Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
August-2021 Volume 48 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
August-2021 Volume 48 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Antioxidant stress and anticancer activity of peptide‑chelated selenium in vitro

  • Authors:
    • Xian Li
    • Xianjue Wang
    • Gang Liu
    • Yanan Xu
    • Xinlin Wu
    • Ru Yi
    • Feng Jin
    • Chula Sa
    • Xiulan Su
  • View Affiliations / Copyright

    Affiliations: Key Laboratory of Medical Cell Biology in Inner Mongolia, Clinical Medical Research Center, The Affiliated Hospital of Inner Mongolia Medical University, Hohhot, Inner Mongolia 010050, P.R. China, Department of Gastrointestinal Surgery, The Affiliated Hospital of Inner Mongolia Medical University, Hohhot, Inner Mongolia 010059, P.R. China, Inner Mongolia Medical University, Hohhot, Inner Mongolia 010059, P.R. China
    Copyright: © Li et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 153
    |
    Published online on: June 18, 2021
       https://doi.org/10.3892/ijmm.2021.4986
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The association between selenium and peptide in gastric cancer is an important research topic. The present study reported the facile synthesis of anticancer bioactive peptide (ACBP)‑functionalized selenium (ACBP‑S‑Se) particles with enhanced anticancer activities and a detailed mechanistic evaluation of their ability to regulate oxidative stress in vitro. Structural and chemical characterizations were revealed by ultraviolet absorption, Fourier transform infrared, X‑ray photoelectron, nuclear magnetic resonance carbon and hydrogen, energy dispersive X‑ray spectroscopy and inductively coupled plasma mass spectrometry, as well as scanning electron microscopy. Sulfhydrylation modifications of ACBP were achieved with S‑acetylmercaptosuccinic anhydride via chemical absorption. After the polypeptide was modified by sulfhydrylation, the ACBP chain was linked to sulfhydryl groups by amide bonds to form the ACBP‑chelated selenium complex. Two gastric cancer cell lines (MKN‑45 and MKN‑74 cells) demonstrated high susceptibility to ACBP‑S‑Se particles and displayed significantly decreased proliferation ability following treatment. The results suggested that the bioactive peptide‑chelated selenium particles effectively inhibited the proliferation of MKN‑45 and MKN‑74 cells in vitro. The genes encoding CDK inhibitor 1A (CDKN1A), cyclin B1, thioredoxin (TXN) and mitogen‑activated protein kinase kinase kinase 5 are associated with regulation of oxidative stress, while CDKN1A and TXN protect cells by decreasing oxidative stress and promoting cell growth arrest. Therefore, ACBP‑S‑Se may be an ideal chemotherapeutic candidate for human cancer, especially gastric cancer.

Introduction

Oxidative stress refers to aberrant production of active substances, including reactive oxygen species (ROS) and nitrogen free radicals, under various stress stimuli, which leads to an unbalanced physiological status or oxidative stress (OS)-associated damage via oxidation-reduction reactions (1). Previous studies revealed that ROS generated by cells under OS are involved in gastric tumorigenesis (2,3).

ROS have been shown to promote gastric carcinogenesis in both clinical studies and mouse models in vivo (4,5). The dysregulation of ROS promotes tumorigenesis and the development of abnormalities due to its ability to increase aberrant cell proliferation, survival and migration in vivo (4,5). Moreover, aberrant production of ROS also induces DNA damage, leading to genomic instability, tumorigenicity and subsequent tumor progression (6). For example, ROS are constantly generated in cells as a consequence of endogenous metabolism, infection/inflammation and/or exposure to environmental toxins (6). If the accumulation of ROS overwhelms the death threshold, cellular apoptosis levels increase, which enhances the antitumor effects of ROS production (7). Fuloria et al (8) confirmed that ROS alleviate certain types of cancer, such as oral (9) and gastric cancer (GC) (10), and that the redox state in cells is an important factor for subsequent tumor formation potential; thus, cellular redox states are potential therapeutic targets for cancer treatment. Finally, ROS may contribute to the regulation of apoptosis (9).

Selenium (Se), with a narrow range between deficiency and toxic effects (11), is a component of the antioxidant system, and one of the most important trace elements in organisms; Se supplements may be effective anti-cancer agents (12,13). Moreover, Se is a key component of the antioxidant system (14) and substantially contributes to human health. The chemical forms of Se regulate its toxicity, bioavailability and diverse biological effects, including anti-inflammatory, antioxidant and immune effects, and lead to severe tissue damage and health complications (15), and supplementation with Se improves the redox system, promotes proper immune system function and has anticarcinogenic effects (16). Se deficiency leads to heart disease, hypothyroidism and a weakened immune system, but excess exposure to Se results in gastrointestinal disturbance and hair and nail changes (17,18). Se enhances the function of the immune system, improves proliferation and biofunction of immune system cells and enhances phagocytosis of immune system cells, thereby improving the immune function and ability to resist disease (19,20). In addition, at higher concentrations, Se exhibits pro-oxidant properties that may be a potential mechanism for cancer therapy (21). Furthermore, Se inhibits hepatocyte necrosis and DNA damage by inhibiting cyclophosphamide-induced OS (22).

Previous studies have confirmed that Se may be a promising therapeutic for cancer (23,24), as it promotes the formation of tumor microenvironment that inhibits cancer proliferation. Following cancer surgery, Se supplementation decreases the risk of cancer recurrence, decreases the toxicity and side effects of chemotherapy and radiotherapy and improves the curative effect of anticancer drugs (25,26). Furthermore, Se, as an essential component of selenocysteine-containing proteins, is involved in cellular biochemistry and function (27).

Selenoproteins are essential for human heath, and have been characterized as antioxidant enzymes, protecting against damage caused by free radicals (28). Further studies on selenoprotein gene expression and cytokine content in the chicken thymus have shown that decreased selenoprotein expression levels induce OS (29,30). In addition, Se-containing molecules exhibit antioxidant properties associated with tumor growth, metastasis, angiogenesis and drug resistance (31). For example, Se-methylselenocysteine offers selective protection against toxicity and potentiates the antitumour activity of anticancer drugs (32). An exciting area of drug design research is the synthesis of the polypeptide chelated selenium, which exhibits cancer stem cell line inhibition and antioxidant activity (33). The anticancer bioactive peptide (ACBP) is a low-molecular weight active peptide extracted from goat liver (34). We previously found that ACBP exhibits antineoplastic activity and inhibits tumor growth in nude mice with Dutch gallbladder carcinoma (35). It also increases the chemotherapeutic sensitizing effect and decreases side effects associated with chemotherapy (35). A number of non-natural selenium-containing amino acid derivatives and peptides have been prepared by chemical synthesis to establish an anti-GC system for treating disease (36). Selenocarbohydrates, selenoamino acids and selenopeptides are utilized in the synthesis of biological compounds. To the best of our knowledge, however, associated OS genes and potential antitumor efficacy of synthesized ACBP-chelated selenium [ACBP functionalized selenium (ACBP-S-Se)] particles have not been previously demonstrated. Furthermore, elucidating the molecular mechanism underlying the antioxidant regulatory effects of the peptide-chelated selenium is important for revealing its ability to regulate tumorigenesis and drug resistance. In addition, selenium nanoparticles loaded with anticancer molecules offer a novel strategy for cancer treatment (37). Moreover, lncRNAs regulate OS to maintain homeostasis (38).

Here, sulfhydrylation modifications of ACBP was performed with S-acetylmercaptosuccinic anhydride (S-AMSA) via chemical absorption. Following sulfhydrylation, the binding site of Se was used to link the sulfhydryl group. The molecular mechanism underlying the antioxidant regulation and antitumor effects of ACBP-S-Se on tumor cell lines was investigated in vitro.

Materials and methods

Materials

ACBP (8,000 kDa) was provided by the Clinical Medicine Research Center of the Affiliated Hospital of Inner Mongolia Medical University (Hohhot, China). S-AMSA (cat. no. 1002008286) and hydroxylamine hydrochloride (cat. no. 1001967036) were purchased from Sigma-Aldrich (Merck KGaA).

