Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
April-2025 Volume 55 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2025 Volume 55 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML

  • Supplementary Files
    • Supplementary_Data.pdf
Article Open Access

Thymoquinone mitigates cardiac hypertrophy by activating adaptive autophagy via the PPAR‑γ/14‑3‑3γ pathway

  • Authors:
    • Rong-Bin Qiu
    • Shi-Tao Zhao
    • Zhi-Qiang Xu
    • Li-Juan Hu
    • Rui-Yuan Zeng
    • Zhi-Cong Qiu
    • Han-Zhi Peng
    • Lian-Fen Zhou
    • Yuan-Ping Cao
    • Li Wan
  • View Affiliations / Copyright

    Affiliations: Department of Cardiovascular Surgery, The First Affiliated Hospital, Jiangxi Medical College, Nanchang University, Nanchang, Jiangxi 330006, P.R. China, Department of Cardiovascular Surgery, The First Affiliated Hospital, Jiangxi Medical College, Nanchang University, Nanchang, Jiangxi 330006, P.R. China, Department of Nursing, Gannan Health Vocational College, Ganzhou, Jiangxi 341000, P.R. China
    Copyright: © Qiu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 59
    |
    Published online on: February 7, 2025
       https://doi.org/10.3892/ijmm.2025.5500
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Thymoquinone (TQ), the principal active compound derived from the black seed plant, has been extensively utilized in traditional medicine for treating various ailments. Despite its widespread use, its therapeutic mechanisms in the context of cardiac hypertrophy remain insufficiently understood. The present study focused on assessing the efficacy of TQ in mitigating cardiac hypertrophy while identifying its specific protective pathways. Through a combination of in vivo experiments utilizing a mouse model of transverse aortic constriction (TAC) and in vitro studies utilizing an angiotensin II (AngII)‑induced hypertrophy model in H9C2 cells, the protective actions of TQ were comprehensively evaluated. The results revealed that TQ significantly attenuated TAC‑induced cardiac hypertrophy and improved overall cardiac function. In AngII‑induced H9C2 cells, pretreatment with TQ significantly reduced both cell hypertrophy and reactive oxygen species levels, while simultaneously promoting autophagy and limiting fibrosis. TQ was also found to increase the transcriptional activity of peroxisome proliferator‑activated receptor‑γ (PPAR‑γ), which interacted with 14‑3‑3γ protein, leading to autophagy activation and subsequent cellular protection. However, the protective autophagic effects were attenuated when PPAR‑γ activity was inhibited alongside pAD/14‑3‑3γ‑short hairpin RNA administration. The present findings demonstrate that TQ mitigates cardiac hypertrophy by modulating autophagy via the PPAR‑γ/14‑3‑3γ signaling axis, highlighting its therapeutic potential for cardiac hypertrophy treatment.

Introduction

Myocardial hypertrophy represents a fundamental adaptive response of the heart to diverse stressors, frequently characterized by the enlargement of myocardial cells and increased fibrosis. Initially, this adaptation functions as a compensatory process aimed at preserving cardiac function. However, over time, sustained hypertrophy disrupts myocardial performance, precipitating heart failure (1). Myocardial hypertrophy is widely recognized as an independent predictor of cardiovascular-related morbidity and mortality, with prolonged hypertrophy driving structural remodeling, functional decline, heart failure progression and, in severe cases, sudden cardiac death (2). Epidemiological data demonstrate that myocardial hypertrophy is a leading cause of morbidity and mortality in heart failure cases (3). Cardiac hypertrophy typically manifests with cardiomyocyte enlargement, fibrosis, myofibrillar disarray, cell death, and increased protein synthesis (4). Underlying mechanisms often include mitochondrial dysfunction, cardiomyocyte fibrosis, apoptosis and the overproduction of reactive oxygen species (ROS) (5). Investigating pharmacological interventions that target these pathways may offer potential therapeutic strategies for controlling this pathological condition (6).

Thymoquinone (TQ), the major bioactive compound in Nigella sativa seeds, plays a significant role in mediating various biological activities of the plant (7). Studies have identified the therapeutic benefits of TQ across multiple pathological conditions, including tumorigenesis, autoimmune disorders, diabetes and neurodegenerative diseases, primarily through pathways involving immune modulation, suppression of apoptosis, attenuation of oxidative stress and neutralization of free radicals (8,9). However, the precise mechanism through which TQ exerts its protective effects on cardiac hypertrophy remains elusive.

Autophagy is a process that entails the engulfment of cytoplasmic proteins or organelles, their encapsulation into vesicles and subsequent fusion with lysosomes to form autolysosomes for degradation. In cardiomyocytes, adaptive autophagy helps eliminate damaged organelles, ensuring the preservation of cardiac function. However, both excessive activation and marked suppression of autophagy can compromise cardiac structure and function (10). Accumulating evidence indicates a key involvement of autophagy in cardiac hypertrophy. Xue et al (11) demonstrated that Sestrin 1 mitigated phenylephrine-induced cardiac hypertrophy by modulating the AMP-activated protein kinase (AMPK)/mTORC1 autophagy pathway. Furthermore, the deletion of ATPase inhibitory factor 1 enhances AMPK activity, boosts autophagy and alleviates transverse aortic constriction (TAC)-induced cardiac hypertrophy (12). Thus, targeting autophagy regulation offers potential therapeutic value for cardiac hypertrophy.

Peroxisome proliferator-activated receptor-γ (PPAR-γ) belongs to a family of ligand-induced transcription factors within the nuclear receptor superfamily (13). Activation of PPAR-γ can reduce inflammation, inhibit oxidative stress and enhance cardiomyocyte energy metabolism, thus inhibiting myocardial remodeling and mitigating myocardial hypertrophy (14). Research has demonstrated that thiazolidinediones exhibit efficacy in enhancing insulin sensitivity and mitigating hyperglycemia through their targeting of PPAR-γ, and they have gained widespread application in the treatment of type 2 diabetes (15). Since PPAR-γ targeted drugs have been poorly studied in cardiac hypertrophy, it is of clinical interest to investigate natural products that can effectively activate PPAR-γ to alleviate cardiac hypertrophy.

The objective of the present study was to validate the protective effect of TQ on cardiac hypertrophy both in vitro and in vivo, as well as to delve into the underlying mechanisms and provide key insights into the therapeutic potential of TQ in both preventing and managing cardiac hypertrophy.

Materials and methods

Reagents and chemicals

TQ (purity ≥99.59%), 3-Methyladenine (3-MA; purity ≥99.91%) and GW9662 (PPAR-γ antagonist; purity ≥99.87%) were sourced from MedChemExpress, while pAD/14-3-3γ-short hairpin (sh)RNA was procured from Cyagen Biosciences, Inc. AngII was acquired from GLPBIO Technology LLC. PPAR-γ (cat. no. YT3836) antibody was supplied by ImmunoWay Biotechnology Company. Primary antibodies for LC3 (cat. no. 381544), p62 (cat. no. 380612), 14-3-3γ (cat. no. R381405) and secondary antibodies (goat anti-mouse, cat. no. 511103; goat anti-rabbit, cat. no. 511203) were purchased from Chengdu Zen-Bioscience Co., Ltd. Proteintech Group, Inc. provided antibodies against collagen I (cat. no. 14695-1-AP), atrial natriuretic peptide (ANP; cat. no. 27426-1-AP) and β-actin (cat. no. 66009-1-Ig). ABclonal, Inc. provided antibodies against brain natriuretic peptide (BNP; cat. no. A2179).

Cell model of cardiac hypertrophy and treatment

The rat H9C2 cell line, obtained from the Cell Bank of Type Culture Collection of the Chinese Academy of Sciences, was maintained in H-DMEM (HyClone; Cytiva), supplemented with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin-streptomycin (Gibco; Thermo Fisher Scientific, Inc.). The H9C2 cells were incubated at 37°C in a controlled environment (95% humidity, 21% O2, and 5% CO2) (16). The H9C2 cells were allocated into six distinct experimental groups: i) Control group, H9C2 cells were maintained in H-DMEM for 48 h under standard conditions; ii) AngII group: H9C2 cells were cultured in H-DMEM for 24 h, followed by exposure to 1 µM AngII for an additional 24 h (17); iii) AngII + TQ group: Cells were pretreated with 10 µM TQ for 24 h before subsequent exposure to 1 µM AngII for another 24 h; iv) AngII + TQ + 3-MA group: Cells were incubated with 10 µM TQ and 5 mM 3-MA (18) for 24 h, followed by 1 µM AngII treatment for 24 h; v) AngII + TQ + GW9662 group: Cells were pretreated with 10 µM TQ and 10 µM GW9662 (19) for 24 h, then exposed to 1 µM AngII for an additional 24 h; and vi) AngII + TQ + pAD/14-3-3γ-shRNA group: H9C2 cardiomyocytes were transfected with pAd/14-3-3γ-shRNA at 37°C for 48 h, incubated with 10 µM TQ for 24 h and subsequently treated with 1 µM AngII for another 24 h.

