Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
February-2020 Volume 45 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2020 Volume 45 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Deficiency of Pdk1 contributes to primordial follicle activation via the upregulation of YAP expression and the pro‑inflammatory response

  • Authors:
    • Jiayin Gao
    • Tiefang Song
    • Dehong Che
    • Changmin Li
    • Jing Jiang
    • Jingyao Pang
    • Yujuan Yang
    • Peiling Li
  • View Affiliations / Copyright

    Affiliations: Department of Obstetrics and Gynecology, The Second Affiliated Hospital of Harbin Medical University, Harbin, Heilongjiang 150081, P.R. China
  • Pages: 647-657
    |
    Published online on: December 20, 2019
       https://doi.org/10.3892/ijmm.2019.4437
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The molecular mechanisms underlying the activation of primordial follicles are poorly understood. The serine/threonine protein kinase phosphoinositide‑dependent kinase 1 (PDK1), a pivotal downstream effector of phosphatidyl inositol‑3 kinase (PI3K) signaling, plays a vital role in cellular signaling. In order to identify the function of PDK1 in ovarian follicle development, this study used conditional Pdk1 deletion in mouse oocytes by crossing Pdk1loxP/loxP mice with transgenic mice carrying Gdf‑9 promoter‑mediated Cre recombinase and found that Pdk1flx/flxGdf9Cre mice were subfertile with increased serum follicle‑stimulating hormone (FSH) and luteinizing hormone (LH) levels compared with Pdk1flx/flx mice. The deletion of Pdk1 in oocytes induced massive primordial follicle activation, leading to premature ovarian failure (POF). Further investigation revealed that enhanced Yes‑associated protein (YAP) expression and an increased pro‑inflammatory response also contributed to massive primordial follicle activation. PDK1 formed the complex with the core kinases of Hippo signaling and regulated the expression levels of YAP. On the whole, the findings of the present study demonstrate that PDK1 serves as an indispensable gatekeeper for maintaining the primordial follicle pool and provide a deeper understanding of POF treatment.

Introduction

Ovaries are female reproductive organs that produce hormones and release ovum. Follicles, the components of the ovary and the pool of primordial follicles, determine the ovarian reserve (1-3). The activity of primordial follicles is highly selective and the majority remain in a quiescent state, determining the female reproductive lifespan. A small number of primordial follicles are activated and develop into growing follicles, while the majority of primordial follicles remain in a quiescent state. When the pool of primordial follicles is exhausted, menopause occurs. Different types of pathological factors can cause the accelerated loss of primordial follicles and the development of premature ovarian failure (POF) (2,4). However, the molecular mechanisms controlling the activation of primordial follicles remain unknown.

In recent years, an increasing number of studies have focused on genetic factors to further investigate premature follicle activation. The ablation of phosphatase and tensin homolog deleted on chromosome 10 (PTEN), which is a negative regulator of phosphatidyl-inositol 3 kinase (PI3K) in oocytes, has been shown to result in the excessive activation of primordial follicles maintaining them in a dormant state (5). Phosphoinositide-dependent kinase l (PDK1) plays a vital role in regulating cell signaling between PI3K and serine/threonine kinase (5). The deletion of Pdk1 in mouse oocytes has been shown to result in accelerated ovarian aging and premature ovarian failure (POF), due to the compromised lifespan of primordial follicles, which in turn is caused by suppressed PDK1/Akt/S6K1/ ribosomal protein S6 (rpS6) signaling in oocytes (6).

The Hippo signaling pathway controls organ size in animals through the regulation of cell proliferation and apoptosis (7,8). Yes-associated protein (YAP) is one of the key Hippo signaling effectors. When Hippo signaling is disrupted, YAP phosphorylation is decreased, with an increase in YAP nuclear levels (8-10). It has been reported that the Hippo signaling pathway is involved in follicle development (11). The disruption of Hippo signaling may stimulate follicle regeneration and may be used to treat premature ovarian insufficiency through the stimulation of the Akt pathway (12).

Inflammation plays a role in weakening and eventually rupturing the follicle wall, affecting ovulation (13,14). Produced during fulliculogenesis, pro-inflammatory cytokines participate in the induction of ovulation. Interleukin (IL)-1β and tumor necrosis factor α (TNF-α) are vital for follicular growth and oocyte maturation (14). Present in follicular fluid, IL-8 contributes to neutrophil migration (15). It has been reported that nuclear factor-κB (NF-κB) also plays a role in causing POF in diabetic rats (16). Chronic inflammation can lead to impaired oocyte quality and an abnormal ovarian physiology.

The aim of the present study was to examine the physiological functions of Pdk1 in the ovaries of Pdk1flx/flxGdf9Cre mice. PDK1 signaling in oocytes appears to be crucial in maintaining primordial follicle activation, which in turn is vital for determining the duration of fertility, indicating that the deletion of Pdk1 in oocytes may lead to the onset of ovarian senescence.

Materials and methods

Mice

Pdk1loxP/loxP mice with an ICR genomic background were crossed with transgenic mice carrying Gdf-9 promoter-mediated Cre recombinase that also had an ICR background. All the mice were obtained from Jackson Laboratory. There were a total of 100 Pdk1flx/flxGdf9Cre mice. Following multiple rounds of crossing, homozygous mutant female mice we obtained lacking Pdk1 in oocytes (Pdk1flx/flxGdf9Cre) (weight, 20-30 g; age, 7 days, n=20; 14 days, n=10; 21 days, n=15; 8 weeks, n=10; 12 weeks, n=5; 16 weeks, n=5, 20 weeks, n=5; 24 weeks, n=5). The Pdk1flx/flxGdf9Cre mice exhibited a normal phenotype. Control mice that do not carry the Cre transgene are referred to as Pdk1flx/flx mice. The control mice were obtained from Jackson Laboratory and there were 100 Pdk1flx/flx mice. The mice were housed under controlled environmental conditions with free access to water and food. All mice were euthanized with carbon dioxide and cervical dislocation was performed to confirm death. The mice were euthanized using 30% volume per minute displacement rates of 100% CO2. All animal experimental procedures were approved by the Committee on the Use of Live Animals in Teaching and Research of Harbin Medical University. All mice were housed in cages in a constant environment with 55±10% humidity, a temperature of 20±5°C and a 12-h light/dark cycle. All mice exhibited a normal weight and behavior during the feeding period. The mice were sacrificed by cervical dislocation. Ovaries were fixed either with neutral formaldehyde or rapidly frozen in liquid nitrogen.