Cell culture

Human GC cell lines (MKN-45 and MKN-74) and normal human gastric epithelial cells (GES-1) were purchased from the Institute of Cell Biology of the Chinese Academy of Sciences (Shanghai, China). MKN-74 cells were cultured in DMEM (cat. no. 10566-016, Invitrogen; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (cat. no. 10091148; Gibco; Thermo Fisher Scientific, Inc.) and 100 U/ml penicillin and streptomycin (P/S) at 37°C in a humidified chamber containing 5% CO2. MKN-45 cells and GES-1 were cultured in RPMI-1640 growth medium (cat. no. 61870036; Invitrogen; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (cat. no. 16000-044; Gibco; Thermo Fisher Scientific, Inc.) and 100 U/ml P/S (cat. no. 15140-122; Gibco; Thermo Fisher Scientific, Inc.) at 37°C in a humidified chamber containing 5% CO2.

Synthesis of ACBP-S-Se particles

Briefly, 2.08 g 3-morpho- line-propanosulfonic acid (MOPS; cat. no. 1001878657, Sigma-Aldrich; Merck KGaA) was dissolved in ddH2O (200 ml) to prepare MOPS-buffered solution. ACBP (1 g) was dissolved in MOPS solution with a pH of 7.4 to obtain ACBP solution. Then, 0.4 g S-AMSA was added to the ACBP solution and incubated at 25°C for 2 h, during which pH was maintained at 7.4. The sample was stored in nitrogen to avoid air oxidation products. Then, 0.05 mol/l hydroxylamine hydrochloride was added and the reaction proceeded at 25°C for 3 h. Next, 0.66 g sodium selenite was added to the ACBP-S solution at 30°C for 6 h to obtain the raw ACBP-S-Se product, and gel chromatography column purification was performed again to produce a pure ACBP-S-Se solution [G250 column; with PBS (pH, 7.4; 1 mol/l) as the mobile phase].

The pure ACBP-S-Se was dried by vacuum refrigeration dryer at 35°C for 48 h, then the ACBP-S-Se particles underwent chemical structure characterization.

Fourier transform-infrared (FT-IR) spectroscopic analysis

FT-IR spectra were recorded using a Nicolet FT-IR 5700 spectrophotometer (Thermo Fisher Scientific, Inc.) at 25°C. Characterization of the components (ACBP and ACBP-S-Se) was performed and the samples were triturated with KBr at a ratio of 1:100 and pressed into pellets for FT-IR spectroscopic analysis at 500-4,000 cm-1.

X-ray photoelectron spectroscopy (XPS)

XPS (Thermo Fisher, ESCALAB 250Xi; Thermo Fisher Scientific, Inc.) was used to determine the elemental compositions of ACBP and ACBP-S-Se, for which full (pass energy, 100 eV) and high-resolution spectra (pass energy, 20 eV) were recorded.

Particle morphology

The morphology of ACBP-S-Se particles was examined by scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDX). ACBP-S-Se was carefully dried to maintain the surface structure and then mounted, sputter-coated with gold and observed under a Hitachi S-570 SEM microscope (Hitachi, Ltd.) at x200 magnification.

Carbon (13C) and hydrogen (H) nuclear magnetic resonance (NMR) spectra

H and 13C NMR spectra were recorded in deuteroxide (D2O) at 17°C using a Bruker DRX 500 spectrometer (Bruker Corporation). For each spectrum, ~1,500 transients were collected using the following acquisition parameters: 3 sec delay between pulses, 90° pulse for 5.4 µsec and 1 m sec contact time. Data were acquired and processed using Topspin 2.1 (Bruker Corporation).

Inductively coupled plasma-mass spectrometry (ICP-MS)

The Se content in ACBP-S-Se particles was determined by ICP-MS (cat. no. 7900ICP, Agilent Technologies, Inc.) as previously described (39). Following ignition, the tested elements and internal standard (10 bbp TuneA) were set according to the standard model. The parameters were as follows: Collision gas, H2/He; flow velocity, 5.5 ml/min, Co sensitivity, 20,000 counts per second/parts per billion (ppb). U signal maximum was adjusted and Se in ACBP-S-Se was measured. The amount of selenium bound to ACBP was determined as follows: nSe/nACBP=(mSe/MSe)/(mACBP/MACBP)=(CSe/MSe)/(CACBP/MACBP)= 1,228CSe/CACBP, where, n=moles, m=mass, M=molar mass, CSe=concentration of Se determined by ICP-MS and CACBP=concentration of ACBP determined by Nanodrop 2000C (Thermo Fisher Scientific, Inc.).

Drug treatment

The cell lines were pre-plated in 6-well culture dishes (Corning, Inc.) at a density of 5x105 cells/well at 37°C in a humidified chamber containing 5% CO2. Cells were cultured in RPMI-1640 (cat. no. 61870036; Invitrogen; Thermo Fisher Scientific, Inc.) growth medium or DMEM (cat. no. 10566-016, Invitrogen; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (cat. no. 16000-044; Gibco; Thermo Fisher Scientific, Inc.) and 100 U/ml P/S (cat. no. 15140-122; Gibco; Thermo Fisher Scientific, Inc.) at 37°C in a humidified chamber containing 5% CO2. When the cell confluence reached 70%, drug treatment (0, 5, 10, 20, 40 and 80 mg/ml ACBP-S-Se) was performed at 37°C for 24 h. Optimization of the ACBP-S-Se concentration was performed as previously described (40).

Cell proliferation

The proliferation of MKN-45 and MKN-74 cells following ACBP-S-Se treatment was assessed using an IncuCyte Live Cell Analysis system (ZOOM; Essen BioScience). Briefly, MKN-45 and MKN-74 cells were inoculated into 96-well plates at a density of 5x103/well and cultured at 37°C for 24 h. Following ACBP-S-Se treatment, the 96-well plates were placed in the IncuCyte Live Cell workstation and cell proliferation was recorded for 24 h at intervals of 2 h. Control groups were not treated with ACBP-S-Se (0 mg/ml); experimental groups were treated with different concentrations of ACBP-S-Se (5, 10, 20, 40 and 80 mg/ml) at 37°C for 24 h. Degree of cell fusion was counted and cell proliferation rate was calculated by IncuCyte Live Cell Analysis system.

Cell migration

The migration of MKN-45 and MKN-74 cells following ACBP-S-Se treatment was determined using an IncuCyte Live Cell workstation. Briefly, confluent MKN-45 and MKN-74 cells were inoculated into 96-well plates at a density of 5x104/well with serum-free RPMI-1640 growth medium at 37°C for 24 h. Following scratching, cells were placed in the IncuCyte Live Cell workstation and migration was recorded for 36 h at intervals of 2 h. Control groups were not treated with any additional ACBP-S-Se (0 mg/ml); experimental groups were treated with different concentrations of ACBP-S-Se (1 and 5 mg/ml) at 37°C. After the assay, the data of the scratch wound healing were calculated using IncuCyte Live Cell Analysis system.

RNA extraction and sequencing

MKN-45 cells (5x105 cells/well) were treated with ACBP-S-Se (5 mg/ml) at 37°C for 24 h, then collected to extract RNA. Total RNA was isolated and purified using TRIzol® (cat. no. 15596018; Invitrogen; Thermo Fisher Scientific, Inc.) reagent according to the manufacturer's instructions. The total RNA quantity and purity were analyzed using Agilent 2100 Bioanalyzer and RNA 1000 Nano LabChip kit (both Agilent Technologies, Inc.) with RNA integrity number >7.0. Then, ~5 ug total RNA was used to deplete ribosomal RNA using a Ribo-Zero™ rRNA Removal kit (Illumina, Inc.) according to the manufacturer's instructions. The RNAs were fragmented using divalent cations 94°C for 4 min. RNA fragments were reverse-transcribed to create cDNA, which was used to synthesize U-labeled second-stranded DNAs with E. coli DNA polymerase I, RNase H and dUTP. A-base was added to the blunt ends of each strand, preparing them for ligation to the indexed adapters. Each adapter contained a T-base over- hang for ligating the adapter to the A-tailed fragmented DNA. Single-or dual-index adapters were ligated to the fragments and size selection was performed with AMPureXP beads. Then, U-labeled second-stranded DNAs were treated with heat-labile UDG enzyme at 37°C for 10 min. The sequences of the forward and reverse primers are shown in Table I. The ligated products were amplified with PCR using primers as follows: Forward, 5'-AAT GAT ACG GCG ACC ACC GAG ATC TAC AC-3' and reverse, 5'-CAA GCA GAA GAC GGC ATA CGA GAT-3'. The thermocycling conditions were: Initial denaturation at 95°C for 3 min; 8 cycles of denaturation at 98°C for 15 sec, annealing at 60°C for 15 sec and extension at 72°C for 30 sec; and final extension at 72°C for 5 min. The average insert size for the final cDNA library was 300 bp (±50 bp). The final library concentration was determined by PCR and then multiplexed in a single sequencing lane for a final volume of 20 µl at 10 nM before sequencing. Paired-end sequencing was performed on an Illumina HiSeq 4000 according to the manufacturer's instructions.