Adenovirus transfection

H9C2 cardiomyocytes were pre-cultured in fresh H-DMEM supplemented with 10% FBS and then transfected with either pAd/14-3-3γ-shRNA or pAd/negative control-shRNA (Cyagen Biosciences, Inc.; concentration not measured) using HighGene plus Transfection reagent (cat. no. RM09014; ABclonal Biotech Co., Ltd.). The transfection efficiency was ~85% after 48 h at 37°C, when the subsequent experiments were carried out. The shRNA sequences are provided in Table I.

Table I

Sequences of the shRNA used in the study.

Table I

Sequences of the shRNA used in the study.

NameSequence (5′ to 3′)
14-3-3γshRNA CGGCGAAGGCAACAACTAACTCGAGTTAGTTGTTGCCTTCGCCG
pAD/NC-shRNA CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG

[i] shRNA, short hairpin RNA; NC, negative control.

Cell viability assay

Cell viability was determined via the Cell Counting Kit-8 (CCK-8; GLPBIO Technology LLC). H9C2 cells were cultured in 96-well plates at a density of 2×104 cells/well and exposed to TQ at concentrations of 1, 5, 10 and 20 µM for 24 h. Subsequently, 10 µl CCK-8 reagent was introduced to each well for 1 h at 37°C, and the absorbance at 450 nm was recorded using a microplate reader (Thermo Fisher Scientific, Inc.).

Determination of oxidative stress and lysosome detection

ROS production levels were assessed via staining with dichlorofluorescein diacetate (DCFH-DA; Beyotime Institute of Biotechnology). H9C2 cells were exposed to 10 µM DCFH-DA for 20 min at 37°C in the dark, followed by three washes with H-DMEM lacking 10% FBS. Intracellular ROS was subsequently visualized using a fluorescence microscope (Olympus Corporation). Lyso-Tracker Red (Beyotime Institute of Biotechnology), a lysosomal red fluorescent probe, enables lysosome-specific staining in live cells by penetrating cell membranes. H9C2 cells were incubated with the Lyso-Tracker Red working solution for 30 min at 37°C in the dark, and fluorescence microscopy (Olympus Corporation) was employed for observation.

Transmission electron microscopy (TEM)

Cells were harvested and fixed in 2% glutaraldehyde at 25°C for 2 h, followed by sequential washing with PBS, dehydration, embedding, sectioning and staining. The sections were 60-80 nm thick and were embedded at 37°C for 5-8 h using EPON 812. Staining was performed using 2% uranyl acetate and 2.6% lead citrate at 37°C for 8 min. Autophagosome structures in H9C2 cells were analyzed via TEM (Hitachi 7800; Hitachi, Ltd.).

Western blot analysis

Total proteins were isolated from H9C2 cells and mouse myocardial tissue using RIPA lysis buffer (Beijing Solarbio Science & Technology Co., Ltd.). Protein concentrations were determined via the BCA Assay Kit (GLPBIO Technology LLC). Equivalent amounts of protein (30-40 µg) were resolved via 10-12.5% gradient SDS-PAGE and subsequently transferred to polyvinylidene fluoride membranes (Pall Corporation). Membranes were blocked with 5% skimmed milk at room temperature for 2 h, followed by overnight incubation at 4°C with primary antibodies against LC3 (1:1,000), p62 (1:1,000), 14-3-3γ (1:1,000), β-actin (1:1,000), collagen I (1:500) and PPAR-γ (1:500) on a shaker. After washing three times using TBST (0.05% Tween 20), the membranes were incubated with HRP-conjugated secondary antibodies (1:5,000) for 2 h at room temperature. β-actin served as a loading control. Finally, protein bands were visualized using the Ultra High Sensitivity ECL kit (cat. no. GK10008; GLPBIO Technology LLC) and protein band densities were semi-quantified using ImageJ software (National Institutes of Health; v1.8.0.345).

RNA isolation and reverse transcription-quantitative PCR (RT-qPCR)

RT-qPCR analysis was performed to quantify the mRNA expression levels of ANP, BNP, NADPH oxidase 4 (NOX4), superoxide dismutase 2 (SOD2) and collagen I. Total RNA was isolated with TRIzol reagent (Beijing Solarbio Science & Technology Co., Ltd.), followed by RT using the PrimeScript RT reagent kit (Monad Biotech Co., Ltd.) according to the manufacturer's instructions. qPCR was performed using the SYBR Green qPCR Master Mix (cat. no. B21203; Selleck Chemicals) on the BIO-RAD CFX Connect Real-Time PCR Detection System from Bio-Rad Laboratories, Inc. The qPCR protocol comprised an initial denaturation step at 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 15 sec and annealing plus extension at 60°C for 1 min. β-actin served as the internal reference and the relative mRNA expression levels of the target genes were calculated employing the 2−ΔΔCq method (20). The specific primers for each gene are detailed in Table II.

Table II

Primers used for of reverse transcription-quantitative PCR.

Table II

Primers used for of reverse transcription-quantitative PCR.

GeneSpeciesForward primer (5′ to 3′)Reverse primer (5′ to 3′)
ANPRat ATCTGATGGATTTCAAGAACC CTCTGAGACGGGTTGACTTC
BNPRat ACAATCCACGATGCAGAAGCT GGGCCTTGGTCCTTTGAGA
ANPMouse CTCCGATAGATCTGCCCTCTTGAA GGTACCGGAAGCTGTTGCAGCCTA
BNPMouse GCTCTTGAAGGACCAAGGCCTCAC GATCCGATCCGGTCTATCTTGTGC
Collagen IRat GAGAGAGCATGACCGATGGATT TGGACATTAGGCGCAGGAA
Collagen IMouse AGGCTTCAGTGGTTTGGATG CACCAACAGCACCATCGTTA
NOX4Rat CTGACAGGTGTCTGCATGGT ACTTCAACAAGCCACCCGAA
NOX4Mouse CGGGATTTGCTACTGCCTCCAT GTGACTCCTCAAATGGGCTTCC
SOD2Rat GTGTCTGTGGGAGTCCAAGG TGCTCCCACACATCAATCCC
SOD2Mouse TAACGCGCAGATCATGCAGCTG AGGCTGAAGAGCGACCTGAGTT
ACTBRat AGATGACCCAGATCATGTTTGAGA CGCTCGGTCAGGATCTTCAT
ACTBMouse GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT

[i] ACTB, β-actin; ANP, atrial natriuretic peptide; BNP, brain natriuretic peptide; SOD2, superoxide dismutase 2; NOX4, NADPH oxidase 4.

Immunofluorescence staining

LC3 expression was evaluated using immunofluorescence staining. After washing the cell samples with PBS fixation was carried out with 4% paraformaldehyde (Biosharp Life Sciences) at room temperature for 10 min, then permeabilization for 10 min at room temperature using 0.2% Triton X-100 (Beijing Solarbio Science & Technology Co., Ltd.), followed by blocking with 2% BSA (cat. no. 9048-46-8; Shanghai Yuanye Biotechnology Co., Ltd.) at room temperature for 30 min. The cells were subsequently incubated overnight at 4°C with rabbit anti-LC3 primary antibody (1:500). Following three washes with TBST (0.05% Tween 20), fluorescent secondary goat anti-rabbit antibody (1:200; cat.no. A32732; Thermo Fisher Scientific, Inc.) was applied for 1 h at room temperature. DAPI counterstaining was performed at room temperature for 5 min, and fluorescence microscopy was used for observation.

Luciferase activity assay

Luciferase activity was assessed using a dual-luciferase reporter assay system (Promega Corporation; cat. no. E1910 Transfection of pcDNA3.1-PPAR-γ and psiCheck2-14-3-3γ (Hunan Fenghui Biotechnology Co., Ltd.) constructs into cells was carried out with LipoFiter (cat. no. HB-LF-1000; Hanbio Biotechnology Co., Ltd.) for 6 h at 37°C. Subsequently, 100 µl each of firefly and Renilla luciferase detection reagents were applied, followed by the measurement of relative light units. The luciferase activity ratio between firefly and Renilla was then calculated.

Molecular docking

The three-dimensional structures of TQ and PPAR-γ were obtained from PubChem (Compound CID: 10281) and the Protein Data Bank (PDB) (PDB ID: 3PRG), respectively. The CB-Dock2 (https://cadd.labshare.cn/cb-dock2/php/index.php) server was utilized to carry out molecular docking.