Antibodies

The antibodies used in the experiments were purchased from the following companies: Rabbit monoclonal anti-YAP (#14074), anti-phosphorylated (p-)YAP (S127, #13008), rabbit monoclonal anti-PDK1 (#5662), rabbit monoclonal TNF-α (#5178), rabbit monoclonal NF-κB (#8242), rabbit polyclonal histone (#7631), rabbit monoclonal salvador family WW domain containing protein 1 (SAV1; #13301), rabbit monoclonal macrophage stimulating 1 (MST1; #14946), rabbit monoclonal large tumor suppressor kinase 1 (LATS1; #3477), mouse monoclonal anti-GAPDH (#5174) (all from Cell Signaling Technology). Secondary rabbit antibodies (#0114) were purchased from ZhongShan Golden Bridge Biotechnology Co., Ltd.

Histological analysis and quantification of ovarian follicles

The ovaries used for histological analysis were fixed in 4% paraformaldehyde (pH 7.5) overnight at 4̊C, dehydrated and embedded in paraffin. Paraffin-embedded ovaries were serially sectioned at 8 µm and every 5th section was mounted on slides. Hematoxylin and eosin staining was performed to identify the morphology of ovaries. Ovarian follicles at different developmental stages, including primordial, primary, early secondary, late secondary and antral follicles were counted in the collected sections of an ovary, based on the well-accepted standards established by Peterson and Peters under a microscope (DP25, Olympus) (17). In each section, only those follicles in which the nucleus of the oocyte was clearly visible were scored and the cumulative follicle counts were multiplied by a correction factor of 5 to represent the estimated number of total follicles in an ovary.

Reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was isolated from the oocytes or ovaries using TRIzol reagent (Invitrogen; Thermo Fisher Scientific). RNA was reverse transcribed into complementary DNA (cDNA) using oligo(dT) and the ImProm-II Reverse Transcription System (Promega). qPCR was conducted using the SYBR-Green PCR reagent (Life Technology; Thermo Fisher Scientific) and StepOnePlus System (Applied Biosystems). The mRNA expression of target genes was normalized to GAPDH. The primer sequences are listed as Table I. The PCR conditions for reverse transcription were as follows: 65°C, 5 min; 4°C, 5 min; 37°C, 50 min; 70°C, 15 min; 4°C, 30 min. The fragment size for each primer was as follows: Cellular communication network factor 1 (CCN1, also known as and referred to herein as CYR61), 109 bp; cellular communication network factor 2 (CCN2, also known as and referred to herein as CTGF), 151 bp; ankyrin repeat domain 1 (ANKRD1), 108 bp; IL-1β and IL-6, 81 bp; PDK1, 110 bp; TNF α, 684 bp; and GAPDH, 123 bp. The cycling conditions for qPCR were as follows: 95°C, 10 min, 1 cycle; 95°C, 15 sec, 60°C, 1 min, 40 cycles. Data analyses were performed using the comparative Cq (ΔΔCq) method for calculating relative gene expression (18).

Table I

List of oligonucleotides used for RT-qPCR.

Table I

List of oligonucleotides used for RT-qPCR.

PrimeSequence (5′-3′)
CYR61Forward: CTGCGCTAAACAACTCAACGA
Reverse: GCAGATCCCTTTCAGAGCGG
CTGFForward: GGGCCTCTTCTGCGATTTC
Reverse: ATCCAGGCAAGTGCATTGGTA
ANKRD1Forward: GGATGTGCCGAGGTTTCTGAA
Reverse: GTCCGTTTATACTCATCGCAGAC
IL-1βForward: CTTCATGGTCCGTGGTACCGCCCTGGAGTCT
Reverse: TGCCCCAGGGCATGGCACCAATCACCCTCTGAC
IL-6Forward: GGTACATCCTCGACGGCATCT
Reverse: GTGCCTCTTTGCTGCTTTCAC
IL-8Forward: GTAGCGAAGGACCTGTCAAACATTGGAAGATCA
Reverse: CAACTCAGTGACCTTGCCTCCTCATGGTAATAC
PDK1Forward: CTATGC TGTGTTACTTCTTGGAGCACAG
Reverse: TGCCGAATATCATGGTGGAAAATGGCCG
TNF-αForward: GCCTCTTCTCATTCCTGCTTG
Reverse: CTGATGAGAGGGAGGCCATT
GAPDHForward: AGGTCGGTGTGAACGGATTTG
Reverse: TGTAGACCATGTAGTTGAGGTC

[i] CYR61, cellular communication network factor 1 (CCN1; also known as and referred to herein as CYR61); CTGF, cellular communication network factor 2 (CCN2, also known as and referred to herein as CTGF); and ANKRD1, ankyrin repeat domain 1; IL, interleukin; PDK1, serine/threonine protein kinase phosphoinositide-dependent kinase 1; YAP, Yes-associated protein; TNF, tumor necrosis factor.