Table I

Primers for reverse transcription-quantitative PCR.

Table I

Primers for reverse transcription-quantitative PCR.

PrimerPrimer sequence, 5'→3'
hCDKN1A-F GGGTGCGGTGATGGATAAA
hCDKN1A-R ACTGCTGAGAACAGGAAGAAC
hCCNB1-F GATGCAGAAGATGGAGCTGAT
hCCNB1-R TCCCGACCCGTGGTTTT
hTXN-F GAAGCTCTGTTTGGTGCTTTG
hTXN-R C TCGTCTGCTTCCCTCTT
hMAP3K5-F CCC AGAGAGAGACAGCAGATA
hMAP3K5-R C TCACTGAAAGAGCCCAGATAC
GAPDH-F TGAACGGGAAGCTCACTG
GAPDH-R GCTTCACCACCTTCTTGATG

[i] F, forward; R, reverse; h, human; CDKN1A, CDK inhibitor 1A; CCNB1, cyclin B1; TXN, thioredoxin; MAP3K5, mitogen-activated protein kinase kinase kinase 5.

Transcript assembly

Firstly, cutadapt-1.10 (41) (cutadapt.readthedocs.io/en/stable/) was used to remove reads that contained adapter contamination and low quality or undetermined bases. The sequence quality was verified using FastQC v0.10.1 (42) (bioinformatics.babraham.ac.uk/projects/fastqc/). Then, hisat2-2.0.4 (43) (ccb.jhu.edu/software/hisat2/) was used to map reads to the human genome GRCh38 (ftp.ensembl.org/pub/release-90/fasta/homo_sapiens/dna/Homo_sapiens.GRCh38.dna.toplevel.fa.gz) (44). All transcriptomes from samples were merged to reconstruct a comprehensive transcriptome using gffcompare (github.com/gpertea/gffcompare/). After the final transcriptome was generated, StringTie (version no. 1.2.4; ccb.jhu.edu/software/stringtie/) (44) was used to assess mRNA expression levels by calculating fragments per kilobase of transcript per million mapped reads (FPKM) (45) as follows: FPKM=total_exon_ fragments/mapped_reads (millions) x exon_length (kb).

Long non-coding (lnc)RNA identification

Transcripts that overlapped with known mRNAs and transcripts <200 bp in length were discarded. CPC0.9-r2 (46) (cpc2.cbi.pku.edu.cn/) and CNCI2.0 (47) (bioinfo.org/software/cnci) with default parameters (cpc2-inovel.fa-ocpc2.out and CNCI.py-f novel. fa-o CNCI.result-p 1-mve-g novel.gtf-d genome.fa, respectively) were used to predict transcripts with coding potential. All transcripts with cerebral performance category score <-1 and CNCI score <0 were removed and remaining transcripts were considered to be lncRNAs.

Differential expression analysis of mRNAs and lncRNAs

StringTie was used to assess expression levels of mRNAs and lncRNAs by calculating FPKM. The differentially expressed mRNAs and lncRNAs were selected with log2 (fold change) ≥1 or log2 (fold change) ≤-1 and P-value <0.05 using R package edgeR (48) (bioconductor.org/packages/release/bioc/html/edgeR.html/).

Target gene prediction and functional analysis of lncRNAs

To investigate the function of lncRNAs, the cis-target genes of lncRNAs were predicted. lncRNAs may serve a cis role acting on neighboring target genes (49,50). A total of 100,000 up- and downstream coding genes were selected by Python Script (ccb.jhu.edu/software/stringtie/) (51). Then, functional analysis of target genes for lncRNAs with Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment was performed, as previously described (52).

Reverse transcription-quantitative (RT-q)PCR

Following drug treatment (0 and 5 mg/ml ACBP) for 24 h, total RNA was extracted from cells using TRIzol® reagent (cat. no. 15596018; Invitrogen; Thermo Fisher Scientific, Inc.), and cDNA was synthesized according to the manufacturer's instructions using Prime Script™ RT reagent kit with gDNA Eraser (cat. no. RR047A; Takara Biotechnology Co., Ltd.). The concentration of ACBP was determined based on the cell proliferation rate. For PCR amplification, specific primers were designed using the National Center for Biotechnology Information website (ncbi.nlm.nih.gov) and commercially synthesized by Invitrogen (Thermo Fisher Scientific, Inc.). RT-qPCR was performed on a Thermo Pikoreal machine (Thermo Fisher Scientific, Inc.) with commercial kit (cat. no. RR820A; TB Green® Premix Ex Taq™ II; Takara Biotechnology Co., Ltd.).

PCR amplification was performed as follows: Initial denaturation cycle for 5 min at 95°C, followed by 35 cycles of denaturation at 95°C for 30 sec, annealing at 58°C for 30 sec and extension at 72°C for 30 sec. The ubiquitously expressed β-actin gene was used as an internal control. The PCR quantities were confirmed by melting curve analysis and all experiments were performed in triplicate. The relative mRNA expression was calculated using the 2-ΔΔCq method (53). The primers for RT-qPCR analysis are shown in Table I.

Statistical analysis

Statistical analysis was performed using Graphpad Prism (version no. 6.02; GraphPad Software, Inc.). Data are presented as the mean ± standard deviation of six independent repeats. Data containing two samples were analyzed using paired Student's t-test. Comparisons in data- sets containing >3 groups were evaluated by one-way ANOVA followed by Bonferroni's post hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

Determination of the chemical structure of ACBP-S-Se by UV and FT-IR spectroscopy

UV absorption value of ACBP was 203 nm (Fig. 1A). The UV absorption of selenium chelated by ACBP was notable at 206 and 210 nm. New forms of -NH and -OH were predicted. Weak absorption was observed at 220 nm, and -CNO and -C-S bond formation may have occurred. The absorption intensity of the carbonyl groups were increased because-NH and -OH are hydrophilic groups, and the λmax of UV absorption therefore increased from 0.12 to 0.62 mm (Fig. 1A and C). Compared with the maximum absorption peak of pure ACBP (λmax=206 nm), that of ACBP-S-Se (λmax=210-220 nm) was at a longer wavelength (4-14 nm). The height of the maximum absorption peak was notably increased for ACBP-S-Se. At 210-220 nm, there were two high absorption peaks, which represented the characteristic absorption peaks of -C=O, -NH and -OH in-RCONHR'. Secondary amide functional groups may have also existed in the product following sulfhydrylation and deacetylation of ACBP. From the FT-IR analysis, distinction between the two maps (ACBP and ACBP-S-Se) was notable, indicating that the ACBP-S-Se curve represented the formation of a new substance that differed from ACBP (Fig. 1B). In the ACBP-S-Se curve, vibrational peaks of the Se-Se bond were observed at 535 and 640 cm-1, and absorption peaks of the C-Se bond were observed at 736.8, 721.0 and 775.0 cm-1. Moreover, the unique absorption peak of Se occurred at 2,336 cm-1, the characteristic absorption peak of-SH occurred at 2,600 cm-1 and those of secondary amides occurred at 3,391.0, 1,585.5 and 1,406.2 cm-1. These peaks differed from those in the ACBP curve as the absorption strength was enhanced. These results indicated that ACBP bound with Se to form ACBP-S-Se, and the ACBP chain was linked with sulfhydryl groups by amide bonds to form the ACBP-chelated selenium complex.

