increase or inhibit the expression of miR-223 in A549 cells treated
with LPS, compared with a negative control group (Fig. 2D and E). Overexpression of
miR-223 reduced the levels of IL-1β and IL-18 in A549 cells
following treatment with LPS, compared with the negative control
group (Fig. 2F and G).
Downregulation of miR-223 promoted the levels of IL-1β and IL-18 in
A549 cells treated with LPS, compared with the negative control
group (Fig. 2H and I). Together,
these results demonstrated that miR-223 regulated inflammation in
ALI, while its mechanism required investigation.
miRNA-223 regulates NLRP3 protein
expression in ALI in vitro
In order to investigate the mechanism of action of
miR-223 in ALI, a gene chip assay was used to measure the
alterations in miR-223 in ALI in vitro following inhibition
of miR-223. Consequently, inhibition of miR-223 induced the gene
expression of TLR4, NF-κB and NLRP3 in ALI in vitro compared
with the negative control (Fig.
3A). Downregulation of miR-223 also increased the mRNA
expression of TLR4, NF-κB and NLRP3 in ALI in vitro,
compared with the negative control group (Fig. 3B-D). The 3′-UTR of NLRP3 mRNA is
a target site of miR-223 in various species (Fig. 3E). The relative luciferase
activity of the wild-type 3′-UTR following downregulation of
miR-223 was increased, in comparison with the control group
(Fig. 3F). As presented in
Fig. 3G, immunofluorescence
demonstrated that the downregulation of miR-223 induced NLRP3
protein expression compared with the control group. These results
indicated that miR-223 may regulate pro-inflammatory cytokine
expression by targeting NLRP3.
miRNA-223 regulates the TLR4 and NLRP3
signaling pathway in ALI in vitro
Downregulation of miR-223 induced the protein
expression of TLR4, NF-κB, NLRP3 and caspase-1 in ALI in
vitro, compared with the negative control group (Fig. 4A–E). Overexpression of miR-223
suppressed the protein expression of TLR4, NF-κB, NLRP3 and
caspase-1 in ALI in vitro, compared with the negative
control group (Fig. 4F–J). Taken
together, these results demonstrated that miR-223 may regulate the
TLR4 and NLRP3 signaling pathway in ALI in vitro.
Inhibition of TLR4 reduces the
pro-inflammatory effect of anti-miR-223 in ALI in vitro
To elucidate the mechanism of action of miR-223 in
ALI in vitro, a TLR4 inhibitor was used to decrease the
protein expression of TLR4 in ALI in vitro. The inhibition
of TLR4 did not affect the protein expression of NLRP3 and
caspase-1, but suppressed that of TLR4 and NF-κB in ALI in
vitro following miR-223 down-regulation, compared with miR-223
downregulation alone (Fig.
5A-E). The inhibition of TLR4 reduced the levels of IL-1β and
IL-18 in ALI in vitro following miR-223 downregulation, in
comparison with miR-223 downregulation alone (Fig. 5F and G). Taken together, these
results demonstrated that TLR4 is required to maintain the
proinflammatory effect of anti-miR-223 in ALI.
Inhibition of NLRP3 reduces the
pro-inflammatory effect of anti-miR-223 in ALI in vitro
To further elucidate the role of NLRP3 in the
pro-inflammatory effect of anti-miR-223 in ALI in vitro, an
NLRP3 inhibitor was used to decrease the protein expression of
NLRP3. As a result, the inhibition of NLRP3 suppressed the protein
expression of NLRP3 and caspase-1 in ALI in vitro following
treatment with anti-miR-223, compared with treatment with
anti-miR-223 alone (Fig. 6A–C).
The inhibition of NLRP3 reduced the levels of IL-1β and IL-18 in
ALI in vitro following treatment with anti-miR-223, compared
with treatment with anti-miR-223 alone (Fig. 6D and E). Taken together, these
results demonstrated that NLRP3 is required to maintain the
proinflammatory effect of anti-miR-223 in ALI, mediated by IL-1β
and IL-18.
miRNA-223 regulates the TLR4 signaling
pathway in ALI in vitro via RHOB
Prior to determining the role of miR-223 in
RHOB-activated inflammation, the 3′-UTR of RHOB mRNA was revealed
to be a target site of miR-223 in various species (Fig. 7A). The relative luciferase
activity of the wild-type 3′UTR in miR-223 was decreased compared
with the control group (Fig.
7B). Overexpression of miR-223 suppressed the protein
expression of RHOB, while downregulation of miR-223 induced RHOB
protein expression in ALI in vitro, compared with the
negative control group (Fig.