Animal model of cardiac hypertrophy and treatment

The experimental procedures followed the guidelines established by the National Institutes of Health and were approved by the Animal Experimentation Ethics Committee of The First Affiliated Hospital, Jiangxi Medical College, Nanchang University (Nanchang, China; approval no. CDYFY-IACUC-202407QR115). Male C57BL/6 mice (22-24 g, 8 weeks old) were sourced from Changzhou Cavens Laboratory Animal Ltd. The mice were maintained in controlled environmental conditions, with a temperature of 23±1°C, a humidity of 40-50%, a 12-h light/dark cycle to simulate day and night, and ad libitum access to food and water to ensure their well-being and experimental accuracy.

The mice were randomly allocated into four groups: i) Sham operation, ii) TAC operation, iii) TAC operation with TQ treatment, and iv) TAC operation with TQ treatment alongside PPAR-γ antagonist (GW9662). Each group comprised 6 mice. The mouse model of pressure overload-induced cardiac hypertrophy was generated through TAC surgery, following the protocol outlined in a previous study (21). For the operation, animals were anesthetized in a chamber with isoflurane (induced with 2% and maintained with 1.5%), supplemented during surgery with 0.1 mg/kg buprenorphine HCl via subcutaneous injection. Post-surgery, the health and behavior of the mice were monitored twice daily. In the TQ treatment group, TQ (50 mg/kg, dissolved in corn oil) was administered via gavage for 6 weeks post-TAC (22). The PPAR-γ antagonist group received intraperitoneal injections of GW9662 (1 mg/kg) after TAC surgery, administered every 3 days for 6 weeks.

The animal was euthanized if predefined humane endpoints were met, including: i) Rapid weight loss of 15-20% of the original body weight (BW); ii) the inability to eat, drink or stand for up to 24 h; and iii) depression and hypothermia (<37°C) without anesthesia or sedation. No mice exhibited signs of reaching these endpoints during the experiment. Euthanasia was induced by an overdose of pentobarbital sodium (200 mg/kg). Animals were observed for 5-10 min post-injection to confirm death, assessed by respiratory and cardiac arrest, and loss of corneal reflex.

Histological analysis

Mouse heart weight (HW) and BW were recorded. Heart tissue samples were preserved in formalin for 12 h at room temperature and embedded in paraffin following established protocols (23). Paraffin-embedded specimens were sectioned at 5 µm thickness and subjected to hematoxylin and eosin staining for 5 min at room temperature as well as Masson's trichrome staining for 5 min at room temperature, using standard procedures (24,25). The myocardial cell size was observed from ventricular slices stained with fluorescein isothiocyanate-labeled wheat germ agglutinin (WGA) at 37°C in the dark for 2 h. Finally, the sections were examined under an inverted fluorescence microscope (Nikon Eclipse Ti-SR), and images were subsequently captured.

Echocardiography

After anesthetizing the mice with 1.5% isoflurane, echocardiography was performed. Cardiac function was assessed using a small animal ultrasound imaging system (VEVO2100; FUJIFILM VisualSonics, Inc.; FUJIFILM Sonosite, Inc.) featuring a 30-MHz probe.

Statistical analysis

Data analysis was conducted using GraphPad Prism 9.0 software (Dotmatics). For two-group comparisons, unpaired Student's t-test was applied, while one-way ANOVA followed by the Tukey's post hoc test was employed for multiple group comparisons. P<0.05 was considered to indicate a statistically significant difference.

Results

Effects of TQ on the viability of H9C2 cells

H9C2 cell viability under varying concentrations of TQ (0, 1, 5, 10 and 20 µM) and AngII (1 µM) was evaluated using the CCK-8 assay. Treatment with TQ at different concentrations did not significantly alter cell viability compared with the control (0 µM) group (Fig. 1A). By contrast, AngII (1 µM) significantly reduced cell viability, an effect that was attenuated by TQ pretreatment (Fig. 1B). As the 10 µM concentration demonstrated the most notable protective effect, it was selected for subsequent experiments. The chemical structure of TQ is illustrated in Fig. 1C and D.

Figure 1

Effects of TQ on the survival of H9C2 cells. (A) The viability of H9C2 cells following treatment with varying concentrations of TQ (0, 1, 5, 10 and 20 µM) was assessed. (B) The viability of H9C2 cells following treatment with varying concentrations of TQ and 1 µM AngII was assessed. (C and D) The molecular structure of TQ. Data are presented as the mean ± SD. **P<0.01, ***P<0.001. ns, not significant; TQ, thymoquinone; AngII, angiotensin II.

TQ attenuates cardiomyocyte hypertrophy in vitro and in vivo

To assess the potential protective effects of TQ against AngII-induced hypertrophy in H9C2 cells, cells were pretreated with AngII (1 µM) for 24 h to induce hypertrophy, followed by evaluation of the cell surface area through WGA immunostaining. Pretreatment with TQ significantly decreased the cell surface area compared with the AngII group (Fig. 2A). In addition, analysis of the protein and mRNA expression levels of key hypertrophic markers, ANP and BNP, indicated that TQ significantly downregulated the expression of these markers (Fig. 2B-D). These results collectively indicated that TQ mitigated the hypertrophic response triggered by AngII in H9C2 cells.

Figure 2

TQ attenuates cardiomyocyte hypertrophy in vitro. (A) Images of H9C2 cells stained for wheat germ agglutinin expression (green) (magnification, ×400; scale bar, 50 µm). (B) Immunoblotting analysis of ANP and BNP protein expression levels in H9C2 cells, (C) alongside the semi-quantification of the results. β-actin was used as an internal control (n=3). (D) Expression levels of the ANP and BNP genes in H9C2 cells. Data are presented as the mean ± SD. **P<0.01, ***P<0.001. TQ, thymoquinone; AngII, angiotensin II; ANP, atrial natriuretic peptide; BNP, brain natriuretic peptide.

To assess the cardioprotective effects of TQ on cardiac hypertrophy, a pressure overload hypertrophy mouse model was induced via TAC surgery. Cardiac function was analyzed through echocardiography (Fig. 3A). Mice in the TAC group exhibited a decline in left ventricular ejection fraction and fractional shortening, alongside an increase in left ventricular internal dimension diastole and posterior wall dimension, compared with the sham group (Fig. 3B-E). However, post-TAC administration of TQ improved cardiac function and attenuated hypertrophy in mice (Fig. 3A-E). Furthermore, pretreatment with TQ alleviated TAC-induced hypertrophy, as indicated by a reduction in cardiac size (Fig. 3G). Additionally, a marked increase in heart size and myofibril degeneration was observed in the TAC group, while the TQ-treated group exhibited reduced heart size and improved myofibril integrity, as shown by hematoxylin and eosin staining (Fig. 3H). The HW/BW ratio was significantly lower in the TAC + TQ group compared with the TAC group (Fig. 3F). Additionally, the protein and mRNA expression levels of ANP and BNP were notably down-regulated in the TAC + TQ group relative to the TAC group (Fig. 3I-L). These findings indicated that TQ attenuated pressure overload-induced cardiac hypertrophy.

Figure 3

TQ attenuates cardiomyocyte hypertrophy in vivo. (A) Echocardiography was conducted to assess heart function. (B) EF, (C) FS, (D) LVPWd, (E) LVIDd and (F) HW/BW ratios were measured. (G) Representative images of the whole hearts. (H) Hematoxylin and eosin-stained cardiac cross-sections (scale bars, 2.5 mm or 100 µm). (I and J) Immunoblotting analysis of ANP and BNP protein expression levels in vivo, (K) alongside the semi-quantification of the results. β-actin was used as an internal control (n=3). (L) The effects of TQ on the mRNA expression of ANP and BNP. Data are presented as the mean ± SD, n=6 mice per group. **P<0.01, ***P<0.001. TQ, thymoquinone; EF, ejection fraction; FS, fractional shortening (of the left ventricular diameter); LVPWd, diastolic left ventricular posterior wall thickness; LVIDd, diastolic left ventricular internal diameter; HW, heart weight; BW, body weight; TAC, transverse aortic constriction; ANP, atrial natriuretic peptide; BNP, brain natriuretic peptide.