Figure 1

ACBP was characterized by UV, FT-IR and 13C and H NMR. (A) UV spectroscopy of ACBP. (B) FT-IR spectroscopy results of ACBP and ACBP-S-Se. (C) UV spectroscopy of ACBP-S-Se. (D) 13C and H NMR results of ACBP and ACBP-S-Se. UV, ultraviolet; FT-IR, Fourier transform-infrared; NMR, nuclear magnetic resonance; ACBP-S-Se, anticancer bioactive peptide functionalized selenium.

Determination of ACBP-S-Se chemical structure by 13C and H NMR

In the H NMR spectra, absorption peaks of -OH, -NH and -SH were detected at the attachments of δ2.31, δ6~8.2 and δ1.43, respectively (Fig. 1D). At the same time, different absorption peaks and chemical shifts were observed. In the ACBP spectra, the absorption peak δ2.31 of -OH was shifted to δ2.1 in the ACBP-S-Se spectra. The δ2.93 of -SH-SH absorption peak was observed in the ACBP-S-Se spectra, while no absorption peak of -SH-SH was observed in the ACBP spectra. In the 13C NMR spectra, absorption peaks of CHO and -C-S at δ100 and absorption peaks of different degrees were simultaneously observed. The absorption peak of -Se-C was detected at δ180 with weak absorption peak in the ACBP-S-Se spectra, but no absorption peak of -Se-C was observed in the ACBP spectra. These results showed that binding occurred between the bioactive polypeptide and Se to different extents, and the molecular structure of ACBP-S-Se was thus inferred.

Determination of ACBP-S-Se chemical structure by XPS

Both ACBP and ACBP-S-Se exhibited significant differences in all four peaks in the XPS spectra: C 1s (284-285 eV), N 1s (399-400 eV), S 2p (166.80-167.57 eV) and Se 3d (55-60 eV; Table II; Fig. 2). As determined by the XPS spectra of nitrogen, the binding energy decreased from 399.65 eV for ACBP and to 399.02 eV for ACBP-S-Se. However, as determined by the XPS spectra of sulfur, the binding energy increased from 166.8 eV for ACBP and up to 167.57 eV for ACBP-S-Se. Additionally, the binding energy of Se formed at 56.2 eV in ACBP-S-Se and a new-SH=Se bond in ACBP-S-Se was formed, resulting in increased electronegativity of Se 3d and binding energy.

Figure 2

Elemental characterization of ACBP by XPS. XPS results of ACBP-S-Se, including C, N, O, S and Se elements. ACBP-S-Se, anticancer bioactive peptide functionalized selenium; XPS, X-ray photoelectron spectroscopy; CPS, counts per second.

Table II

Assignment of the primary special bands in ACBP-S-Se based on binding energy.

Table II

Assignment of the primary special bands in ACBP-S-Se based on binding energy.

ElementACBP/eVACBP-S-Se/eVAssignment
C 1s284.70284.87C-C
N 1s399.65399.02NH2, NH3+
S 2p166.80167.57 NO2SO3, K2SO3, pNH2C6H4SO2C6H4NH2+
Se 3d-56.20-SH=Se

[i] ACBP-S-Se, anticancer bioactive peptide functionalized selenium.

SEM-EDX observation and ICP-MS of ACBP-S-Se

ACBP exhibited a coarse fibrous morphological structure (Fig. 3A). According to the morphological analysis of ACBP-S-Se, the particle structure exhibited an average uneven grain that was 5 µm in diameter (Fig. 3C). Compared with ACBP, ACBP-S-Se exhibited decreased distribution of elements C, N and O but increased distribution of Se and S (Fig. 3B and D).

Figure 3

Morphological characterization of ACBP by SEM and EDX. (A) SEM and EDX results (distribution of elements C, N, O, Se, S) and (B) elemental content of ACBP following vacuum freeze-drying. (C) SEM and EDX results (distribution of elements C, N, O, Se, S) and (D) elemental content of ABCP-S-Se. ACBP-S-Se, anticancer bioactive peptide functionalized selenium; SEM, scanning electron microscopy; EDX, energy dispersive X-ray spectroscopy.

Se content reached up to 0.28% (Fig. 3D). The Se content was 829.030 He/ppb at an ACBP to Se ratio of 2:1 (Table III). The mole ratio of Se content in the ACBP molecule was 2.1.

Table III

Concentration of selenium in ACBP chelate selenium as determined by inductively coupled plasma-mass spectrometry.

Table III

Concentration of selenium in ACBP chelate selenium as determined by inductively coupled plasma-mass spectrometry.

SampleSelenium concentration, Se(He)/ppbACBP concentration, mg/mlRSDnSe/nACBP
ACBP:Se (2:1)829.030.050.32.1

[i] ACBP-S-Se, anticancer bioactive peptide functionalized selenium; RSD, relative standard deviation.

Inhibitory effect of ACBP-S-Se on tumor cell lines

Proliferation of MKN-45 and MKN-74 cells was inhibited following treatment with ACBP-S-Se and the number of cells were inhibited in a dose-dependent manner (Fig. 4A and B). The inhibition of MKN-45 and MKN-74 cell proliferation was not notably different as ACBP-S-Se concentration increased from 5 to 80 mg/ml.

Figure 4

ACBP-S-Se inhibits MKN-45 and MKN-74 cell proliferation. The proliferation of (A) MKN-45 and (B) MKN-74 cells following treatment with ACBP-S-Se was detected using the IncuCyte live cell workstation. Wound healing ability of (C) MKN-45 and (D) MKN-74 cells treated with different concentrations of ACBP-S-Se were detected using the IncuCyte live cell workstation and wound scratch assay. Wound healing assay using (E) MKN-45 and (F) MKN-74 cells. ACBP-S-Se (0 mg/ml) was used as the control. Magnification, x10. ACBP-S-Se, anticancer bioactive peptide functionalized selenium.

The wound healing ability of MKN-45 and MKN-74 cells decreased following treatment with ACBP-S-Se in a dose-dependent manner (Fig. 4C and D). These results indicated that ACBP-S-Se at concentrations from 1 to 5 mg/ml inhibited cell migration (Fig. 4E and F).

Functional gene selection

Functional gene analysis revealed 911 up- and 1,122 downregulated genes following ACBP-S-Se treatment in MKN-45 cells. The screening results and enrichment analysis of OS-associated genes are shown in Table IV.

Table IV

Screening and enrichment analysis of oxidative stress-associated genes.

Table IV

Screening and enrichment analysis of oxidative stress-associated genes.

Classification Characterization
GO:0006979Response to oxidative stress
GO:0008631Intrinsic apoptotic signaling pathway in response to oxidative stress
GO:0034599Cellular response to oxidative stress
GO:0036475Neuron death in response to oxidative stress
GO:0043619Regulation of transcription from RNA polymerase II promoter in response to oxidative stress
GO:0097193Intrinsic apoptotic signaling pathway
GO:1900407Regulation of cellular response to oxidative stress
GO:1900408Negative regulation of cellular response to oxidative stress
GO:1902175Regulation of oxidative stress-induced intrinsic apoptotic signaling pathway
GO:1902176Negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway
GO:1902882Regulation of response to oxidative stress
GO:1902883Negative regulation of response to oxidative stress
GO:1903202Negative regulation of oxidative stress-induced cell death
GO:1903204Negative regulation of oxidative stress-induced neuron death
GO:1903376Regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway
GO:1903377Negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway
hsa04068FoxO signaling pathway
hsa04115p53 signaling pathway

From the functional enrichment analysis of OS-associated genes, a total of 75 genes with significant differences were selected (Fig. 5A). From the gene interaction mapping, CDK inhibitor 1A (CDKN1A), cyclin B1 (CCNB1), thioredoxin (TXN) and mitogen-activated protein kinase kinase kinase 5 (MAP3K5) were extracted based on the roles of genes with which they were associated and the significantly enriched pathways, which were used for TCGA analysis (Fig. 5B).