7C–F). A RHOB plasmid was utilized to induce the protein
expression of RHOB, which did not affect TLR4 protein expression in
ALI in vitro following treatment with anti-miR-223, compared
with treatment with anti-miR-223 alone (Fig. 7G–I). The activation of RHOB
reduced the pro-inflammatory effect of anti-miR-223 on the levels
of IL-1β and IL-18 in ALI in vitro following treatment with
anti-miR-223, compared with treatment with anti-miR-223 alone
(Fig. 7J and K).
Activation of RHOB reduces the effects of
miR-223 on inflammation in ALI in vitro
To further study the role of RHOB in the effects of
miR-223 on inflammation in ALI in vitro, RHOB plasmid was
used to induce RHOB protein expression in ALI following
overexpression of miR-223. RHOB plasmid did not affect miR-223
expression in the ALI model, compared with the negative group
(Fig. 8A). As presented in
Fig. 8B–G, RHOB plasmid induced
RHOB, TLR4 and NF-κB protein expression, and did not affect NLRP3
and caspase-1 protein expression in ALI following overexpression of
miR-223, compared with overexpression of miR-223 alone.
Discussion
ALI/ARDS is a common and important rapidly
progressive inflammatory lung disease. It is estimated that there
are 190,000 new ALI cases in the USA annually, with approximately
75,000 mortalities (2). In China,
the incidence of ALI/ARDS is even higher, with a mortality rate of
52% (14). In recent years,
scientists have noticed that miRNAs serve vital roles in multiple
biological processes and signal transduction pathways of ALI/ARDS
(14). In the present study, it
was identified that miRNA-223 expression was decreased in ALI mice.
Neudecker et al (12)
suggested that miRNA-223 deficiency was associated with severe lung
inflammation.
ALI/ARDS is damage to alveolar epithelial cells and
capillary endothelial cells due to a variety of direct causes
(including pneumonia and pulmonary contusion) and indirect causes
(including adenosis and trauma) (15). This leads to diffuse edema of the
pulmonary interstitium and alveoli, subsequently triggering acute
hypoxemia. ALI/ARDS is not considered a simple lung disease or
inflammatory disease (15,16).
Instead, it is a systemic inflammatory response in the lung tissue,
according to current opinion (17). In cases of ALI/ARDS, neutrophils,
macrophages and endothelial cells release a large quantity of
proinflammatory cytokines, chemokines and inflammatory mediators.
This leads to damage to the lung epithelial cells and pulmonary
vascular endothelial cells, increased alveolar permeability, and
exudation of inflammatory cells, proteins and water. Additionally,
this results in reduced lung tissue volume, decreased pulmonary
compliance, disorders of gas diffusion, exchange and metabolism,
and eventual mortality attributed to respiratory failure. The
present study demonstrated that the downregulation of miRNA-223
promoted IL-1β and IL-18 levels in A549 cells treated with LPS, and
the downregulation of miRNA-223 promoted TLR4 and NF-κB protein
expression in A549 cells treated with LPS. Wang et al
(18) indicated that miRNA-223
negatively regulated the activation of the TLR4/NF-κB pathway in
macrophages.
In the occurrence and development of ALI, the
release of proinflammatory mediators and apoptosis serve an
important role (19). Disorders
of the secretion of cytokines, inflammatory chemokines and other
associated proteins promote the inflammatory response and
accelerate the development of lung injury (20). Previous studies have confirmed
that the NLRP3 inflammasome serves an important role in this
process (21,22). It not only activates caspase-1 and
inflammatory factors, but also promotes the maturation and
secretion of inflammasomes (21,22). Therefore, the regulatory approach
targeting NLRP3 inflammasomes may be of great importance for the
treatment of ALI. The NLRP3 inflammasome is a multiprotein
large-cytoplasmic complex that is composed of NLRP3,
apoptosis-related spot-like proteins and pro-caspase-1 (23). NLRP3 serves a critical role in
regulating the relevant components of the inflammation complex,
including apoptosis-related point-like proteins and pro-caspase-1
(23). Recent studies have
confirmed that activation of the inflammasome induces the division
of pro-IL-1B and pro-IL-18 (21,22). Furthermore, it results in
increased alveolar permeability, subsequently leading to pulmonary
edema and lung injury (21,22). In the present study, miRNA-223
negatively regulated the TLR4/ NF-κB signaling pathway via RHOB in
ALI. Downregulation of miRNA-223 induced TLR4, NF-κB, NLRP3 and
caspase-1 protein expression in ALI in vitro. Yang et
al (24) reported that
miRNA-223 regulates inflammation and brain injury via feedback to
NLRP3 inflammasome after intracerebral hemor rhage. Zeng et
al (25) demonstrated that
miRNA-223 attenuates hypoxia-induced vascular remodeling through
RHOB/myosin light chain 9 in pulmonary arterial smooth muscle.