Western blot analysis

Oocytes or ovary lysate were prepared from minced ovaries following the removal of suspended granulosa cells by centrifugation (300 × g at 4°C for 5 min) for western blot analysis. The total protein concentrations were determined using a bicinchoninic acid protein assay kit (Thermo Fisher Scientific). A total of 30 µg ovary protein or 200 oocytes were mixed with SDS sample buffer and boiled for 5 min at 100°C for SDS-PAGE. Equal quantities of protein (40 µg/lane) were resolved by 10% SDS-PAGE, followed by transferred onto polyvinylidene difluoride (PVDF) membranes with a transfer apparatus (Bio-Rad Laboratories, Inc.). The PVDF membranes were incubated in 5% non-fat milk containing Tris-buffered saline containing Tween-20 (TBST) for 3 h at room temperature. The PVDF membranes were sequentially incubated with primary antibodies against PDK1 (cat. no. 5662), phosphorylated (p)-YAP (S127, #13008), YAP (cat. no. 14074), TNF-α (cat. no. 5178), NF-κB p50 (cat. no. 8242), histone (cat. no. 7631), SAV1 (cat. no. 13301), MST1 (cat. no. 14946), LATS1 (cat. no. 3477) (all from Cell Signaling Technology) and GAPDH (cat. no. AF0006; Shanghai Boyun Biotech Co., Ltd.) at a dilution of 1:1,000 overnight at 4°C. Following incubation with the primary antibodies, the membranes were washed in a TBST 4 times for 10 min and incubated with mouse anti-rabbit IgG (H&L)-horseradish peroxidase conjugate (1:1,500 dilution; cat. no. sc2357; Santa Cruz Biotechnology, Inc.) for 3 h at room temperature. The blots were visualized using Enhanced Chemiluminescence Western Blotting Luminol Reagent (GE Healthcare) and were semi-quantified using Image-Pro Plus 6.0 image analysis software (Media Cybernetics, Inc.).

In vivo injections with YAP inhibitor

The PD7 Pdk1flx/flxGdf9Cre mice were administered DMSO (vehicle) or 100 mg/kg verteporfin (VP), which is a potent YAP inhibitor, intraperitoneally at 3-day intervals for 14 days. A total of 10 mice were used with 5 mice in each group. Ovaries were collected and embedded in paraffin, and serial sections of 8 µm thickness were prepared and stained with hematoxylin and eosin. The morphology of the ovaries was observed under a microscope (DP25, Olympus), and number of primordial follicles and activated follicles were counted.

Nuclear extraction

Nuclear protein extraction was performed according to the following protocol: Oocytes were lysed using buffer I containing 10 mmol/l HEPES, 10 mmol/l KCl, 1 µmol/l EDTA, 1 µmol/l EGTA, 15% Nonidet, protease and phosphatase inhibitors. Following centrifugation (12,000 × g at 4°C for 15 min) the supernatant (cytosolic fraction) was transferred to a new tube and stored or immediately used for western blot analysis. The remaining pellet containing the nuclear fraction was dissolved in 40 µl buffer II consisting of 20 mmol/l HEPES, 400 mmol/l NaCl, 0.01 mol/l EDTA, 0.01 mol/l EGTA, 15% Nonidet, and protease and phosphatase inhibitors. Subsequently, this solution was sonicated 2 times for 5 sec at 50 Watts at 4°C. Following centrifugation (12,000 × g at 4°C for 15 min) the supernatant containing the nuclear fraction was transferred to a new tube and stored at −80°C or was immediately used.

Co-immunoprecipitation

The protein concentration prepared from ooytes was measured using the BCA protein assay kit. Subsequently, IP was conducted using a Pierce Classic IP kit (cat. no. 26146; Pierce; Thermo Fisher Scientific, Inc.). For 1 mg lysate, 80 µl Control Agarose Resin slurry was added to preclear the lysate. Subsequently, PDK1 (1:50, cat. no. 5662), SAV1 (1:50, cat. no. 13301), MST1 (1:50, cat. no. 14946), LAST1 (1:50, cat. no. 3477) (all from Cell Signaling Technology) and GAPDH (1:50, cat. no. AF0006; Shanghai Boyun Biotech Co., Ltd.) was added to the precleared cell lysate in a microcentrifuge tube; the antibody/lysate solution was diluted to 300-600 µl with PBS. Rabbit IgG was used as a negative control (1:50, cat. no. 2729; Cell Signaling Technology). The solution was incubated overnight at 4̊C to form the immune complex in the spin column. To capture the immune complex, the antibody/lysate sample was added to Protein A/G Plus Agarose in the spin column (supplied in the IP kit), and the column was incubated with gentle end-over-end shaking for 1 h at 4°C. Subsequently, the sample was centrifuged 100 × g for 1 min 4°C and the flow-through was saved. The spin column containing the resin was transferred into a new collection tube and 2X reducing sample buffer was added and incubated at 100°C for 5-10 min. The samples were further centrifuged 100 × g for 1 min 4°C to collect the eluate. Finally, the eluate and flow-through were separated by 10% SDS-PAGE and examined by western blot analysis.

Serum analysis

A mixture of 0.75 ml ketamine (150 mg/kg) and 0.25 ml xylazine (10 mg/kg) was prepared and diluted to 5 ml with sterile 1X PBS (19). Mice (20 g) were administered a 0.125 ml mixture for anesthesia via i.p. injection. Once the rodents no longer responded to an interdigital pinch, they were transferred to a temperature-controlled surgical plate. Blood (700 µl) was collected via cardiac puncture. A total of 10 mice were used with 5 in each group. Mouse blood was centrifuged at 453 × g at 4°C for 10 min. The supernatants were collected and these serum samples were used for ELISA. ELISAs were performed according to the manufacturer's instructions for the mouse FSH ELISA kits (Westang Bio-Tech Co., Ltd.). The human Luteinizing Hormone ELISA kit was purchased from Abcam (ab108651, Abcam). Briefly, 100 µl serum, along with mouse E2 standards (at concentrations of 8,000, 4,000, 2,000, 1,000, 500, 250 and 125 pg/ml) and mouse FSH standards (at concentrations of 10, 5, 2.5, 1.25, 0.625, 0.312 and 0.156 ng/ml), was added to pre-coated 96-well detection plates and incubated for 60 min at 37°C. The solution was discarded and the plates were washed 3 times with wash solution. Horseradish peroxidase-conjugated detection antibodies (dilution 1:500; ab205718, Abcam) were added and incubated for 60 min at 37°C. Subsequently, stop solution was added and the optical density of each well in the 96-well plate was measured at a wavelength of 450 nm.