TQ inhibits cardiac fibrosis in vivo and in vitro

The inter-relation between cardiac fibrosis and hypertrophy has been well-established, with fibrosis progression impairing myocardial contractility, ultimately contributing to heart failure and potential mortality (26,27). Masson staining, immunoblotting and RT-qPCR were employed to assess the effects of TQ on cardiac fibrosis. Masson staining showed a marked increase in fibrosis in mice subjected to TAC surgery, which was markedly attenuated by TQ treatment (Fig. 4A). The protein and mRNA levels of type I collagen were significantly upregulated in the TAC group compared with the control but were reduced following TQ administration (Fig. 4B-D). Similarly, in vitro experiments using H9C2 cells revealed elevated expression of type I collagen in the AngII group, which was mitigated by TQ, aligning with the in vivo findings (Fig. 4E-G).

Figure 4

TQ inhibits cardiac fibrosis in vivo and in vitro. (A) Masson's trichrome staining for cardiac fibrosis (scale bar, 100 µm). (B) Immunoblotting analysis of collagen I protein expression levels in vivo (C) alongside the semi-quantification of the results. β-actin was used as an internal control (n=3). (D) The effects of TQ on collagen I mRNA expression in vivo was assessed using reverse transcription-quantitative PCR. (E) Immunoblotting analysis of collagen I protein expression levels in vitro, (F) alongside the semi-quantification of the results. β-actin was used as an internal control (n=3). (G) The effects of TQ on the mRNA expression of collagen I in vitro. Data are presented as the mean ± SD. *P<0.05, **P<0.01, ***P<0.001. TQ, thymoquinone; TAC, transverse aortic constriction; AngII, angiotensin II.

TQ attenuates oxidative stress levels in cardiac hypertrophy cells

Excessive generation of ROS is recognized as a key mechanism contributing to the progression of cardiac hypertrophy (5). Elevated ROS accumulation in cardiomyocytes has been shown to aggravate cardiac hypertrophy and myocardial fibrosis, ultimately leading to heart failure (28). To explore the potential antioxidative effect of TQ in cardiac hypertrophy, ROS levels were measured in treated cells. A notable increase in ROS levels were observed in the AngII group, while TQ treatment markedly reduced ROS levels (Fig. 5A). Additionally, RT-qPCR and western blot analysis indicated that TQ significantly downregulated the mRNA and protein expression of the oxidation gene, NOX4, and significantly upregulated the mRNA and protein expression of antioxidation gene, SOD2, in both the TAC-induced and AngII-induced groups (Fig. 5B-G).

Figure 5

TQ attenuates oxidative stress levels in cardiac hypertrophy. (A) Representative images stained with DCFH-DA for reactive oxygen species detection in H9C2 cells (magnification, ×400). The effects of TQ on NOX4 and SOD2 mRNA expression (B) in vivo and (C) in vitro were assessed using reverse transcription-quantitative PCR. Immunoblotting analysis of ANP and BNP protein expression levels (D and E) in vivo and (F and G) in vitro, alongside the semi-quantification of the results. β-actin was used as an internal control (n=3). Data are presented as the mean ± SD. *P<0.05, **P<0.01, ***P<0.001. TQ, thymoquinone; TAC, transverse aortic constriction; AngII, angiotensin II; NOX4, NADPH oxidase 4; SOD2, superoxide dismutase 2.

TQ activates adaptive autophagy in H9C2 hypertrophy cardiomyocytes

Autophagy plays a central role in the pathogenesis of cardiac hypertrophy, with its dysregulation contributing to the worsening of the condition (29,30). To evaluate the effect of TQ pretreatment on adaptive autophagy in H9C2 cells, the expression levels of autophagy markers, LC3II and p62, as well as lysosome counts, were analyzed. As shown in Fig. 6A-C, TQ + AngII treatment significantly increased LC3II expression while reducing p62 levels compared with AngII alone. This modulation was attenuated by the autophagy inhibitor, 3-MA. These results suggested that autophagy was downregulated during the onset of hypertrophy in cardiac cells and that TQ pretreatment restored autophagic activity under these conditions. Furthermore, LysoTracker Red staining revealed a reduction in lysosome numbers following AngII-induced treatment of H9C2 cells, which was reversed upon TQ administration. Notably, the addition of 3-MA markedly reduced fluorescence intensity in H9C2 cells (Fig. 6D). Immunofluorescence analysis indicated an elevation in LC3 expression following TQ pretreatment, which was markedly reversed by 3-MA (Fig. 6E). Thus, we found that TQ activated adaptive autophagy in H9C2 hypertrophy cardiomyocyte.

Figure 6

TQ activates adaptive autophagy in H9C2 hypertrophic cardiomyocytes. (A) Immunoblotting analysis of the LC3 and p62 protein expression levels in AngII-induced hypertrophic H9C2 cells, (B and C) alongside the semi-quantification of the results. β-actin was used as an internal control (n=3). (D) Representative images of AngII-induced hypertrophic H9C2 cells stained with LysoTracker Red (magnification, ×200; scale bar, 100 µm). (E) Representative images of LC3 immunofluorescence in the AngII-induced H9c2 cell hypertrophic model (magnification, ×200; scale bar, 50 µm). Data are presented as the mean ± SD. **P<0.01, ***P<0.001. TQ, thymoquinone; AngII, angiotensin II; 3-MA, 3-Methyladenine.

TQ alleviates hypertrophy in cardiac cells by upregulating 14-3-3γ expression to activate adaptive autophagy

The 14-3-3 proteins, a group of highly conserved acidic proteins found in all eukaryotic cells, comprise seven isoforms (31). Research has established their role in regulating autophagy and their protective function in cardiomyocytes (16,32). To investigate whether TQ conferred protection via autophagy regulation mediated by 14-3-3γ, the expression of 14-3-3γ was knocked down in H9C2 cells, the success of which was verified by western blot analysis (Fig. S1). As shown in Fig. 7A and B, TQ pretreatment led to a significant upregulation of 14-3-3γ expression, an effect that was reversed by pAD/14-3-3γ shRNA. In addition, knockdown of 14-3-3γ significantly influenced autophagic activity (Fig. 7A, C and D). Specifically, pAD/14-3-3γ shRNA reduced LC3II expression while simultaneously increasing p62 expression compared with the TQ group. TEM further confirmed a reduction in autophagic vesicles and therefore a suppression of autophagy in H9C2 cells treated with pAD/14-3-3γ shRNA (Fig. 7E). Additionally, pAD/14-3-3γ shRNA upregulated the mRNA and protein expression levels of ANP and BNP compared with the AngII + TQ group (Fig. 7F-H). These experiments confirmed that TQ alleviated cardiac hypertrophy by upregulating 14-3-3γ.

Figure 7

TQ alleviates cardiac hypertrophy by upregulating 14-3-3γ expression to activate adaptive autophagy. (A) Immunoblotting analysis of LC3, p62 and 14-3-3γ protein expression levels in AngII-induced hypertrophic H9C2 cells, (B-D) alongside the semi-quantification of the results. β-actin was used as an internal control (n=3). TQ inhibited the protein expression levels of p62 and upregulated the protein expression levels of LC3II, effects that were abolished by the simultaneous knockdown of 14-3-3 γ. (E) Transmission electron microscopy images of H9C2 cells (magnification, ×6,000; scale bar: 2 µm). (F) Expression levels of the hypertrophic genes, ANP and BNP, in H9C2 cells. (G) Immunoblotting analysis of the ANP and BNP protein expression levels in H9C2 hypertrophic cardiomyocytes, (H) alongside the semi-quantification of the results. β-actin was used as an internal control (n=3). TQ inhibited the mRNA and protein expression levels of ANP and BNP, effects that were abolished by the simultaneous knockdown of 14-3-3γ. Data are presented as the mean ± SD. *P<0.05, **P<0.01, ***P<0.001. TQ, thymoquinone; AngII, angiotensin II; shRNA, short hairpin RNA; ANP, atrial natriuretic peptide; BNP, brain natriuretic peptide.

TQ targets PPAR-γ and attenuates cardiac hypertrophy through activating adaptive autophagy

PPAR-γ, a protective regulator, is essential for maintaining cardiac homeostasis and preventing heart failure (33-35). We hypothesized that TQ could specifically target PPAR-γ and activate adaptive autophagy, thereby alleviating cardiac hypertrophy. To test this conjecture, the protein expression level of PPAR-γ was detected using western blot analysis. The results demonstrated that PPAR-γ expression in hypertrophic cardiac tissue revealed was significantly downregulated compared with the control group. However, TQ treatment effectively restored PPAR-γ levels. Notably, the co-administration of a PPAR-γ inhibitor (GW9662) reversed the TQ-mediated upregulation of PPAR-γ (Fig. 8A-D). Molecular docking techniques were employed to explore the regulatory interaction between TQ and PPAR-γ, simulating their binding. This method is widely used to evaluate compound interactions and activity (36). The analysis demonstrated that TQ formed hydrogen bonds with several key sites on PPAR-γ (Fig. 8F), suggesting that PPAR-γ modulation may be a potential mechanism of TQ's effects. Furthermore, similar results in AngII-pretreated H9C2 cells as those obtained from in vivo experiments were observed. The results indicated that the autophagy levels were suppressed as LC3II expression decreased and p62 expression increased in the AngII + TQ + GW9662 group treated compared with the AngII + TQ group (Fig. 8A-D). TEM further confirmed the reduction of autophagic vesicles in the PPAR-γ inhibitor-treated group, consistent with the western blot results (Fig. 8E). Additionally, PPAR-γ inhibition reversed the protective effects of TQ on cardiac hypertrophy, resulting in an enlarged cardiomyocyte surface area (Fig. 8G) and elevated the protein and mRNA expression of ANP and BNP (Fig. 8H-J).