In conclusion, the present study demonstrated that
miRNA-223 reduced inflammation, suppressed the NLRP3 inflammasome,
and negatively regulated the TLR4/NF-κB signaling pathway via RHOB
in ALI (Fig. 9). miRNA-223 is
involved in the activation of the TLR4/NF-κB signaling pathway via
RHOB, and the NLRP3 inflammasome may be a therapeutic target for
the treatment of inflammation in ALI. Therefore, miRNA-223 serves
as a potent positive regulator of inflammation in ALI.
Funding
No funding was received.
Availability of data and materials
The analyzed data sets generated during the study
are available from the corresponding author on reasonable
request.
Authors' contributions
ZZ designed the study. YY, KL and TY performed the
experiments. ZZ and YY analyzed the data. ZZ wrote the
manuscript.
Ethics approval and consent to
participate
The experimental procedures in the present study
were performed with the approval of Binzhou Medical University
Hospital (Binzhou, China).
Patient consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing
interests.
Acknowledgments
Not applicable.
References
|
1
|
Cheng Y, Jin M, Dong X, Sun L, Liu J, Wang
R, Yang Y, Lin P, Hou S, Ma Y, et al: Mechanism and early
intervention research on ALI during emergence surgery of stanford
type-A AAD: Study protocol for a prospective, double-blind,
clinical trial. Medicine (Baltimore). 95:e51642016. View Article : Google Scholar
|
|
2
|
Zhang J, Cao J, Feng J, Wu Q and Chen BY:
A study of noninvasive positive-pressure mechanical ventilation in
the treatment of acute lung injury with a complex critical care
ventilator. J Int Med Res. 42:788–798. 2014. View Article : Google Scholar : PubMed/NCBI
|
|
3
|
Meade MO, Cook DJ, Griffith LE, Hand LE,
Lapinsky SE, Stewart TE, Killian KJ, Slutsky AS and Guyatt GH: A
study of the physiologic responses to a lung recruitment maneuver
in acute lung injury and acute respiratory distress syndrome.
Respir Care. 53:1441–1449. 2008.PubMed/NCBI
|
|
4
|
Guo H, Suo DW, Zhu HP, Sun XM and Chen J:
Early blood purification therapy of severe acute pancreatitis
complicated by acute lung injury. Eur Rev Med Pharmacol Sci.
20:873–878. 2016.PubMed/NCBI
|
|
5
|
Tian L, Li W and Wang T: Therapeutic
effects of silibinin on LPS-induced acute lung injury by inhibiting
NLRP3 and NF-κB signaling pathways. Microb Pathog. 108:104–108.
2017. View Article : Google Scholar : PubMed/NCBI
|
|
6
|
Zhang A, Pan W, Lv J and Wu H: Protective
effect of amygdalin on LPS-induced acute lung injury by inhibiting
NF-κB and NLRP3 signaling pathways. Inflammation. 40:745–751. 2017.
View Article : Google Scholar : PubMed/NCBI
|
|
7
|
Fukumoto J, Fukumoto I, Parthasarathy PT,
Cox R, Huynh B, Ramanathan GK, Venugopal RB, Allen-Gipson DS,
Lockey RF and Kolliputi N: NLRP3 deletion protects from
hyperoxia-induced acute lung injury. Am J Physiol Cell Physiol.
305:C182–C189. 2013. View Article : Google Scholar : PubMed/NCBI
|
|
8
|
Zhang Y and Li X, Grailer JJ, Wang N, Wang
M, Yao J, Zhong R, Gao GF, Ward PA, Tan DX and Li X: Melatonin
alleviates acute lung injury through inhibiting the NLRP3
inflammasome. J Pineal Res. 60:405–414. 2016. View Article : Google Scholar : PubMed/NCBI
|
|
9
|
Cao Y, Lyu YI, Tang J and Li Y: MicroRNAs:
Novel regulatory molecules in acute lung injury/acute respiratory
distress syndrome. Biomed Rep. 4:523–527. 2016. View Article : Google Scholar : PubMed/NCBI
|
|
10
|
Rajasekaran S, Pattarayan D, Rajaguru P,
Sudhakar Gandhi PS and Thimmulappa RK: MicroRNA regulation of acute
lung injury and acute respiratory distress syndrome. J Cell
Physiol. 231:2097–2106. 2016. View Article : Google Scholar : PubMed/NCBI
|
|
11
|
Neudecker V, Yuan X, Bowser JL and
Eltzschig HK: MicroRNAs in mucosal inflammation. J Mol Med (Berl).
95:935–949. 2017. View Article : Google Scholar
|
|
12
|
Neudecker V, Brodsky KS, Clambey ET,
Schmidt EP, Packard TA, Davenport B, Standiford TJ, Weng T,
Fletcher AA, Barthel L, et al: Neutrophil transfer of miR-223 to
lung epithelial cells dampens acute lung injury in mice. Sci Transl
Med. 9:eaah53602017. View Article : Google Scholar
|
|
13
|
Livak KJ and Schmittgen TD: Analysis of
relative gene expression data using real-time quantitative PCR and
the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.