Statistical analysis

The experiments were performed in 5 mice every time and repeated for at least 3 times. The reproducibility rate of this study is 90%. Statistical analysis of the experimental results was performed using GraphPad Prism 5 (GraphPad Software, Inc.), ImageJ 1.8.0 (National Institutes of Health), Image-Pro Plus 6, and SPSS 22.0 (IBM Corp.) statistical software. All data are expressed as the means ± SEM. Differences among groups were analyzed by one-way analysis of variance followed by Tukey's post hoc test using SPSS 22.0 software. A value of P<0.05 was considered to indicate a statistically significant difference.

Results

Depletion of Pdk1 in oocytes causes massive primordial follicle activation

To investigate the function of PDK1, a conditional knockout mice were generated by crossing Pdk1flx/flx mice with transgenic mice expressing Gdf9 promoter-mediated Cre recombinase. Gdf9Cre is highly expressed in oocytes and causes the inactivation of Pdk1 in primordial follicles and in later developmental stages. Pdk1flx/flxGdf9Cre mice were used to examine the effects of the conditional deficiency of Pdk1 on primordial follicle activation. The successful depletion of Pdk1 in the mouse oocytes was confirmed by RT-qPCR and western blot analysis (Fig. 1A and B). A breeding assay was then performed to examine the effects of Pdk1 deletion on female fertility. As shown in Fig. 1C, female Pdk1flx/flxGdf9Cre mice were significantly infertile compared with the wild type (Pdk1flx/flx mice). In order to investigate the potential causes of the decreased fertility in the mutant mice, the levels of gonadotropins, including follicle-stimulating hormone (FSH) and luteinizing hormone (LH) level were measured in mouse serum, which may indicate ovary function. The levels of FSH and LH were significantly increased in the Pdk1flx/flxGdf9Cre mice, indicating that follicle growth may be accelerated (Fig. 1D and E). The morphology of the ovaries from the Pdk1flx/flx and Pdk1flx/flxGdf9Cre mice was also observed. It was found that at postnatal day (PD)7 and PD14, massive primordial follicles were activated, with an increased number of primary or secondary follicles (Fig. 2A-E). At PD7, the Pdk1flx/flxGdf9Cre mice had 201±43 secondary follicles compared to 89±22 in their counterparts. The number of primordial follicles was 1,817±58 in the control littermates and was reduced to 1,243±89 in the Pdk1flx/flxGdf9Cre mice (Fig. 2C).

Figure 1

PDK1 is essential for female fertility. Oocytes were isolated from ovaries from 21-day-old Pdk1flx/flx and Pdk1flx/flxGdf9Cre mice. (A) Pdk1 expression was examined by RT-qPCR and normalized to GAPDH. (B) Western blot analysis was performed to detect PDK1 and GAPDH protein levels. (C) Breeding assay was performed and the cumulative number of progeny/female in Pdk1flx/flx and Pdk1flx/flxGdf9Cre mice was compared. (D) Sera from 2-month-old Pdk1flx/flx and Pdk1flx/flxGdf9Cre mice were collected for the measurement of FSH. (E) Sera from 2-month-old Pdk1flx/flx and Pdk1flx/flxGdf9Cre mice were collected for the measurement of LH. n=5, *P<0.05 compared with control. PDK1, serine/threonine protein kinase phosphoinositide-dependent kinase 1; FSH, follicle-stimulating hormone; LH, luteinizing hormone.

Figure 2

Depletion of Pdk1 in oocytes causes massive primordial follicle activation. Ovaries from Pdk1flx/flx and Pdk1flx/flxGdf9Cre mice were embedded in paraffin, and serial sections of 8 µm thickness were prepared and stained with hematoxylin and eosin. (A) Morphological analysis of ovaries from Pdk1flx/flx littermates at PD7. (B) Morphological analysis of ovaries from Pdk1flx/flxGdf9Cre littermates at PD7. (C) Quantification of follicle numbers in ovaries of PD7 old Pdk1flx/flx mice and their Pdk1flx/flxGdf9Cre littermates. (D) Morphological analysis of ovaries from Pdk1flx/flx littermates at PD14. (E) Morphological analysis of ovaries from Pdk1flx/flxGdf9Cre littermates at PD14. (F) Quantification of follicle numbers in ovaries of PD14 old Pdk1flx/flx mice and their Pdk1flx/flxGdf9Cre littermates. (G) Morphological analysis of ovaries from Pdk1flx/flx littermates at PD21. (H) Morphological analysis of ovaries from Pdk1flx/flxGdf9Cre littermates at PD21. (I) Quantification of follicle numbers in ovaries of PD21 old Pdk1flx/flx mice and their Pdk1flx/flxGdf9Cre littermates. (J) Morphological analysis of ovaries from Pdk1flx/flx littermates at 2-month old. (K) Morphological analysis of ovaries from Pdk1flx/flxGdf9Cre littermates at 2-month old. (L) Quantification of follicle numbers in ovaries of 2-month old Pdk1flx/flx mice and their Pdk1flx/flxGdf9Cre littermates. n=5, *P<0.05 compared with the control. PDK1, serine/threonine protein kinase phosphoinositide-dependent kinase 1; PD, postnatal day; M, months.

At PD14, the Pdk1flx/flxGdf9Cre mouse ovaries contained 257±75 primary follicles and 323±49 secondary follicles, compared to 103±10 and 156±25 the controls, respectively (Fig. 2D-F). The number of primordial follicles was significantly decreased from 1,453±164 in the counterparts to 900±48 in the Pdk1flx/flxGdf9Cre mouse ovaries (Fig. 2F). At PD21, the secondary follicle number was increased along with a diminished number of antral follicles and the total number of follicles in the Pdk1flx/flxGdf9Cre mouse ovaries (Fig. 2G-I). Almost all primordial follicles were activated by 2 months of age and only a small number of primordial follicles and growing follicles existed in the Pdk1flx/flxGdf9Cre mice, whereas most of the follicles in the control mouse ovaries were still at the primordial stage (Fig. 2J-L). The results of this study thus indicate that the deletion of Pdk1 leads to massive primordial activation and causes POF.