Figure 8

TQ targets PPAR-γ to attenuate cardiac hypertrophy through activating adaptive autophagy. Immunoblotting analysis of LC3, p62 and PPAR-γ protein expression levels (A) in vivo and (C) in vitro after pretreatment with TQ and GW9662, (B and D) alongside the semi-quantification of the results. β-actin was used as an internal control (n=3). (E) Transmission electron microscopy images of H9C2 cells (magnification, ×6,000; scale bar, 2 µm). (F) Molecular docking images illustrate the binding positions of TQ within PPAR-γ, highlighting the interactions between the ligand and the residues. The docking mode employed was structure-based blind docking. The potential binding sites of the queried ligands were ranked according to the AutoDock Vina score (kcal/mol), and those with the lowest binding energy are selected for display. (G) Representative images of fluorescein isothiocyanate--conjugated wheat germ agglutinin stained transverse sections. (H) Immunoblotting analysis of the ANP and BNP protein expression levels in H9C2 hypertrophic cardiomyocytes after pretreatment with TQ and GW9662, (I) alongside the semi-quantification of the results. β-actin was used as an internal control (n=3). (J) The expression levels of the hypertrophic genes, BNP and ANP in H9C2 hypertrophic cardiomyocytes after pretreatment with TQ and GW9662. Data are presented as the mean ± SD. *P<0.05, **P<0.01, ***P<0.001. TQ, thymoquinone; AngII, angiotensin II; TAC, transverse aortic constriction; PPAR-γ, peroxisome proliferator-activated receptor-γ; ANP, atrial natriuretic peptide; BNP, brain natriuretic peptide.

TQ attenuates cardiac hypertrophy by activating adaptive autophagy through the PPAR-γ/14-3-3γ pathway

Inhibition of 14-3-3γ expression was observed upon treatment with the PPAR-γ inhibitor, GW9662. The suppression of PPAR-γ resulted in a corresponding reduction in 14-3-3γ levels (Fig. 9A and C). Similarly, knockdown of 14-3-3γ via pAD/14-3-3γ shRNA also diminished PPAR-γ expression (Fig. 9B and D). Moreover, the dual-luciferase assay demonstrated that PPAR-γ upregulated 14-3-3γ promoter activity (Fig. 9E). These results suggest that TQ mitigates cardiac hypertrophy by promoting adaptive autophagy through the PPAR-γ/14-3-3γ signaling axis (Fig. S2).

Figure 9

TQ attenuates cardiac hypertrophy by activating adaptive autophagy through the PPAR-γ/14-3-3γ pathway. (A) Immunoblotting analysis of the 14-3-3γ protein expression levels in AngII-induced hypertrophic H9C2 cells, (C) alongside the semi-quantification of the results. β-actin was used as an internal control (n=3). (B) Immunoblotting analysis of the PPAR-γ protein expression levels in AngII-induced hypertrophic H9C2 cells, (D) alongside the semi-quantification of the results. β-actin was used as an internal control (n=3). (E) Luciferase assay results demonstrate the interaction between PPAR-γ and 14-3-3γ. Data are presented as the mean ± SD. *P<0.05,**P<0.01; ns, not significant. TQ, thymoquinone; AngII, angiotensin II; PPAR-γ, peroxisome proliferator-activated receptor-γ; shRNA, short hairpin RNA

Discussion

Myocardial hypertrophy constitutes a significant risk factor for numerous cardiac pathologies. Prolonged hypertrophy often leads to a diminished left ventricular ejection fraction and progressive cardiac dysfunction, ultimately resulting in heart failure and increased mortality rates (37). At present, no specific pharmacological intervention exists for the effective treatment of cardiac hypertrophy in clinical practice. Thus, investigating the molecular mechanisms underlying the development of cardiac hypertrophy is essential for the discovery and advancement of novel therapeutic agents. In the present study, TQ treatment demonstrated a notable reduction in cardiac hypertrophy both in vitro, using H9C2 cells, and in vivo, utilizing a TAC-induced cardiac hypertrophy mouse model. TQ was found to markedly lower ROS levels, mitigate myocardial fibrosis, enhance autophagic activity in the context of cardiac hypertrophy and provide protection against hypertrophy-induced cardiac dysfunction. Additionally, TQ activated the PPAR-γ and 14-3-3γ signaling pathways, leading to enhanced autophagy and suppression of pathological cardiac hypertrophy. These results suggest that TQ holds considerable promise as a potential therapeutic agent for the treatment of cardiac hypertrophy and heart failure, with strong prospects for clinical application.

Chinese herbal medicines have gained prominence in the treatment of cardiovascular diseases (38). Baicalein, for instance, enhances catalase expression to eliminate ROS, binds to FOXO3a, promotes its transcriptional activity and activates autophagy, thereby alleviating cardiac hypertrophy (39). Similarly, Sophora effectively mitigates TAC-induced cardiac hypertrophy, protects against hypertrophy-related cardiac dysfunction, reduces myocardial fibrosis and activates AMPK/mTORC1-mediated autophagy to counteract hypertrophy (40). Berberine administration also ameliorates TAC-induced cardiac hypertrophy, reduces myocardial apoptosis, limits fibrosis and upregulates autophagy, providing cardioprotective effects in hypertrophy models (41). Despite these advances, research on the effects of TQ in cardiac hypertrophy remains limited. The present study highlights TQ's potential to attenuate cardiac hypertrophy, presenting a novel therapeutic strategy for managing the condition.

Oxidative stress arises from an imbalance between antioxidant defenses and ROS production, with excessive ROS leading to cellular damage. A major contributor to cardiac hypertrophy is oxidative stress driven by elevated ROS levels in cardiomyocytes (42). Persistent oxidative stress has been implicated in the progression of myocardial hypertrophy to heart failure (43). Evidence suggests that controlling oxidative stress can mitigate cardiac hypertrophy and hinder its transition to heart failure (44,45). In the present study, in the AngII-induced H9C2 cell hypertrophy model, ROS levels were assessed through DCFH-DA staining under fluorescence microscopy and the expression of ROS-related genes via qPCR. AngII markedly elevated ROS production in cells, while TQ pretreatment attenuated ROS levels, attributed to its potent antioxidant properties. However, a ROS inhibitor was not employed to further verify the impact of TQ on cardiac hypertrophy.

Autophagy is a conserved cellular mechanism responsible for degrading proteins and damaged organelles, playing a vital role in maintaining survival, development and homeostasis, and is therefore integral to human health and development (46). This homeostatic process ensures the degradation and recycling of cellular components under both physiological and stress conditions. Impaired autophagy results in disrupted ubiquitination, ROS accumulation and compromised mitochondrial function (47). Autophagy activation has been shown to alleviate cardiac hypertrophy and mitigate cardiac dysfunction in stress-induced hypertrophy models (48). The present study reinforces the hypothesis that enhancing autophagy can reduce the progression of cardiac hypertrophy. The present study utilized TEM and the Lyso-Tracker method to examine autophagic lysosomes, while western blotting was used to quantify the LC3 protein levels to evaluate autophagic activity. LC3, a widely recognized autophagy marker, is commonly used to assess autophagy, with LC3II levels closely linked to autophagosome numbers, and the LC3II/LC3I ratio serving as an indicator of autophagic flux (49). In the cardiac hypertrophy model, the protein expression level of LC3II was significantly reduced compared with the TQ-treated group, indicating that TQ mitigates cardiac hypertrophy and improves cardiac function by promoting autophagy. This observation is consistent with a prior study (48). Notably, to the best of our knowledge, the present study is the first to establish the role of TQ in attenuating cardiac hypertrophy through autophagy enhancement.