View Article : Google Scholar
|
|
14
|
Bechir M, Puhan MA, Fasshauer M,
Schuepbach RA, Stocker R and Neff TA: Early fluid resuscitation
with hydroxyethyl starch 130/0.4 (6%) in severe burn injury: A
randomized, controlled, double-blind clinical trial. Crit Care.
17:R2992013. View
Article : Google Scholar : PubMed/NCBI
|
|
15
|
Barr LC, Brittan M, Morris AC, McAuley DF,
McCormack C, Fletcher AM, Richardson H, Connell M, Patel D, Wallace
WA, et al: A randomized controlled trial of peripheral blood
mono-nuclear cell depletion in experimental human lung
inflammation. Am J Respir Crit Care Med. 188:449–455. 2013.
View Article : Google Scholar : PubMed/NCBI
|
|
16
|
Aikawa N, Ishizaka A, Hirasawa H,
Shimazaki S, Yamamoto Y, Sugimoto H, Shinozaki M, Taenaka N, Endo
S, Ikeda T and Kawasaki Y: Reevaluation of the efficacy and safety
of the neutrophil elastase inhibitor, sivelestat, for the treatment
of acute lung injury associated with systemic inflammatory response
syndrome; a phase IV study. Pulm Pharmacol Ther. 24:549–554. 2011.
View Article : Google Scholar : PubMed/NCBI
|
|
17
|
Krupa A, Fol M, Rahman M, Stokes KY,
Florence JM, Leskov IL, Khoretonenko MV, Matthay MA, Liu KD, Calfee
CS, et al: Silencing Bruton's tyrosine kinase in alveolar
neutrophils protects mice from LPS/immune complex-induced acute
lung injury. Am J Physiol Lung Cell Mol Physiol. 307:L435–L448.
2014. View Article : Google Scholar : PubMed/NCBI
|
|
18
|
Wang J, Bai X, Song Q, Fan F, Hu Z, Cheng
G and Zhang Y: miR-223 inhibits lipid deposition and inflammation
by suppressing toll-like receptor 4 signaling in macrophages. Int J
Mol Sci. 16:24965–24982. 2015. View Article : Google Scholar : PubMed/NCBI
|
|
19
|
Feng Z, Qi S, Zhang Y, Qi Z, Yan L, Zhou
J, He F, Li Q, Yang Y, Chen Q, et al: Ly6G+ neutrophil-derived
miR-223 inhibits the NLRP3 inflammasome in mitochondrial
DAMP-induced acute lung injury. Cell Death Dis. 8:e31702017.
View Article : Google Scholar : PubMed/NCBI
|
|
20
|
Jiang L, Fei D, Gong R, Yang W, Yu W, Pan
S and Zhao M and Zhao M: CORM-2 inhibits TXNIP/NLRP3 inflammasome
pathway in LPS-induced acute lung injury. Inflamm Res. 65:905–915.
2016. View Article : Google Scholar : PubMed/NCBI
|
|
21
|
Xiang M, Shi X, Li Y, Xu J, Yin L, Xiao G,
Scott MJ, Billiar TR, Wilson MA and Fan J: Hemorrhagic shock
activation of NLRP3 inflammasome in lung endothelial cells. J
Immunol. 187:4809–4817. 2011. View Article : Google Scholar : PubMed/NCBI
|
|
22
|
Jiang W, Li M, He F, Bian Z, Liu J, He Q,
Wang X, Sun T and Zhu L: Dopamine D1 receptor agonist A-68930
inhibits NLRP3 inflammasome activation and protects rats from
spinal cord injury-induced acute lung injury. Spinal Cord.
54:951–956. 2016. View Article : Google Scholar : PubMed/NCBI
|
|
23
|
Jiang L, Zhang L, Kang K, Fei D, Gong R,
Cao Y, Pan S and Zhao M and Zhao M: Resveratrol ameliorates
LPS-induced acute lung injury via NLRP3 inflammasome modulation.
Biomed Pharmacother. 84:130–138. 2016. View Article : Google Scholar : PubMed/NCBI
|
|
24
|
Yang Z, Zhong L, Xian R and Yuan B:
MicroRNA-223 regulates inflammation and brain injury via feedback
to NLRP3 inflam-masome after intracerebral hemorrhage. Mol Immunol.
65:267–276. 2015. View Article : Google Scholar : PubMed/NCBI
|
|
25
|
Zeng Y, Zhang X, Kang K, Chen J, Wu Z,
Huang J, Lu W, Chen Y, Zhang J, Wang Z, et al: MicroRNA-223
attenuates hypoxia-induced vascular remodeling by targeting
rhoB/MLC2 in pulmonary arterial smooth muscle cells. Sci Rep.
6:249002016. View Article : Google Scholar : PubMed/NCBI
|