Figure 5

Functional enrichment and oxidative stress-associated genes of anticancer bioactive peptide functionalized selenium. (A) Functional enrichment and association network diagrams of oxidative stress-associated genes (colors represent functions; larger dots indicate more enriched genes; thicker lines indicate more genes with the same function). (B) Interaction of oxidative stress-associated genes (points represent genes; larger circles indicate more genes). GO, Gene Ontology.

According to the interaction of genes associated with OS and lncRNAs, networks of OS genes and lncRNA interactions (lncRNA FPKM>5) were constructed via lncRNA trans and cis analysis (TRANS_ENERGY<-50; Fig. 6A). The results showed that the network contained 55 genes associated with OS and 37 lncRNAs.

Figure 6

Expression of oxidative stress-associated genes and lncRNAs in normal and primary tumors. (A) Interaction of genes and lncRNAs associated with oxidative stress. Expression levels of (B) CDKN1A, (C) CCNB1, (D) MAP3K5 and (E) TXN in STAD based on TCGA samples (normal and primary tumors). lnc, long non-coding; CDKN1A, CDK inhibitor 1A; CCNB1, cyclin B1; MAP3K5, mitogen-activated protein kinase kinase kinase 5; TXN, thioredoxin; STAD, stomach adenocarcinoma; TCGA, The Cancer Genome Atlas.

The selected lncRNAs included MSTRG.13268.2, ENST00000508832, ENST00000580180, ENST00000454068, ENST00000607476, ENST00000504539, ENST00000326677, ENST00000448718, ENST00000531126 and MSTRG.5031.1. Expression levels of the four selected OS-associated genes in The Cancer Genome Atlas (TCGA) were assessed. Expression of CDKN1A increased following treatment with ACBP-S-Se but was lower in tumor samples than in paracancerous samples (Fig. 6B; Table V). The expression of the other three genes decreased following treatment with ACBP-S-Se and was lower in tumor samples than in paracancerous samples, however this was not significantly different.

Table V

Expression levels of CDKN1A, CCNB1, MAP3K5 and TXN under oxidative stress in The Cancer Genome Atlas.

Table V

Expression levels of CDKN1A, CCNB1, MAP3K5 and TXN under oxidative stress in The Cancer Genome Atlas.

GeneMKN-45-ACBPMKN-45FClog2(FC)Regulation
CDKN1A264.779.5525.924.70Up
CCNB18.9925.890.33-1.62Down
MAP3K50.992.940.32-1.66Down
TXN38.7474.240.49-1.03Down

[i] CDKN1A, CDK inhibitor 1A; CCNB1, cyclin B1; MAP3K5, mitogen-activated protein kinase kinase kinase 5; TXN, thioredoxin.

Relative gene expression levels

CDKN1A, CCNB1, TXN and MAP3K5 gene expression levels in GES-1, MKN-45 and MKN-74 cells were analyzed by RT-qPCR (Fig. 7). In GES-1, MKN-45 and MKN-74 cells, the gene expression levels of CDKN1A and TXN were significantly increased following ACBP-S-Se treatment compared with the control. In addition, the gene expression levels of CDKN1A and TXN in GES-1 cells were significantly different between the control and ACBP-S-Se treatment groups; however, the gene expression levels of MAP3K5 were significantly increased in MKN-45 but decreased in MKN-74 cells following ACBP-S-Se treatment. The results indicated that CDKN1A and TXN protected cells with decrease OS and inhibited cell growth.

Figure 7

Expression of hCDKN1A, hCCNB1, hTXN and hMAP3K5 detected by RT-qPCR. The relative hCDKN1A, hCCNB1, hTXN and hMAP3K5 gene expression levels following treatment with 5 mg/ml ACBP-S-Se were detected by RT-qPCR. ACBP-S-Se (0 mg/ml) was used as the control. *P<0.05 vs. control. RT-q, reverse transcription-quantitative; h, human; CDKN1A, CDK inhibitor 1A; CCNB1, cyclin B1; MAP3K5, mitogen-activated protein kinase kinase kinase 5; TXN, thioredoxin; ACBP-S-Se, anticancer bioactive peptide functionalized selenium.

Discussion

GC is a threat to human health worldwide; each year ~990,000 people are diagnosed with GC worldwide, of whom ~738,000 die from this disease (54). A previous study demonstrated that ACBP combined with oxaliplatin significantly inhibits proliferation of MKN-45 cells (35). Recently, the replacement of peptides with chemical modifications to achieve the same therapeutic effects as their natural peptide counterparts in combined chemotherapeutics has been developed (55). Furthermore, the incorporation of the Se atom into amino acids and peptides is primarily restricted to selenocysteine derivatives (56) and there is a need to develop synthesis of amino acid-derived chiral Se compounds for evaluation of antioxidant, antihypertensive, anti-inflammatory and immunomodulatory effects (56). Here, ACBP was modified by sulfhydrylation and combined with Se to form ACBP-chelated Se, and its properties and inhibitory effect on GC cells in vitro were investigated.

FT-IR, XPS, 13C and H NMR, SEM, EDX and ICP-MS analysis demonstrated that new functional groups were formed, such as -C-Se, Se-Se, -SH=Se and -CONH. ICP-MS is used to determine the single elements and perform multielement analysis of synthetic drugs (39). The higher content of Se in ACBP-S-Se than in ACBP may indicate that Se was successfully incorporated into the molecular chain of ACBP. Moreover, Se is a trace element that is beneficial to humans depending on its concentration and chemical speciation (57,58). The mechanism underlying the synthesis of ACBP, S-SAMS and sodium selenite are shown in Fig. 8. Studies have shown that different Se compounds decrease cancer growth, thus serving as potential anticancer drugs (59,60). Se deficiency has been shown to increase cell apoptosis and decrease viability; Se supplementation may mitigate these alterations (28). The present study showed that ACBP-S-Se at 5 mg/ml effectively inhibited proliferation of MKN-45 and MKN-74 cells. In addition, the wound healing ability of MKN-45 and MKN-74 cells following ACBP-S-Se treatment decreased.

Figure 8

Mechanism of ACBP, S-SAMS and sodium selenite synthesis. ACBP was subjected to sulfhydrylation modification by S-AMSA and then underwent chelation reactions with sodium selenite. ACBP-S-Se, anticancer bioactive peptide functionalized selenium; S-AMSA, S-acetylmercaptosuccinic anhydride.

Selenocysteine has high glutathione peroxidase activity and can clear free radicals in the human body (61). Although several functions of selenoproteins are unknown, many disorders are associated with alterations in selenoprotein expression levels or activity (62). Selenium insufficiency and polymorphisms or mutations in genes encoding selenoproteins and synthesis cofactors are involved in the pathophysiology of numerous diseases, including immune disease, GC and colorectal cancer (31). From the perspective of using OS to investigate the competing endogenous RNA mechanism of ACBP-S-Se in the treatment of GC, it is necessary to determine expression changes in OS-associated genes following ACBP-S-Se treatment. Here, analysis of OS-associated pathways and genes resulted in detection of functional genes.