YAP expression is upregulated in Pdk1flx/flxGdf9Cre mice

The activation of YAP is determined by the hypophosphorylation of YAP at the Ser127 residue, an increase in YAP and their target gene expression, and the nuclear localization of YAP. As a key mediator of chemoresistance in various types of cancer, it has been reported that the disruption of YAP expression also plays a role in the development of POF (12). To investigate whether YAP contributes to massive primordial follicle loss in Pdk1flx/flxGdf9Cre mice, YAP expression was examined by western blot analysis. The results demonstrated that there was a significant increase in YAP expression and a significant decrease in YAP phosphorylation in the ovaries of Pdk1flx/flxGdf9Cre mice (Fig. 3A). RT-qPCR analysis also revealed that the expression levels of YAP target genes, including CYR61, CTGF and ANKRD1, were significantly lower in the ovaries of Pdk1flx/flxGdf9Cre mice compared with the controls (Fig. 3B). These data thus indicated that YAP activity was enhanced in the Pdk1flx/flxGdf9Cre mice.

Figure 3

Depletion of Pdk1 in oocytes enhances YAP expression. (A) Secondary and antral follicles were isolated from PD7 Pdk1flx/flx and Pdk1flx/flxGdf9Cre mouse ovaries, protein was extracted, and western blot analysis was performed using antibodies against YAP and phosphorylated YAP. GAPDH was used as a control. (B) Secondary and antral follicles were isolated from PD7 Pdk1flx/flx and Pdk1flx/flxGdf9Cre mouse ovaries and RNA was extracted for cDNA conversion and RT-qPCR. The mRNA expression of CYR61, CTGF and ANKRD1 was measured. Data were normalized to GAPDH expression and are presented as the mean relative quantity (compared with control). n=5, *P<0.05 compared with the control. PDK1, serine/threonine protein kinase phosphoinositide-dependent kinase 1; YAP, Yes-associated protein; CYR61, cellular communication network factor 1 (CCN1; also known as and referred to herein as CYR61); CTGF, cellular communication network factor 2 (CCN2, also known as and referred to herein as CTGF); and ANKRD1, ankyrin repeat domain 1.

YAP activation promotes pro-inflammatory responses in Pdk1flx/flxGdf9Cre mouse oocytes

To investigate whether YAP mediates the pro-inflammatory responses in Pdk1flx/flxGdf9Cre mouse oocytes, the expression levels of inflammatory cytokine genes were examined by RT-qPCR and western blot analysis. It was observed that the expression of TNF-α was elevated in the Pdk1flx/flxGdf9Cre mouse oocytes at both the mRNA and protein level (Fig. 4A and B). The mRNA expression of cytokines was also measured, and it was found that there was a significant elevation in the levels of IL-1β, IL-6 and IL-8 in the Pdk1flx/flxGdf9Cre mouse oocytes (Fig. 4C). Furthermore, to examine the association between Pdk1 deletion and the activation of NF-κB, the expression of NF-κB p50 was examined at the protein level (Fig. 4D). The results revealed that the expression of NF-κB was upregulated in the Pdk1flx/flxGdf9Cre mouse oocytes compared with the wild-type control. Taken together, these results indicate that Pdk1 deletion may induce inflammation in oocytes, which in turn contributes to POF.

Figure 4

YAP activation promotes pro-inflammatory responses in Pdk1flx/flxGdf9Cre mouse oocytes. Oocytes were isolated from PD7 Pdk1flx/flx and Pdk1flx/flxGdf9Cre ovaries, and protein was extracted. (A and C) Total RNA was analyzed by RT-qPCR to determine the mRNA expression profiles of TNF-α, IL-1β, IL-6 and IL-8. The expression was normalized to GAPDH. (B) Protein from oocytes were subjected to western blot analysis for TNF-α analysis. The protein profiles were normalized to GAPDH. (D) The nuclear proteins of NF-κB p50 were extracted and were subjected to western blot analysis. The protein profiles were normalized to histone. n=5, *P<0.05 vs. the control. PDK1, serine/threonine protein kinase phosphoinositide-dependent kinase 1; YAP, Yes-associated protein; TNF-α, tumor necrosis factor-α; IL, interleukin.

PDK1 directly interacts with the Hippo complex

To investigate whether PDK1 is involved in forming the complex in Hippo signaling pathway to regulate YAP activity, co-immunoprecipitation with endogenous PDK1 in oocytes was performed. The results revealed that SAV1, MST1 and LATS1, co-immunoprecipitated with endogenous PDK1. The interaction of PDK1 with all of these components was normal in the Pdk1flx/flx mouse oocytes with or without PDK1 inhibitor, while there was no detection of interaction in the Pdk1flx/flxGdf9Cre mouse oocytes (Fig. 5). This may be due to the reason that Pdk1 deletion caused the disruption of interaction with the complex in Hippo signaling. The results demonstrated that SAV1, MST1 and LATS1, coimmunoprecipitated with endogenous PDK1 in the wild-type oocytes, suggesting that PDK1 is a component of the Hippo pathway complex.

Figure 5

PDK1 directly interacts with the Hippo complex. Oocytes were isolated from PD7 Pdk1flx/flx and Pdk1flx/flxGdf9Cre mouse ovaries, and protein was extracted. Co-immunoprecipitation was performed in endogenous PDK1 binding to the Hippo complex proteins. The precipitated PDK1 immunocomplex input samples were subjected to western blot analysis with the indicated antibody. n=5. PDK1, serine/threonine protein kinase phosphoinositide-dependent kinase 1; SAV1, salvador family WW domain containing protein 1; MTS1, macrophage stimulating 1; LATS1, large tumor suppressor kinase 1.

Suppressed expression of YAP reverses the overactivation of primordial follicles in Pdk1flx/flxGdf9Cre mouse ovaries

In order to provide in vivo evidence that increased YAP activity accelerates the overactivation of primordial follicles in Pdk1flx/flxGdf9Cre mice, this study intraperitoneally injected PD7 Pdk1flx/flxGdf9Cre mice with VP, a potent YAP inhibitor, at 3-day intervals for 14 days. The mice were sacrificed, and ovarian morphology was examined.