PPARs are part of the ligand-activated transcription factor family within the nuclear receptor superfamily, comprising three isoforms: PPAR-α, PPAR-δ and PPAR-γ (50). PPAR-γ, predominantly expressed in adipose tissue, governs adipocyte differentiation and the regulation of genes involved in lipid storage (13). PPAR-γ has been identified as a crucial regulator of adipose development and systemic metabolism, with therapeutic potential in enhancing insulin sensitivity in diabetic patients (51). Activation of PPAR-γ has been shown to prevent myocardial hypertrophy and attenuate post-myocardial infarction remodeling by reducing inflammation, oxidative stress, cell death and improving cardiomyocyte energy metabolism (13,50,52,53). In the present study, AngII exposure inhibited PPAR-γ expression in cultured H9C2 cells, while TQ treatment restored its activation. Notably, the cardioprotective effect of TQ disappeared upon administration of the PPAR-γ inhibitor, GW9662. To the best of our knowledge, the present study presents the first evidence that TQ mitigates cardiac hypertrophy via PPAR-γ activation.

The 14-3-3 proteins are ubiquitously expressed across animal and plant tissues, serving critical roles in cellular biology and signal transduction pathways (54). Numerous studies have identified 14-3-3 proteins as endogenous cardioprotective agents, offering protection in various heart injury models. For instance, curcumin has been shown to mitigate doxorubicin (DOX)-induced cardiotoxicity by upregulating 14-3-3γ, which in turn reduces serum lactate dehydrogenase (LDH) activity, inhibits apoptosis and limits mitochondrial damage (55). Quercetin has been shown to enhance cardiomyocyte viability, elevate SOD and catalase activity, and decrease LDH, ROS and malondialdehyde levels through the upregulation of 14-3-3γ, thereby mitigating DOX-induced cardiotoxicity. The protective effect is diminished when 14-3-3γ expression is knocked down (56). However, the role of 14-3-3γ in cardiac hypertrophy remains uncertain. In the present study, 14-3-3γ expression was reduced in the cardiac hypertrophy model but increased in the TQ-treated group. Knockdown of 14-3-3γ using pAD/14-3-3γ in the TQ group weakened the protective effects of TQ and suppressed autophagy. To the best of our knowledge, the present study is the first to demonstrate that TQ alleviates cardiac hypertrophy by upregulating 14-3-3γ and promoting autophagy.

Research has demonstrated that PPAR-γ plays a central role in regulating lipid metabolism and inflammation (57). PPAR-γ is crucial for maintaining cellular energy homeostasis, modulating inflammatory responses and controlling fibrosis (58). As a transcription factor, PPAR-γ regulates TGF-β1 expression and Smad2/3 phosphorylation, thereby inhibiting hepatic stellate cell activation and mitigating liver fibrosis (59). PPAR-γ activation also suppresses platelet derived growth factor and tissue inhibitory of metalloproteinase-2 expression in non-alcoholic fatty liver disease, reducing inflammation and fibrosis (60). We hypothesize that PPAR-γ may bind to the 14-3-3γ promoter to alleviate cardiac hypertrophy. Notably, in the present study, both 14-3-3γ and PPAR-γ protein expression increased in the TQ group but declined following PPAR-γ inhibitor (GW9662) treatment. A dual-luciferase reporter assay confirmed that PPAR-γ enhanced 14-3-3γ promoter activity. However, the absence of chromatin immunoprecipitation, Baf A1-induced LC3-I/II conversion and mRFP-LC3 tandem fluorescence assays in the present study limits its conclusiveness, necessitating further investigation. Additionally, primary cardiomyocytes, which were not used in the present study, may better mimic the in vivo environment and produce more convincing findings.

In conclusion, TQ appears to play a notable role in preventing pressure overload-induced cardiac hypertrophy by reducing oxidative stress and inhibiting fibrosis. TQ alleviates cardiac hypertrophy by modulating 14-3-3γ expression and enhancing autophagy through the activation of PPAR-γ transcriptional activity. This mechanism offers a potential therapeutic strategy for the clinical treatment of cardiac hypertrophy. Nonetheless, the present study contains certain limitations. First, while TQ exhibited a protective effect, its efficacy remains limited, necessitating further investigation across additional cardiac hypertrophy models. Second, the precise mechanism by which TQ induces autophagy through the PPAR-γ/14-3-3γ pathway requires further elucidation.

Supplementary Data

Availability of data and materials

The data generated in the present study may be requested from the corresponding author.

Authors' contributions

RBQ conducted the cell experiments and analyzed and mapped the experimental data. STZ provided the experimental design and data for analysis. ZQX conducted animal experiments and analyzed the results. RYZ, ZCQ, HZP and LFZ contributed to the cell experiments. LJH enhanced the language of the article and analyzed the data. YPC and LW designed the experiments and provided financial support. RYZ, ZCQ and HZP confirm the authenticity of all the raw data. All authors read and approved the final version of the manuscript.

Ethics approval and consent to participate

Animal experiments followed the guidelines of the National Institutes of Health and were authorized by the Animal Experimentation Ethics Committee of the First Affiliated Hospital, Jiangxi Medical College, Nanchang University (Nanchang, China; approval no. CDYFY-IACUC-202407QR115).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Acknowledgments

Not applicable.

Funding

This study was funded by the Natural Science Foundation of Jiangxi Province (grant no. 20212ACB206011) and the National Natural Science Foundation of China (grant nos. 82460057, 81860082 and 82260059).

References

1 

Frey N and Olson EN: Cardiac hypertrophy: The good, the bad, and the ugly. Annu Rev Physiol. 65:45–79. 2003. View Article : Google Scholar : PubMed/NCBI

2 

Xu M, Wan CX, Huang SH, Wang HB, Fan D, Wu HM, Wu QQ, Ma ZG, Deng W and Tang QZ: Oridonin protects against cardiac hypertrophy by promoting P21-related autophagy. Cell Death Dis. 10:4032019. View Article : Google Scholar : PubMed/NCBI

3 

Nakai A, Yamaguchi O, Takeda T, Higuchi Y, Hikoso S, Taniike M, Omiya S, Mizote I, Matsumura Y, Asahi M, et al: The role of autophagy in cardiomyocytes in the basal state and in response to hemodynamic stress. Nat Med. 13:619–624. 2007. View Article : Google Scholar : PubMed/NCBI

4 

Ritterhoff J and Tian R: Metabolic mechanisms in physiological and pathological cardiac hypertrophy: New paradigms and challenges. Nat Rev Cardiol. 20:812–829. 2023. View Article : Google Scholar : PubMed/NCBI

5 

Nakamura M and Sadoshima J: Mechanisms of physiological and pathological cardiac hypertrophy. Nat Rev Cardiol. 15:387–407. 2018. View Article : Google Scholar : PubMed/NCBI

6 

Maillet M, Van Berlo JH and Molkentin JD: Molecular basis of physiological heart growth: Fundamental concepts and new players. Nat Rev Mol Cell Biol. 14:38–48. 2013. View Article : Google Scholar

7 

Gali-Muhtasib H, Roessner A and Schneider-Stock R: Thymoquinone: A promising anti-cancer drug from natural sources. Int J Biochem Cell Biol. 38:1249–1253. 2006. View Article : Google Scholar

8 

Darakhshan S, Bidmeshki Pour A, Hosseinzadeh Colagar A and Sisakhtnezhad S: Thymoquinone and its therapeutic potentials. Pharmacol Res. 95-96:138–158. 2015. View Article : Google Scholar : PubMed/NCBI

9 

Woo CC, Kumar AP, Sethi G and Tan KH: Thymoquinone: Potential cure for inflammatory disorders and cancer. Biochem Pharmacol. 83:443–451. 2012. View Article : Google Scholar

10 

Mialet-Perez J and Vindis C: Autophagy in health and disease: Focus on the cardiovascular system. Essays Biochem. 61:721–732. 2017. View Article : Google Scholar : PubMed/NCBI

11 

Xue R, Zeng J, Chen Y, Chen C, Tan W, Zhao J, Dong B, Sun Y, Dong Y and Liu C: Sestrin 1 ameliorates cardiac hypertrophy via autophagy activation. J Cell Mol Med. 21:1193–1205. 2017. View Article : Google Scholar : PubMed/NCBI

12 

Yang K, Long Q, Saja K, Huang F, Pogwizd SM, Zhou L, Yoshida M and Yang Q: Knockout of the ATPase inhibitory factor 1 protects the heart from pressure overload-induced cardiac hypertrophy. Sci Rep. 7:105012017. View Article : Google Scholar : PubMed/NCBI

13 

Kelly DP: PPARs of the heart: Three is a crowd. Circ Res. 92:482–484. 2003. View Article : Google Scholar : PubMed/NCBI