Among these genes, those that were downregulated were determined to encode selenoproteins. Furthermore, Se-specific effects are caused primarily by Se deficiency, rather than high Se levels (63). A total of 75 genes with significantly different functional enrichment were selected, and CDKN1A, CCNB1, TXN and MAP3K5 were selected from the gene interaction map. CDKN1A (also known as p21), a cell cycle-dependent kinase suppressor molecule, protect cells from OS damage (64). CCNB1 also inhibits certain factors in the ubiquitin (Ub) proteasome (65). For example, hydrogen peroxide prevents Ub from binding to late-promoting complex (anaphase-promoting complex/cyclosome) substrates, which prevents the degradation of CCNB1 and thus inhibited cell proliferation caused by OS. Increased CCNB1 expression has been observed in several types of cancer (66); for example, the expression of CCNB1 in GC tissue is higher than that in normal gastric tissue (67). However, ACBP-S-Se treatment decreased expression levels of CCNB1 in MKN-45 and MKN-74 cells. TXN serves an important role in cellular antioxidant defense (67,68). MAP3K5, also known as apoptotic signal-regulated kinase 1, regulates the biological and physiological processes of apoptosis, immunity and gastric emptying by regulating the flow of apoptotic kinases (69,70). Furthermore, MAP3K5, which is activated in response to stress signals, serves an important role in OS regulation, cell proliferation, differentiation and death and immune response (71). It has been shown that a molecular target of ROS, TXN (also known as Trx), is an inhibitor of MAP3K5 (72). Moreover, oxidation via ROS disrupts the binding of Trx to MAP3K5, resulting in apoptosis (73). The present results showed that formation of ACBP-S-Se negatively regulated MAP3K5 activity, thus attenuating the proapoptotic signal in MKN-74 cells. Inhibition of apoptosis via this mechanism results in increased proliferation and survival, thereby increasing the likelihood of tumorigenesis and/or metastasis. Therefore, OS is associated with the occurrence and development of cancer. OS results in cell apoptosis/death, stressors alter micro (mi)RNA expression level profiles and miRNAs serve a role in the cell response to stress (38).

In summary, the application of sulfhydrylation and deacetylation is an effective method to enhance the chelating efficiency of ACBP and Se. According to the UV, FT-IR and 13C NMR, H NMR, XPS, EDX and ICP-MS analysis, Se was chelated to ACBP via sulfhydrylation; the sulfhydryl group was used as the binding site of Se and increased chelation. Finally, the results suggested that ACBP-S-Se effectively inhibited MKN-45 and MKN-74 cell proliferation and migration in vitro and may have clinical applications.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

XL, XWa, GL, YX and XS analyzed and interpreted the data. RY, FJ, CS and XWu performed the experiments. XL wrote the manuscript. All authors read and approved the final manuscript. XL and XS confirm the authenticity of all the raw data.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Acknowledgments

Not applicable.

References

1 

Moloney JN and Cotter TG: ROS signalling in the biology of cancer. Semin Cell Dev Biol. 80:50–64. 2018. View Article : Google Scholar

2 

Huang T, Wang-Johanning F, Zhou F, Kallon H and Wei Y: MicroRNAs serve as a bridge between oxidative stress and gastric cancer (Review). Int J Oncol. 49:1791–1800. 2016. View Article : Google Scholar : PubMed/NCBI

3 

Ismail T, Kim Y, Lee H, Lee DS and Lee HS: Interplay between mitochondrial peroxiredoxins and ROS in cancer development and progression. Int J Mol Sci. 20:44072019. View Article : Google Scholar :

4 

Zhang P, Shi L, Zhang T, Hong L, He W, Cao P, Shen X, Zheng P, Xia Y and Zou P: Piperlongumine potentiates the antitumor efficacy of oxaliplatin through ROS induction in gastric cancer cells. Cell Oncol (Dordr). 42:847–860. 2019. View Article : Google Scholar

5 

Gu H, Huang T, Shen Y, Liu Y, Zhou F, Jin Y, Sattar H and Wei Y: Reactive oxygen species-mediated tumor microenvironment transformation: The mechanism of radioresistant gastric cancer. Oxid Med Cell Longev. 2018:58012092018. View Article : Google Scholar : PubMed/NCBI

6 

Yu Y, Cui Y, Niedernhofer LJ and Wang Y: Occurrence, biological consequences, and human health relevance of oxidative stress-induced DNA damage. Chem Res Toxicol. 29:2008–2039. 2016. View Article : Google Scholar : PubMed/NCBI

7 

Bao B, Azmi AS, Li Y, Ahmad A, Ali S, Banerjee S, Kong D and Sarkar FH: Targeting CSCs in tumor microenvironment: The potential role of ROS-associated miRNAs in tumor aggressiveness. Curr Stem Cell Res Ther. 9:22–35. 2014. View Article : Google Scholar

8 

Fuloria S, Subramaniyan V, Karupiah S, Kumari U, Sathasivam K, Meenakshi DU, Wu YS, Sekar M, Chitranshi N and Malviya R: Comprehensive review of methodology to detect reactive oxygen species (ROS) in mammalian species and establish its relationship with antioxidants and cancer. Antioxidants (Basel). 10. pp. 1282021, View Article : Google Scholar

9 

Choudhari SK, Chaudhary M, Gadbail AR, Sharma A and Tekade S: Oxidative and antioxidative mechanisms in oral cancer and precancer: A review. Oral Oncol. 50:10–18. 2014. View Article : Google Scholar

10 

Kruk J and Aboul-Enein HY: Reactive oxygen and nitrogen species in carcinogenesis: Implications of oxidative stress on the progression and development of several cancer types. Mini. Rev Med Chem. 17:904–919. 2017.

11 

Panhwar A, Tuzen M and Kazi T: Ultrasonic assisted dispersive liquid-liquid microextraction method based on deep eutectic solvent for speciation, preconcentration and determination of selenium species (IV) and (VI) in water and food samples. Talanta. 175:352–358. 2017. View Article : Google Scholar : PubMed/NCBI

12 

Zachariah M, Maamoun H, Milano L, Rayman MP, Meira LB and Agouni A: Endoplasmic reticulum stress and oxidative stress drive endothelial dysfunction induced by high selenium. J Cell Physiol. 236:4348–4359. 2021. View Article : Google Scholar

13 

Cai X, Wang C, Yu W, Fan W, Wang S, Shen N, Wu P, Li X and Wang F: Selenium exposure and cancer risk: An updated meta-analysis and meta-regression. Sci Rep. 6:192132016. View Article : Google Scholar : PubMed/NCBI

14 

Gheorghiu ML and Badiu C: Selenium involvement in mitochondrial function in thyroid disorders. Hormones (Athens). 19:25–30. 2020. View Article : Google Scholar

15 

Liu Q, Zhao X, Ma J, Mu Y, Wang Y, Yang S, Wu Y, Wu F and Zhou Y: Selenium (Se) plays a key role in the biological effects of some viruses: Implications for COVID-19. Environ Res. 196:1109842021. View Article : Google Scholar : PubMed/NCBI

16 

Peng H, Zhang N, He M, Chen B and Hu B: Simultaneous speciation analysis of inorganic arsenic, chromium and selenium in environmental waters by 3-(2-aminoethylamino) propyltrimethoxysilane modified multi-wall carbon nanotubes packed microcolumn solid phase extraction and ICP-MS. Talanta. 131:266–272. 2015. View Article : Google Scholar

17 

Colangelo LA, He K, Whooley MA, Daviglus ML, Morris S and Liu K: Selenium exposure and depressive symptoms: The coronary artery risk development in young adults trace element study. Neurotoxicology. 41:167–174. 2014. View Article : Google Scholar : PubMed/NCBI

18 

Zhang N, Fu N, Fang Z, Feng Y and Ke L: Simultaneous multi-channel hydride generation atomic fluorescence spectrometry determination of arsenic, bismuth, tellurium and selenium in tea leaves. Food Chem. 124:1185–1188. 2011. View Article : Google Scholar

19 

Achilli C, Ciana A and Minetti G: Brain, immune system and selenium: A starting point for a new diagnostic marker for Alzheimer's disease? Perspect Public Health. 138:223–226. 2018. View Article : Google Scholar : PubMed/NCBI

20 

Avery JC and Hoffmann PR: Selenium, selenoproteins, and immunity. Nutrients. 10:12032018. View Article : Google Scholar :

21 

Guo CH, Hsia S, Hsiung DY and Chen PC: Supplementation with Selenium yeast on the prooxidant-antioxidant activities and anti-tumor effects in breast tumor xenograft-bearing mice. J Nutr Biochem. 26:1568–1579. 2015. View Article : Google Scholar : PubMed/NCBI

22 

Li B, Li W, Tian Y, Guo S, Qian L, Xu D and Cao N: Selenium-alleviated hepatocyte necrosis and DNA damage in cyclophosphamide-treated geese by mitigating oxidative stress. Biol Trace Elem Res. 193:508–516. 2020. View Article : Google Scholar