It was indicated that in the PD21 Pdk1flx/flxGdf9Cre mice injected with VP, the expression of YAP was suppressed with an increased level of phosphorylated YAP (Fig. 6A). Typical primordial follicles were found in the Pdk1flx/flxGdf9Cre mice treated with VP, while in the ovaries of PD21 Pdk1flx/flxGdf9Cre mice that were treated with the vehicle (control), the majority of primordial follicles was activated (Fig. 6B). The quantification of the aforementioned results of follicle numbers revealed that the proportion of primordial follicles in the VP-treated Pdk1flx/flxGdf9Cre ovaries was upregulated by 60%, which was similar to its counterparts (61%) (Fig. 6C). These results demonstrated that increased YAP activity in oocytes was the major factor that activated the primordial follicle pool in Pdk1flx/flxGdf9Cre mice, suggesting that a low expression of YAP is indispensable for the preservation of primordial follicles in a dormant state.

Figure 6

The suppressed expression of YAP reverses the overactivation of primordial follicles in Pdk1flx/flxGdf9Cre mouse ovaries. PD7 Pdk1flx/flxGdf9Cre mice were administered DMSO (vehicle) or 100 mg/kg verteporfin, which is a potent YAP inhibitor, intraperitoneally at 3-day intervals for 14 days. (A) Ovaries were collected, and protein was extracted, and western blot analysis was performed using antibodies against YAP and phosphorylated YAP. GAPDH was used as a control. Expression intensity was quantified using ImageJ software. (B and C) Ovaries were collected and embedded in paraffin, and serial sections of 8 µm thickness were prepared and stained with hematoxylin and eosin. Morphology of ovaries were observed, and number of primordial follicles were counted. n=5, *P<0.05. PDK1, serine/threonine protein kinase phosphoinositide-dependent kinase 1; VP, verteporfin.

Discussion

In this study, it was found that the PDK1-YAP signaling pathway plays an essential role in maintaining the survival of primordial follicles and the activation of growing follicles. The deletion of Pdk1 contributed to an enhanced YAP expression and its cytoplasm-nucleus translocation, causing a pro-inflammatory response, which was responsible for primordial follicle activation. Therefore, this study suggests that the maintenance of the primordial follicle pool is dependent on PDK1 in mouse ovaries (Fig. 7).

Figure 7

Working model. Oocyte-specific deletion of Pdk1 caused enhanced expression of YAP, leading to increased proinflammatory response, contributing to premature ovarian failure. Pdk1, serine/threonine protein kinase phosphoinositide-dependent kinase 1; YAP, Yes-associated protein; POF, premature ovarian failure.

It has been reported that the deletion of Pdk1 in oocytes can cause the accelerated loss of primordial follicles through rpS6 inactivation, which is vital for mediating ribosome biogenesis and protein translation in oocytes (18). PTEN activity adjusts PI3K/PDK1 signaling in oocytes to an optimal level, so that the pool of primordial follicles can be maintained in a dormant and surviving condition. In this study, in our mouse model, it was found that the deletion of Pdk1 in oocytes activated primordial follicles to transition into growing follicles. It was further indicated that the expression of YAP, which controls cell proliferation, was enhanced in Pdk1 oocyte-specific knockout mice. The suppression of YAP in Pdk1 knockout mice may maintain the number of primordial follicles compared with the vehicle control, indicating that YAP plays an essential role in regulating POF. The expression of the core components of Hippo pathway was altered with follicle development, and the trend of this alteration was consistent with that in follicles cultured in vitro in a recent study (19). Primordial follicle activation was accompanied by the attenuation of the Hippo pathway, therefore suggesting a close association of the Hippo pathway and primordial-to-primary transition.

Prostaglandins (PGs) may also serve as non-negligible factors that may contribute to premature follicle activation. PGs have been reported to be involved in female reproductive functions, including ovulation, fertilization and implantation (20). The cyclooxygenase (COX) isozymes, COX-1 and COX-2, are considered to be the primary producers of PGs (21). Oocytes are arrested at the germinal vesicle stage before the surge of pituitary luteinizing hormone, inducing epidermal growth factor-like growth factors, which can promote meiotic resumption and cumulus expansion by depositing via COX-2 expression (22). It has been reported that PGs can mediate inflammation by regulating YAP expression (23). PGs can also activate PKD1 expression to regulate cell proliferation (24).

The Hippo signaling pathway controls organ size in mammals by regulating apoptosis and cell proliferation (25). The nuclear accumulation and activation of YAP, the main transcriptional effector of the Hippo signaling pathway, is associated with organ growth, the loss of contact inhibition, cellular proliferation and inhibition of apoptotic signals. Emerging studies have revealed the critical role of YAP in ovarian follicle development. In mammals, there are 4 core components of the Hippo pathway, which includes serine/threonine kinases MST1/2 (homologs of Hippo/Hpo), LATS1/2 (homologs of Warts/Wts), their adaptor proteins SAV1 (homolog of Salvador/Sav) and MOB (homologs of MATS) (26). It is indispensable to form the MST1, SAV1 and LATS1 complex for the Hippo signaling cascade. The disruption of the Hippo signaling pathway and the stimulation of Akt can preserve the ovarian follicles and may serve as a potential treatment option for infertile women (12). However, the underlying mechanisms through which Hippo signaling regulates follicle activation remain unclear. In this study, it was found that PDK1 coimmunoprecipitated with Hippo signaling kinases, including SAV1, MST1 and LATS1 in wild-type mouse oocytes. Whereas, in Pdk1flx/flxGdf9Cre mouse oocytes, THE deletion of Pdk1 caused the dissociation of kinase complex and the dephosphorylation and the nuclear translocation of YAP.

Inflammation serves a number of physiological roles in follicologenesis, and mammalian ovulation has been reported to share similarities properties with the inflammatory response (27). IL-8, a leukocyte chemotactic and neutrophil-activating cytokine, is present in preovulatory follicles and plays a role in ovulation (27). IL-1α, IL-6, IL-8 and TNF-α expression is increased in granulosa cells of antral follicles compared with dormant follicles (28). In this study, in our mouse model, there was a significant increase in the levels of IL-1α, IL-6, IL-8 and TNF-α in Pdk1flx/flxGdf9Cre mouse ovaries, indicating that an enhanced pro-inflammatory response contributed to premature follicle activation.