14 

Majdalawieh A and Ro HS: PPARgamma1 and LXRalpha face a new regulator of macrophage cholesterol homeostasis and inflammatory responsiveness, AEBP1. Nucl Recept Signal. 8:e0042010. View Article : Google Scholar : PubMed/NCBI

15 

Kung J and Henry RR: Thiazolidinedione safety. Expert Opin Drug Saf. 11:565–579. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Peng Y, Wang L, Zhang Z, He X, Fan Q, Cheng X, Qiao Y, Huang H, Lai S, Wan Q, et al: Puerarin activates adaptive autophagy and protects the myocardium against doxorubicin-induced cardiotoxicity via the 14-3-3γ/PKCε pathway. Biomed Pharmacother. 153:1134032022. View Article : Google Scholar

17 

Cheng Y, Shen A, Wu X, Shen Z, Chen X, Li J, Liu L, Lin X, Wu M, Chen Y, et al: Qingda granule attenuates angiotensin II-induced cardiac hypertrophy and apoptosis and modulates the PI3K/AKT pathway. Biomed Pharmacother. 133:1110222021. View Article : Google Scholar : PubMed/NCBI

18 

He H, Wang L, Qiao Y, Yang B, Yin D and He M: Epigallocatechin-3-gallate pretreatment alleviates doxorubicin-induced ferroptosis and cardiotoxicity by upregulating AMPKα2 and activating adaptive autophagy. Redox Biol. 48:1021852021. View Article : Google Scholar

19 

Lu Q, Hu S, Guo P, Zhu X, Ren Z, Wu Q and Wang X: PPAR-γ with its anti-fibrotic action could serve as an effective therapeutic target in T-2 toxin-induced cardiac fibrosis of rats. Food Chem Toxicol. 152:1121832021. View Article : Google Scholar

20 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar

21 

Rockman HA, Ross RS, Harris AN, Knowlton KU, Steinhelper ME, Field LJ, Ross J Jr and Chien KR: Segregation of atrial-specific and inducible expression of an atrial natriuretic factor transgene in an in vivo murine model of cardiac hypertrophy. Proc Natl Acad Sci USA. 88:8277–8281. 1991. View Article : Google Scholar : PubMed/NCBI

22 

Chen H, Zhuo C, Zu A, Yuan S, Zhang H, Zhao J and Zheng L: Thymoquinone ameliorates pressure overload-induced cardiac hypertrophy by activating the AMPK signalling pathway. J Cell Mol Med. 26:855–867. 2022. View Article : Google Scholar

23 

Ji YX, Zhang P, Zhang XJ, Zhao YC, Deng KQ, Jiang X, Wang PX, Huang Z and Li H: The ubiquitin E3 ligase TRAF6 exacerbates pathological cardiac hypertrophy via TAK1-dependent signalling. Nat Commun. 7:112672016. View Article : Google Scholar : PubMed/NCBI

24 

Li HH, Kedar V, Zhang C, McDonough H, Arya R, Wang DZ and Patterson C: Atrogin-1/muscle atrophy F-box inhibits calcineurin-dependent cardiac hypertrophy by participating in an SCF ubiquitin ligase complex. J Clin Invest. 114:1058–1071. 2004. View Article : Google Scholar : PubMed/NCBI

25 

Xie X, Bi HL, Lai S, Zhang YL, Li N, Cao HJ, Han L, Wang HX and Li HH: The immunoproteasome catalytic β5i subunit regulates cardiac hypertrophy by targeting the autophagy protein ATG5 for degradation. Sci Adv. 5:eaau04952019. View Article : Google Scholar

26 

Gyöngyösi M, Winkler J, Ramos I, Do QT, Firat H, McDonald K, González A, Thum T, Díez J, Jaisser F, et al: Myocardial fibrosis: Biomedical research from bench to bedside. Eur J Heart Fail. 19:177–191. 2017. View Article : Google Scholar : PubMed/NCBI

27 

Bacmeister L, Schwarzl M, Warnke S, Stoffers B, Blankenberg S, Westermann D and Lindner D: Inflammation and fibrosis in murine models of heart failure. Basic Res Cardiol. 114:192019. View Article : Google Scholar : PubMed/NCBI

28 

Doroszko A, Dobrowolski P, Radziwon-Balicka A and Skomro R: New insights into the role of oxidative stress in onset of cardiovascular disease. Oxid Med Cell Longev. 2018:95638312018. View Article : Google Scholar : PubMed/NCBI

29 

Li Z, Song Y, Liu L, Hou N, An X, Zhan D, Li Y, Zhou L, Li P, Yu L, et al: miR-199a impairs autophagy and induces cardiac hypertrophy through mTOR activation. Cell Death Differ. 24:1205–1213. 2017. View Article : Google Scholar :

30 

Simonson B, Subramanya V, Chan MC, Zhang A, Franchino H, Ottaviano F, Mishra MK, Knight AC, Hunt D, Ghiran I, et al: DDiT4L promotes autophagy and inhibits pathological cardiac hypertrophy in response to stress. Sci Signal. 10:eaaf59672017. View Article : Google Scholar : PubMed/NCBI

31 

Obsil T and Obsilova V: Structural basis of 14-3-3 protein functions. Semin Cell Dev Biol. 22:663–672. 2011. View Article : Google Scholar : PubMed/NCBI

32 

Wu W, Yang B, Qiao Y, Zhou Q, He H and He M: Kaempferol protects mitochondria and alleviates damages against endotheliotoxicity induced by doxorubicin. Biomed Pharmacother. 126:1100402020. View Article : Google Scholar : PubMed/NCBI

33 

Diebold I, Hennigs JK, Miyagawa K, Li CG, Nickel NP, Kaschwich M, Cao A, Wang L, Reddy S, Chen PI, et al: BMPR2 preserves mitochondrial function and DNA during reoxygenation to promote endothelial cell survival and reverse pulmonary hypertension. Cell Metab. 21:596–608. 2015. View Article : Google Scholar : PubMed/NCBI

34 

Caglayan E, Stauber B, Collins AR, Lyon CJ, Yin F, Liu J, Rosenkranz S, Erdmann E, Peterson LE, Ross RS, et al: Differential roles of cardiomyocyte and macrophage peroxisome proliferator-activated receptor gamma in cardiac fibrosis. Diabetes. 57:2470–2479. 2008. View Article : Google Scholar : PubMed/NCBI

35 

Duan SZ, Ivashchenko CY, Russell MW, Milstone DS and Mortensen RM: Cardiomyocyte-specific knockout and agonist of peroxisome proliferator-activated receptor-gamma both induce cardiac hypertrophy in mice. Circ Res. 97:372–379. 2005. View Article : Google Scholar : PubMed/NCBI

36 

Li T, Guo R, Zong Q and Ling G: Application of molecular docking in elaborating molecular mechanisms and interactions of supramolecular cyclodextrin. Carbohydr Polym. 276:1186442022. View Article : Google Scholar

37 

Oka T, Akazawa H, Naito AT and Komuro I: Angiogenesis and cardiac hypertrophy: Maintenance of cardiac function and causative roles in heart failure. Circ Res. 114:565–571. 2014. View Article : Google Scholar : PubMed/NCBI

38 

Zhang C, Liu J, Pan H, Yang X and Bian K: Mitochondrial dysfunction induced by excessive ROS/RNS-metabolic cardiovascular disease and traditional Chinese medicines intervention. Zhongguo Zhong Yao Za Zhi. 36:2423–2428. 2011.In Chinese. PubMed/NCBI

39 

Liu BY, Li L, Liu GL, Ding W, Chang WG, Xu T, Ji XY, Zheng XX, Zhang J and Wang JX: Baicalein attenuates cardiac hypertrophy in mice via suppressing oxidative stress and activating autophagy in cardiomyocytes. Acta Pharmacol Sin. 42:701–714. 2021. View Article : Google Scholar :

40 

Gao M, Hu F, Hu M, Hu Y, Shi H, Zhao GJ, Jian C, Ji YX, Zhang XJ, She ZG, et al: Sophoricoside ameliorates cardiac hypertrophy by activating AMPK/mTORC1-mediated autophagy. Biosci Rep. 40:BSR202006612020. View Article : Google Scholar : PubMed/NCBI

41 

Li MH, Zhang YJ, Yu YH, Yang SH, Iqbal J, Mi QY, Li B, Wang ZM, Mao WX, Xie HG and Chen SL: Berberine improves pressure overload-induced cardiac hypertrophy and dysfunction through enhanced autophagy. Eur J Pharmacol. 728:67–76. 2014. View Article : Google Scholar : PubMed/NCBI

42 

Togliatto G, Lombardo G and Brizzi MF: The future challenge of reactive oxygen species (ROS) in hypertension: From bench to bed side. Int J Mol Sci. 18:19882017. View Article : Google Scholar : PubMed/NCBI