23 

Salonen JT: Selenium and human cancer. Ann Clin Res. 18:18–21. 1986.PubMed/NCBI

24 

Vinceti M, Filippini T, Cilloni S and Crespi CM: The epidemiology of selenium and human cancer. Adv Cancer Res. 136:1–48. 2017. View Article : Google Scholar : PubMed/NCBI

25 

Sun C, Wang L, Xianyu B, Li T, Gao S and Xu H: Selenoxide elimination manipulate the oxidative stress to improve the anti-tumor efficacy. Biomaterials. 225:1195142019. View Article : Google Scholar

26 

Wang Y, Liu X, Deng G, Sun J, Yuan H, Li Q, Wang Q and Lu J: Se@SiO2-FA-CuS nanocomposites for targeted delivery of DOX and nano selenium in synergistic combination of chemophotothermal therapy. Nanoscale. 10:2866–2875. 2018. View Article : Google Scholar : PubMed/NCBI

27 

Hoffmann PR and Berry MJ: The influence of selenium on immune responses. Mol Nutr Food Res. 52:1273–1280. 2008. View Article : Google Scholar : PubMed/NCBI

28 

Zoidis E, Seremelis I, Kontopoulos N and Danezis GP: Selenium-dependent antioxidant enzymes: Actions and proper- ties of selenoproteins. Antioxidants (Basel). 7. pp. 662018, View Article : Google Scholar

29 

Khoso PA, Yang Z, Liu C and Li S: Selenium deficiency down- regulates selenoproteins and suppresses immune function in chicken thymus. Biol Trace Elem Res. 167:48–55. 2015. View Article : Google Scholar : PubMed/NCBI

30 

Khoso PA, Yang Z, Liu C and Li S: Selenoproteins and heat shock proteins play important roles in immunosuppression in the bursa of Fabricius of chickens with selenium deficiency. Cell Stress Chaperones. 20:967–978. 2015. View Article : Google Scholar : PubMed/NCBI

31 

Zakharia Y, Bhattacharya A and Rustum YM: Selenium targets resistance biomarkers enhancing efficacy while reducing toxicity of anti-cancer drugs: Preclinical and clinical development. Oncotarget. 9:10765–10783. 2018. View Article : Google Scholar : PubMed/NCBI

32 

Cao S, Durrani FA, Tóth K and Rustum YM: Se-methylselenocysteine offers selective protection against toxicity and potentiates the antitumour activity of anticancer drugs in preclinical animal models. Br J Cancer. 110:1733–1743. 2014. View Article : Google Scholar : PubMed/NCBI

33 

Yang Y, Liu N, Deng Y, Zeng Y, Pei J, Bao H and Liu L: A kind of whey protein peptide with antioxidant activity-selenium chelate and its preparation method and application. Patent CN108893514A. Filed July 20, 2018; issued November 27, 2018.

34 

Zhang C, Jia S and Su X: Effect of anticancer bioactive peptide on the gene expression of human gastric cancer BGC-823 cells. PLoS One. 9:e1026732014.

35 

Li X, Wu H, Ouyang X, Zhang B and Su X: New bioactive peptide reduces the toxicity of chemotherapy drugs and increases drug sensitivity. Oncol Rep. 38:129–140. 2017. View Article : Google Scholar : PubMed/NCBI

36 

Cordeau E, Cantel S, Gagne D, Lebrun A, Martinez J, Subra G and Enjalbal C: Selenazolidine: A selenium containing proline surrogate in peptide science. Org Biomol Chem. 14:8101–8108. 2016. View Article : Google Scholar : PubMed/NCBI

37 

Xia Y, You P, Xu F, Liu J and Xing F: Novel functionalized selenium nanoparticles for enhanced anti-hepatocarcinoma activity in vitro. Nanoscale Res Lett. 10:10512015. View Article : Google Scholar : PubMed/NCBI

38 

Nie L, Zhang P and Wang Q, Zhou X and Wang Q: lncRNA-triggered macrophage inflammaging deteriorates age-related diseases. Mediators Inflamm. 2019:42603092019. View Article : Google Scholar

39 

Mittal M, Kumar K, Anghore D and Rawal RK: ICP-MS: Analytical method for identification and detection of elemental impurities. Curr Drug Discov Technol. 14:106–120. 2017. View Article : Google Scholar

40 

Li X, Xia L, Ouyang X, Suyila Q, Su L and Su X: Bioactive peptides sensitize cells to anticancer effects of oxaliplatin in human colorectal cancer xenografts in nude mice. Protein Pept Lett. 26:512–522. 2019. View Article : Google Scholar : PubMed/NCBI

41 

Kechin A, Boyarskikh U, Kel A and Filipenko M: Cutadapt removes adapter sequences from high-throughput sequencing reads. J Comput Biol. 24:1138–1143. 2017. View Article : Google Scholar : PubMed/NCBI

42 

Beekman R, Chapaprieta V, Russiñol N, Vilarrasa-Blasi R, Verdaguer-Dot N, Martens JHA, Duran-Ferrer M, Kulis M, Serra F, Javierre BM, et al: The reference epigenome and regulatory chromatin landscape of chronic lymphocytic leukemia. Nat Med. 24:868–880. 2018. View Article : Google Scholar : PubMed/NCBI

43 

Kim D, Langmead B and Salzberg SL: HISAT: A fast spliced aligner with low memory requirements. Nat Methods. 12:357–360. 2015. View Article : Google Scholar : PubMed/NCBI

44 

Pertea M, Pertea GM, Antonescu CM, Chang TC, Mendell JT and Salzberg SL: StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat Biotechnol. 33:290–295. 2015. View Article : Google Scholar : PubMed/NCBI

45 

Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ, Salzberg SL, Wold BJ and Pachter L: Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol. 28:511–515. 2010. View Article : Google Scholar : PubMed/NCBI

46 

Kong L, Zhang Y, Ye ZQ, Liu XQ, Zhao SQ, Wei L and Gao G: CPC: Assess the protein-coding potential of transcripts using sequence features and support vector machine. Nucleic Acids Res. 35(Web Server Issue): W345–W349. 2007. View Article : Google Scholar : PubMed/NCBI

47 

Sun L, Luo H, Bu D, Zhao G, Yu K, Zhang C, Liu Y, Chen R and Zhao Y: Utilizing sequence intrinsic composition to classify protein-coding and long non-coding transcripts. Nucleic Acids Res. 41:e1662013. View Article : Google Scholar : PubMed/NCBI

48 

Robinson MD, McCarthy DJ and Smyth GK: edgeR: A bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 26:139–140. 2010. View Article : Google Scholar

49 

Stewart GL, Sage AP, Enfield KSS, Marshall EA, Cohn DE and Lam WL: Deregulation of a Cis-acting lncRNA in non-small cell lung cancer may control HMGA1 expression. Front Genet. 11:6153782021. View Article : Google Scholar :

50 

Statello L, Guo CJ, Chen LL and Huarte M: Gene regulation by long non-coding RNAs and its biological functions. Nat Rev Mol Cell Biol. 22:96–118. 2021. View Article : Google Scholar

51 

Shi T, Hu W, Hou H, Zhao Z, Shang M and Zhang L: Identification and comparative analysis of long non-coding RNA in the skeletal muscle of two dezhou donkey strains. Genes. 11:5082020. View Article : Google Scholar :

52 

Young MD, Wakefield MJ, Smyth GK and Oshlack A: Gene ontology analysis for RNA-seq: Accounting for selection bias. Genome Biol. 11:R142010. View Article : Google Scholar : PubMed/NCBI

53 

Liu G, Li S, Yuan H, Hao M, Wurihan, Yun Z, Zhao J, Ma Y and Dai Y: Effect of sodium alginate on mouse ovary vitrification. Theriogenology. 113:78–84. 2018. View Article : Google Scholar : PubMed/NCBI

54 

Ferlay J, Shin HR, Bray F, Forman D, Mathers C and Parkin DM: Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J Cancer. 127:2893–2917. 2010. View Article : Google Scholar