However, this study also presented with a number of limitations. PDK1 is one of the vital gates for the Akt/mTOR signaling pathway; therefore, the deletion of Pdk1 may cause other molecular alterations, apart from YAP, which may also contribute to premature follicle activation. Furthermore, the deletion of the Pdk1 gene cannot be performed in humans; therefore the importance of Pdk1 in human physiology cannot be fully explained. Future studies are required to focus on the collection of human oocyte samples from premature ovarian failure and examine Pdk1 expression in these samples. In addition, the treatment of mice with PDK1 inhibitor or activator may be performed to observe the effects on the ovaries. The identification of the role of the PDK1/YAP signaling in regulating follicle development may provide novel prospects for understanding the specific mechanisms of the activation of primordial follicles in mammalian ovaries. This study may serve as a valuable clinical indicator for designing treatments for POF.

In conclusion, this study found that PDK1 was pivotal for maintaining female fertility, and the deletion of Pdk1 in mouse oocytes induced the overactivation of the primordial follicles, resulting in follicular exhaustion and POF in adulthood. Furthermore, these results suggested that the deletion of Pdk1 enhanced proinflammatory reaction and increased YAP nuclear location, which resulted in massive follicular activation in knockout mice and eventually led to premature ovarian failure. Thus, PDK1 is a critical gatekeeper for regulating primordial follicle dormancy and/or activation.

Funding

This study was financially supported by grants from the China Postdoctoral Science Foundation (Project no. 2017M611391) and the Hei Long Jiang Postdoctoral Foundation (Project no. LBH-Z17139).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

JG and PL were involved in the conception of the study. JG was involved in the study methodology. TS was involved in data analysis. DC was involved in data validation. CL was involved in formal analysis. JJ was involved in the investigative aspect of the study. JP and YY were responsible for the experimental design. JG was involved in the writing of and preparation of the original draft. PL was involved in the writing, reviewing and editing of the manuscript. PL supervised the study, was responsible for project administration and funding acquisition. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

All animal experimental procedures were approved by the Committee on the Use of Live Animals in Teaching and Research of Harbin Medical University (Harbin, China).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Abbreviations:

PDK1

serine/threonine protein kinase phosphoinositide-dependent kinase 1

FSH

follicle-stimulating hormone

LH

luteinizing hormone

YAP

Yes-associated protein

POF

premature ovarian failure

PI3K

phosphatidyl inositol-3 kinase

PTEN

phosphatase and tensin homolog deleted on chromosome 10

PGs

prostaglandins

COX

cyclooxygenase

Acknowledgments

Not applicable.

References

1 

Laml T, Schulz-Lobmeyr I, Obruca A, Huber JC and Hartmann BW: Premature ovarian failure: Etiology and prospects. Gynecol Endocrinol. 14:292–302. 2000. View Article : Google Scholar : PubMed/NCBI

2 

Goswami D and Conway GS: Premature ovarian failure. Hum Reprod Update. 11:391–410. 2005. View Article : Google Scholar : PubMed/NCBI

3 

Meskhi A and Seif MW: Premature ovarian failure. Curr Opin Obstet Gynecol. 18:418–426. 2006. View Article : Google Scholar : PubMed/NCBI

4 

Rebar RW: Premature ovarian failure In: Treatment of the Postmenopausal Woman. 3rd edition. Elsevier; pp. 99–109. 2007

5 

Yang KJ, Shin S, Piao L, Shin E, Li Y, Park KA, Byun HS, Won M, Hong J, Kweon GR, et al: Regulation of 3-phosphoinositide-dependent protein kinase-1 (PDK1) by Src involves tyrosine phosphorylation of PDK1 and Src homology 2 domain binding. J Biol Chem. 283:1480–1491. 2008. View Article : Google Scholar

6 

Huang J, Wu S, Barrera J, Matthews K and Pan D: The hippo signaling pathway coordinately regulates cell proliferation and apoptosis by inactivating yorkie, the drosophila homolog of YAP. Cell. 122:421–434. 2005. View Article : Google Scholar : PubMed/NCBI

7 

Pan D: Hippo signaling in organ size control. Genes Dev. 21:886–897. 2007. View Article : Google Scholar : PubMed/NCBI

8 

Halder G and Johnson RL: Hippo signaling: Growth control and beyond. Development. 138:9–22. 2011. View Article : Google Scholar :

9 

Hergovich A: YAP-Hippo signalling downstream of leukemia inhibitory factor receptor: Implications for breast cancer. Breast Cancer Res. 14:3262012. View Article : Google Scholar : PubMed/NCBI

10 

Zhao B, Wei X, Li W, Udan RS, Yang Q, Kim J, Xie J, Ikenoue T, Yu J, Li L, et al: Inactivation of YAP oncoprotein by the hippo pathway is involved in cell contact inhibition and tissue growth control. Genes Dev. 21:2747–2761. 2007. View Article : Google Scholar : PubMed/NCBI

11 

Grijalva JL, Huizenga M, Mueller K, Rodriguez S, Brazzo J, Camargo F, Sadri-Vakili G and Vakili K: Dynamic alterations in hippo signaling pathway and YAP activation during liver regeneration. Am J Physiol Gastrointest Liver Physiol. 307:G196–G204. 2014. View Article : Google Scholar : PubMed/NCBI

12 

Kawamura K, Cheng Y, Suzuki N, Deguchi M, Sato Y, Takae S, Ho CH, Kawamura N, Tamura M, Hashimoto S, et al: Hippo signaling disruption and Akt stimulation of ovarian follicles for infertility treatment. Proc Natl Acad Sci USA. 110:17474–17479. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Espey LL: Ovulation as an inflammatory reaction-a hypothesis. Biol Reprod. 22:73–106. 1980. View Article : Google Scholar : PubMed/NCBI

14 

Espey LL: Current status of the hypothesis that mammalian ovulation is comparable to an inflammatory reaction. Biol Reprod. 50:233–238. 1994. View Article : Google Scholar : PubMed/NCBI