43 

Dhalla AK, Hill MF and Singal PK: Role of oxidative stress in transition of hypertrophy to heart failure. J Am Coll Cardiol. 28:506–514. 1996. View Article : Google Scholar : PubMed/NCBI

44 

Qin F, Lennon-Edwards S, Lancel S, Biolo A, Siwik DA, Pimentel DR, Dorn GW, Kang YJ and Colucci WS: Cardiac-specific overexpression of catalase identifies hydrogen peroxide-dependent and -independent phases of myocardial remodeling and prevents the progression to overt heart failure in G(alpha)q-overexpressing transgenic mice. Circ Heart Fail. 3:306–313. 2010. View Article : Google Scholar

45 

Liu C, Wu QQ, Cai ZL, Xie SY, Duan MX, Xie QW, Yuan Y, Deng W and Tang QZ: Zingerone attenuates aortic banding-induced cardiac remodelling via activating the eNOS/Nrf2 pathway. J Cell Mol Med. 23:6466–6478. 2019. View Article : Google Scholar : PubMed/NCBI

46 

Yang Z and Klionsky DJ: Eaten alive: A history of macroautophagy. Nat Cell Biol. 12:814–822. 2010. View Article : Google Scholar : PubMed/NCBI

47 

Hansen M, Rubinsztein DC and Walker DW: Autophagy as a promoter of longevity: Insights from model organisms. Nat Rev Mol Cell Biol. 19:579–593. 2018. View Article : Google Scholar : PubMed/NCBI

48 

Sun M, Ouzounian M, de Couto G, Chen M, Yan R, Fukuoka M, Li G, Moon M, Liu Y, Gramolini A, et al: Cathepsin-L ameliorates cardiac hypertrophy through activation of the autophagy-lysosomal dependent protein processing pathways. J Am Heart Assoc. 2:e0001912013. View Article : Google Scholar : PubMed/NCBI

49 

Kabeya Y, Mizushima N, Ueno T, Yamamoto A, Kirisako T, Noda T, Kominami E, Ohsumi Y and Yoshimori T: LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. EMBO J. 19:5720–5728. 2000. View Article : Google Scholar : PubMed/NCBI

50 

Drosatos K, Khan RS, Trent CM, Jiang H, Son NH, Blaner WS, Homma S, Schulze PC and Goldberg IJ: Peroxisome proliferator-activated receptor-γ activation prevents sepsis-related cardiac dysfunction and mortality in mice. Circ Heart Fail. 6:550–562. 2013. View Article : Google Scholar : PubMed/NCBI

51 

Desvergne B and Wahli W: Peroxisome proliferator-activated receptors: Nuclear control of metabolism. Endocr Rev. 20:649–688. 1999.PubMed/NCBI

52 

Herrmann JE, Heale J, Bieraugel M, Ramos M, Fisher RL and Vickers AE: Isoproterenol effects evaluated in heart slices of human and rat in comparison to rat heart in vivo. Toxicol Appl Pharmacol. 274:302–312. 2014. View Article : Google Scholar

53 

Yang J, Liu Y, Fan X, Li Z and Cheng Y: A pathway and network review on beta-adrenoceptor signaling and beta blockers in cardiac remodeling. Heart Fail Rev. 19:799–814. 2014. View Article : Google Scholar

54 

Yamaguchi O: Autophagy in the heart. Circ J. 83:697–704. 2019. View Article : Google Scholar : PubMed/NCBI

55 

He H, Luo Y, Qiao Y, Zhang Z, Yin D, Yao J, You J and He M: Curcumin attenuates doxorubicin-induced cardiotoxicity via suppressing oxidative stress and preventing mitochondrial dysfunction mediated by 14-3-3γ. Food Funct. 9:4404–4418. 2018. View Article : Google Scholar : PubMed/NCBI

56 

Chen X, Peng X, Luo Y, You J, Yin D, Xu Q, He H and He M: Quercetin protects cardiomyocytes against doxorubicin-induced toxicity by suppressing oxidative stress and improving mitochondrial function via 14-3-3γ. Toxicol Mech Methods. 29:344–354. 2019. View Article : Google Scholar : PubMed/NCBI

57 

Chen H, Tan H, Wan J, Zeng Y, Wang J, Wang H and Lu X: PPAR-γ signaling in nonalcoholic fatty liver disease: Pathogenesis and therapeutic targets. Pharmacol Ther. 245:1083912023. View Article : Google Scholar

58 

Botta M, Audano M, Sahebkar A, Sirtori CR, Mitro N and Ruscica M: PPAR agonists and metabolic syndrome: An established role? Int J Mol Sci. 19:11972018. View Article : Google Scholar : PubMed/NCBI

59 

NiX X, Li XY, Wang Q and Hua J: Regulation of peroxisome proliferator-activated receptor-gamma activity affects the hepatic stellate cell activation and the progression of NASH via TGF-β1/Smad signaling pathway. J Physiol Biochem. 77:35–45. 2021. View Article : Google Scholar

60 

Deng W, Meng Z, Sun A and Yang Z: Pioglitazone suppresses inflammation and fibrosis in nonalcoholic fatty liver disease by down-regulating PDGF and TIMP-2: Evidence from in vitro study. Cancer Biomark. 20:411–415. 2017. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Qiu R, Zhao S, Xu Z, Hu L, Zeng R, Qiu Z, Peng H, Zhou L, Cao Y, Wan L, Wan L, et al: Thymoquinone mitigates cardiac hypertrophy by activating adaptive autophagy via the PPAR‑&gamma;/14‑3‑3&gamma; pathway. Int J Mol Med 55: 59, 2025.
APA
Qiu, R., Zhao, S., Xu, Z., Hu, L., Zeng, R., Qiu, Z. ... Wan, L. (2025). Thymoquinone mitigates cardiac hypertrophy by activating adaptive autophagy via the PPAR‑&gamma;/14‑3‑3&gamma; pathway. International Journal of Molecular Medicine, 55, 59. https://doi.org/10.3892/ijmm.2025.5500
MLA
Qiu, R., Zhao, S., Xu, Z., Hu, L., Zeng, R., Qiu, Z., Peng, H., Zhou, L., Cao, Y., Wan, L."Thymoquinone mitigates cardiac hypertrophy by activating adaptive autophagy via the PPAR‑&gamma;/14‑3‑3&gamma; pathway". International Journal of Molecular Medicine 55.4 (2025): 59.
Chicago
Qiu, R., Zhao, S., Xu, Z., Hu, L., Zeng, R., Qiu, Z., Peng, H., Zhou, L., Cao, Y., Wan, L."Thymoquinone mitigates cardiac hypertrophy by activating adaptive autophagy via the PPAR‑&gamma;/14‑3‑3&gamma; pathway". International Journal of Molecular Medicine 55, no. 4 (2025): 59. https://doi.org/10.3892/ijmm.2025.5500
Copy and paste a formatted citation
x
Spandidos Publications style
Qiu R, Zhao S, Xu Z, Hu L, Zeng R, Qiu Z, Peng H, Zhou L, Cao Y, Wan L, Wan L, et al: Thymoquinone mitigates cardiac hypertrophy by activating adaptive autophagy via the PPAR‑&gamma;/14‑3‑3&gamma; pathway. Int J Mol Med 55: 59, 2025.
APA
Qiu, R., Zhao, S., Xu, Z., Hu, L., Zeng, R., Qiu, Z. ... Wan, L. (2025). Thymoquinone mitigates cardiac hypertrophy by activating adaptive autophagy via the PPAR‑&gamma;/14‑3‑3&gamma; pathway. International Journal of Molecular Medicine, 55, 59. https://doi.org/10.3892/ijmm.2025.5500
MLA
Qiu, R., Zhao, S., Xu, Z., Hu, L., Zeng, R., Qiu, Z., Peng, H., Zhou, L., Cao, Y., Wan, L."Thymoquinone mitigates cardiac hypertrophy by activating adaptive autophagy via the PPAR‑&gamma;/14‑3‑3&gamma; pathway". International Journal of Molecular Medicine 55.4 (2025): 59.
Chicago
Qiu, R., Zhao, S., Xu, Z., Hu, L., Zeng, R., Qiu, Z., Peng, H., Zhou, L., Cao, Y., Wan, L."Thymoquinone mitigates cardiac hypertrophy by activating adaptive autophagy via the PPAR‑&gamma;/14‑3‑3&gamma; pathway". International Journal of Molecular Medicine 55, no. 4 (2025): 59. https://doi.org/10.3892/ijmm.2025.5500
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team