55 

Bolhassani A: Improvements in chemical carriers of proteins and peptides. Cell Biol Int. 43:437–452. 2019. View Article : Google Scholar : PubMed/NCBI

56 

Zhang X, He H, Xiang J, Yin H and Hou T: Selenium-containing proteins/peptides from plants: A review on the structures and functions. J Agric Food Chem. 68:15061–15073. 2020. View Article : Google Scholar : PubMed/NCBI

57 

Castro Grijalba A, Fiorentini EF and Wuilloud RG: Ionic liquid-assisted separation and determination of selenium species in food and beverage samples by liquid chromatography coupled to hydride generation atomic fluorescence spectrometry. J Chromatogr A. 1491:117–125. 2017. View Article : Google Scholar : PubMed/NCBI

58 

Pedrero Z and Madrid Y: Novel approaches for selenium speciation in foodstuffs and biological specimens: A review. Anal Chim Acta. 634:135–152. 2009. View Article : Google Scholar : PubMed/NCBI

59 

Fu X, Yang Y, Li X, Lai H, Huang Y, He L, Zheng W and Chen T: RGD peptide-conjugated selenium nanoparticles: Antiangiogenesis by suppressing VEGF-VEGFR2-ERK/AKT pathway. Nanomedicine. 12:1627–1639. 2016. View Article : Google Scholar : PubMed/NCBI

60 

Pang KL and Chin KY: Emerging anticancer potentials of selenium on osteosarcoma. Int J Mol Sci. 20:53182019. View Article : Google Scholar :

61 

Luo G, Sun Y, Lu S, Mou Y and Yan G: Selenium-containing poly- peptide and its use in medicine, food etc. Patent CN1603338A. Filed August 24, 2004; issued April 6, 2005.

62 

Hughes DJ, Kunická T, Schomburg L, Liška V, Swan N and Souček P: Expression of selenoprotein genes and association with selenium status in colorectal adenoma and colorectal cancer. Nutrients. 10:18122018. View Article : Google Scholar :

63 

Sunde RA and Raines AM: Selenium regulation of the selenoprotein and nonselenoprotein transcriptomes in rodents. Adv Nutr. 2:138–150. 2011. View Article : Google Scholar :

64 

Lalem T, Zhang L, Scholz M, Burkhardt R, Saccheti V, Teren A, Thiery J and Devaux Y: Cardiolinc™ network (http://www.cardiolinc.orgurisimplewww.cardiolinc.org): Cyclin dependent kinase inhibitor 1 C is a female-specific marker of left ventricular function after acute myocardial infarction. Int J Cardiol. 274:319–325. 2019. View Article : Google Scholar

65 

He J, Yu S, Guo C, Tan L, Song X, Wang M, Wu J, Long Y, Gong D, Zhang R, et al: Polyphyllin I induces autophagy and cell cycle arrest via inhibiting PDK1/Akt/mTOR signal and down- regulating cyclin B1 in human gastric carcinoma HGC-27 cells. Biomed Pharmacother. 117:1091892019. View Article : Google Scholar

66 

Chen EB, Qin X, Peng K, Li Q, Tang C, Wei YC, Yu S, Gan L and Liu TS: HnRNPR-CCNB1/CENPF axis contributes to gastric cancer proliferation and metastasis. Aging (Albany NY). 11:7473–7491. 2019. View Article : Google Scholar

67 

Hanschmann EM and Berndt C: Thioredoxin (TXN). Encyclopedia of Signaling Molecules. Choi S: Springer; Cham: 2018, View Article : Google Scholar

68 

Yang J, Hamid S, Cai J, Liu Q, Xu S and Zhang Z: Selenium deficiency-induced thioredoxin suppression and thioredoxin knock down disbalanced insulin responsiveness in chicken cardiomyocytes through PI3K/Akt pathway inhibition. Cell Signal. 38:192–200. 2017. View Article : Google Scholar : PubMed/NCBI

69 

Pu L, Zhang LC, Zhang JS, Song X, Wang LG, Liang J, Zhang YB, Liu X, Yan H, Zhang T, et al: Porcine MAP3K5 analysis: Molecular cloning, characterization, tissue expression pattern, and copy number variations associated with residual feed intake. Genet Mol Res. 15:2016. View Article : Google Scholar

70 

Pressinotti NC, Klocker H, Schäfer G, Luu VD, Ruschhaupt M, Kuner R, Steiner E, Poustka A, Bartsch G and Sültmann H: Differential expression of apoptotic genes PDIA3 and MAP3K5 distinguishes between low- and high-risk prostate cancer. Mol Cancer. 8:1302009. View Article : Google Scholar : PubMed/NCBI

71 

Golz S, Brüggemeier U and Geerts A: Diagnostics and therapeutics for diseases associated with mitogen-activated protein kinase kinase kinase 5 (map3k5). FR Patent WO2005114199A1. Filed April 30, 2005, issued December 1, 2005.

72 

Tzeng HE, Tsai CH, Chang ZL, Su CM, Wang SW, Hwang WL and Tang CH: Interleukin-6 induces vascular endothelial growth factor expression and promotes angiogenesis through apoptosis signal-regulating kinase 1 in human osteosarcoma. Biochem Pharmacol. 85:531–540. 2013. View Article : Google Scholar

73 

Prickett TD, Zerlanko B, Gartner JJ, Parker SCJ, Dutton-Regester K, Lin JC, Teer JK, Wei X, Jiang J; Nisc Comparative Sequencing Program; et al: Somatic mutations in MAP3K5 attenuate its proapoptotic function in melanoma through increased binding to thioredoxin. J Invest Dermatol. 134:452–460. 2014. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li X, Wang X, Liu G, Xu Y, Wu X, Yi R, Jin F, Sa C and Su X: Antioxidant stress and anticancer activity of peptide‑chelated selenium <em>in vitro</em>. Int J Mol Med 48: 153, 2021.
APA
Li, X., Wang, X., Liu, G., Xu, Y., Wu, X., Yi, R. ... Su, X. (2021). Antioxidant stress and anticancer activity of peptide‑chelated selenium <em>in vitro</em>. International Journal of Molecular Medicine, 48, 153. https://doi.org/10.3892/ijmm.2021.4986
MLA
Li, X., Wang, X., Liu, G., Xu, Y., Wu, X., Yi, R., Jin, F., Sa, C., Su, X."Antioxidant stress and anticancer activity of peptide‑chelated selenium <em>in vitro</em>". International Journal of Molecular Medicine 48.2 (2021): 153.
Chicago
Li, X., Wang, X., Liu, G., Xu, Y., Wu, X., Yi, R., Jin, F., Sa, C., Su, X."Antioxidant stress and anticancer activity of peptide‑chelated selenium <em>in vitro</em>". International Journal of Molecular Medicine 48, no. 2 (2021): 153. https://doi.org/10.3892/ijmm.2021.4986
Copy and paste a formatted citation
x
Spandidos Publications style
Li X, Wang X, Liu G, Xu Y, Wu X, Yi R, Jin F, Sa C and Su X: Antioxidant stress and anticancer activity of peptide‑chelated selenium <em>in vitro</em>. Int J Mol Med 48: 153, 2021.
APA
Li, X., Wang, X., Liu, G., Xu, Y., Wu, X., Yi, R. ... Su, X. (2021). Antioxidant stress and anticancer activity of peptide‑chelated selenium <em>in vitro</em>. International Journal of Molecular Medicine, 48, 153. https://doi.org/10.3892/ijmm.2021.4986
MLA
Li, X., Wang, X., Liu, G., Xu, Y., Wu, X., Yi, R., Jin, F., Sa, C., Su, X."Antioxidant stress and anticancer activity of peptide‑chelated selenium <em>in vitro</em>". International Journal of Molecular Medicine 48.2 (2021): 153.
Chicago
Li, X., Wang, X., Liu, G., Xu, Y., Wu, X., Yi, R., Jin, F., Sa, C., Su, X."Antioxidant stress and anticancer activity of peptide‑chelated selenium <em>in vitro</em>". International Journal of Molecular Medicine 48, no. 2 (2021): 153. https://doi.org/10.3892/ijmm.2021.4986
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team