15 

Malizia BA, Wook YS, Penzias AS and Usheva A: The human ovarian follicular fluid level of interleukin-8 is associated with follicular size and patient age. Fertili Steril. 93:537–543. 2010. View Article : Google Scholar

16 

Erbas O, Pala HG, Pala EE, Oltulu F, Aktug H, Yavasoglu A and Taskiran D: Ovarian failure in diabetic rat model: Nuclear factor-kappaB, oxidative stress, and pentraxin-3. Taiwan J Obstet Gynecol. 53:498–503. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Pedersen T and Peters H: Proposal for a classification of oocytes and follicles in the mouse ovary. J Reprod Fertil. 17:555–557. 1968. View Article : Google Scholar : PubMed/NCBI

18 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar

19 

Wei JL and Liu CJ: Establishment of a modified collagen-induced arthritis mouse model to investigate the Anti-inflammatory activity of progranulin in inflammatory arthritis. Methods Mol Biol. 2108:305–313. 2018. View Article : Google Scholar

20 

Reddy P, Adhikari D, Zheng W, Liang S, Hämäläinen T, Tohonen V, Ogawa W, Noda T, Volarevic S, Huhtaniemi I and Liu K: PDK1 signaling in oocytes controls reproductive aging and lifespan by manipulating the survival of primordial follicles. Hum Mol Genet. 18:2813–2824. 2009. View Article : Google Scholar : PubMed/NCBI

21 

Hu LL, Su T, Luo RC, Zheng YH, Huang J, Zhong ZS, Nie J and Zheng LP: Hippo pathway functions as a downstream effector of AKT signaling to regulate the activation of primordial follicles in mice. J Cell Physiol. 234:1578–1587. 2019. View Article : Google Scholar

22 

Bazan NG, Colangelo V and Lukiw WJ: Prostaglandins and other lipid mediators in alzheimer's disease. Prostaglandins Other Lipid Mediat. 68:197–210. 2002. View Article : Google Scholar : PubMed/NCBI

23 

Poligone B and Baldwin AS: Positive and negative regulation of NF-κB by COX-2 roles of different prostaglandins. J Biol Chem. 276:38658–38664. 2001. View Article : Google Scholar : PubMed/NCBI

24 

Konturek P, Kania J, Burnat G, Hahn EG and Konturek SJ: Prostaglandins as mediators of COX-2 derived carcinogenesis in gastrointestinal tract. J Physiol Pharmacol. 56:57–73. 2005.PubMed/NCBI

25 

Kim HB, Kim M, Park YS, Park I, Kim T, Yang SY, Cho CJ, Hwang D, Jung JH, Markowitz SD, et al: Prostaglandin E2 activates YAP and a positive-signaling loop to promote colon regeneration after colitis but also carcinogenesis in mice. Gastroenterology. 152:616–630. 2017. View Article : Google Scholar

26 

Fan Y, Wang Y and Wang K: Prostaglandin E 2 stimulates normal bronchial epithelial cell growth through induction of c-Jun and PDK1, a kinase implicated in oncogenesis. Respir Res. 16:1492015. View Article : Google Scholar

27 

Zhao B, Li L, Lei Q and Guan KL: The Hippo-YAP pathway in organ size control and tumorigenesis: An updated version. Genes Dev. 24:862–874. 2010. View Article : Google Scholar : PubMed/NCBI

28 

Pan D: The hippo signaling pathway in development and cancer. Dev Cell. 19:491–505. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Gao J, Song T, Che D, Li C, Jiang J, Pang J, Yang Y and Li P: Deficiency of Pdk1 contributes to primordial follicle activation via the upregulation of YAP expression and the pro‑inflammatory response. Int J Mol Med 45: 647-657, 2020.
APA
Gao, J., Song, T., Che, D., Li, C., Jiang, J., Pang, J. ... Li, P. (2020). Deficiency of Pdk1 contributes to primordial follicle activation via the upregulation of YAP expression and the pro‑inflammatory response. International Journal of Molecular Medicine, 45, 647-657. https://doi.org/10.3892/ijmm.2019.4437
MLA
Gao, J., Song, T., Che, D., Li, C., Jiang, J., Pang, J., Yang, Y., Li, P."Deficiency of Pdk1 contributes to primordial follicle activation via the upregulation of YAP expression and the pro‑inflammatory response". International Journal of Molecular Medicine 45.2 (2020): 647-657.
Chicago
Gao, J., Song, T., Che, D., Li, C., Jiang, J., Pang, J., Yang, Y., Li, P."Deficiency of Pdk1 contributes to primordial follicle activation via the upregulation of YAP expression and the pro‑inflammatory response". International Journal of Molecular Medicine 45, no. 2 (2020): 647-657. https://doi.org/10.3892/ijmm.2019.4437
Copy and paste a formatted citation
x
Spandidos Publications style
Gao J, Song T, Che D, Li C, Jiang J, Pang J, Yang Y and Li P: Deficiency of Pdk1 contributes to primordial follicle activation via the upregulation of YAP expression and the pro‑inflammatory response. Int J Mol Med 45: 647-657, 2020.
APA
Gao, J., Song, T., Che, D., Li, C., Jiang, J., Pang, J. ... Li, P. (2020). Deficiency of Pdk1 contributes to primordial follicle activation via the upregulation of YAP expression and the pro‑inflammatory response. International Journal of Molecular Medicine, 45, 647-657. https://doi.org/10.3892/ijmm.2019.4437
MLA
Gao, J., Song, T., Che, D., Li, C., Jiang, J., Pang, J., Yang, Y., Li, P."Deficiency of Pdk1 contributes to primordial follicle activation via the upregulation of YAP expression and the pro‑inflammatory response". International Journal of Molecular Medicine 45.2 (2020): 647-657.
Chicago
Gao, J., Song, T., Che, D., Li, C., Jiang, J., Pang, J., Yang, Y., Li, P."Deficiency of Pdk1 contributes to primordial follicle activation via the upregulation of YAP expression and the pro‑inflammatory response". International Journal of Molecular Medicine 45, no. 2 (2020): 647-657. https://doi.org/10.3892/ijmm.2019.4437
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team