This article is mentioned in:

Introduction

Colorectal cancer (CRC) is one of the highest incidence cancers worldwide (1). In the US, CRC is the fourth most common cancer in men and women (1) and approximately 3,000 new cases are diagnosed annually both in the Jewish male and female population (2–4). It is uncommon in the non-Jewish (Arab) population. This is attributed to different genetic susceptibility and/or lifestyle and diet (2–4). Gene mutation or genetic variations, whether it is at the single nucleotide polymorphism (SNP) or structural level, could also contribute to the development of CRC as shown in a number of Genome Wide Association (GWAS) and related studies (5–9). The glycosylphosphatidylinositol transamidase (GPIT) complex is a family of proteins that assists in attaching a diverse group of macromolecules to the plasma membrane of eukaryotes (10). The GPIT complex is composed of 5 subunits namely PIGU, PIGT, GPAA1, PIGS and PIGK (10). Among these 5 subunits, PIGK (GPI8) plays a crucial role in protein-GPI anchoring (10,11). It is well established that PIGK catalyzes the endoproteolysis and amidation steps involved in transfer of GPI to proteins (10). However, the role of PIGK in tumorigenesis remains largely unknown. Recently, we reported a low expression of PIGK protein in some CRC, hepatocellular (HCC) and urothelial cell carcinoma (UCC) patients (11). We hypothesize that the altered expression of PIGK could be due to mutation in the coding regions of this gene. As a pilot study, we examined all 10 exons of the PIGK gene in 45 CRC patients by direct sequencing. Immunohistochemistry was performed on the same 45 CRC patients to examine corresponding protein expression. We did not detect any mutation in the exons, but a SNP (C/C→C/G or G/G; rs1048575) was found in the 3′UTR immediately after the stop codon of the PIGK gene in 67% (30/45) of the samples. We also observed a significantly low (P<0.002) expression of PIGK protein in all patients with the altered alleles (C/G or G/G) compared to the ancestral alleles (C/C). Similar observations were made on PIGK expression in a several transformed human colon cell lines with the ancestral (C/C) and altered (C/G) genotype. These results suggest an association between SNP-1048575 and low PIGK expression in CRC patients.

Materials and methods

Patient history and tissue samples

Matched adjacent normal and tumor tissues from 45 CRC patients and the HCC samples were collected at the Johns Hopkins University (JHU) as per IRB approved protocol. Formalin-fixed paraffin-embedded (FFPE) tumor tissue sections (5 μm) were procured from all 45 CRC patients for immunohistochemical (IHC) analysis. All the subsequent analysis of tissue samples, IHC staining was performed at JHU. Detailed patient information is shown in Table I.

Table I Colorectal cancer patients with the PIGK genotype and corresponding PIGK protein expression.

Table I

Colorectal cancer patients with the PIGK genotype and corresponding PIGK protein expression.

Patient ID	Genotype	Stage	PIGK expressiona
C592	CC	IV	+++
C127	CC	IV	+++
C758	CC	I	+++
C358	CC	IIA	+++
C155	CC	IIA	+++
C277	CC	I	+++
C193	CC	IIB	+++
C410	C/G	IIIB	+
C307	C/G	IIIB	++
C183	C/G	III	++
C301	C/G	IIA	+
C345	C/G	IIIC	+
C374	C/G	IIIA	+
C330	C/G	IIA	+
C217	C/G	IIA	-
C206	C/G	IIIB	+
C485	C/G	IIIB	++
C80	C/G	IV	+
C123	C/G	IIA	+
C414	G/G	III	+
C918	CC	III	+
C850	C/G	III	-
C870	C/G	IV	++
C1015	C/G	IV	+
C998	C/G	IV	++
C1023	CC	-	+++
C1025	C/G	III	+
C863	CC	V	+
C837	CC	-	+++
C1014	C/G	IV	+
C1021	C/G	IV	+
C1003	C/G	IV	++
C968	C/G	-	++
C1032	C/G	-	++
C989	C/G	-	++
C980	C/G	IV	+
C990	C/G	II	+++
C947	C/G	IV	+
C935	C/G	IV	+
C804	CC		+++
C1019	C/G	III	+
C1017	CC	I	+++
C1002	C/G	III	+
C1016	CC	II	+++
C866	CC	I	+++

a PIGK expression was scored as described under Materials and methods.

Cell lines

We obtained 2 human non-tumorigenic colonic cell lines; CCD841 and FHC and two hepatocellular carcinoma (HCC) lines H2pG2 and Hep3B from ATCC. All cell lines were cultured in ATCC recommended medium. The cell lines were periodically chacked for mycoplasma contamination using Mycoplasma Detection kit from Sigma (MP-0025). The tissue culture media and reagents were purchased either from ATCC or Invitrogen.

DNA extraction and PIGK exon sequencing

Genomic DNA was extracted from the microdissected tumor and normal tissue samples and cell lines as described (12). The list of primers is given in Table II. The PCR was carried out in a 50 μl reaction volume with the conditions as follows: 95°C for 5 min, 1 cycle; 94°C for 30 sec, 55°C for 30 sec, 72°C for 7 min, 40 cycles; and final extension at 72°C for 10 min. All amplified products were analyzed on 1% agarose gels, cut, purified and sequenced using the ABI Big Dye Cycle Sequencing kit (Applied Biosystems). All experiments were carried out at JHU.

Table II The primers used to amplify the 10 exons of the human PIGK gene.

Table II

The primers used to amplify the 10 exons of the human PIGK gene.

Exon	Forward	Reverse
1	GGATCAAGCAGAACAATTCTTTA	CATATCTAATGTGAACAGCAAGGT
2	TCAGGTGTGTACATCCCGATT	TTACCTGTCAGGAATACCTAGCCTCT
3	TTTTTCCCTAGTCACATTGTCC	TACCTCGTAACTTCTATAATCCACTTC
4	CCCCCTTAGGTAACTGTGGA	TTCCATTTGCCTTTCTTTTCA
5	ACAAGGGCATGGTGGAAAT	ACCGTCTTTTCTGCCACATT
6	TCATTTTTCTTTCAGCTACAATGAG	ACAAATGGGGAAAATGCACA
7	TTTTTCCCCCTTTCCATAGC	CAAATCAAGTGAATACTTACAAGGTCA
8	GCATTTATTATTATATATTT	GAGACTAGTATTCTATTC
9	TTTTCCAGCTATAAGGAAGACCA	AAATGAAATGCAAACCTGGTG
10-P1a	GCAGAAACCGAAGCTGAAAG	CCAAGTTTGCAGTCCTCCAT
P2	TTGCTGCCTGCCCTATTTAC	TTTCACAGCACATTTCCAAAA
P3	TTTTGACTCCTGTGTTTCTGGA	ACACTGAAGCAATAAGGCCAAT
P4	TAATGATGCCATCCTGCAAA	ATGCTTCTTGTGGGAATCATC
P5	GCCTTTCTCACAGTGTTGTGG	TGGGGGAGGAGAAAAAGAAC
P6	GCGGAGCTATTTAGGGTGGT	AGGAACAACTGCCCTTTGAA
P7	GCTTTTTGCCAGCTCTGAAT	GGGCAACATGGTCAATCTTT

a A total of 7 pairs of primers were used to amply and cover the entire exon 10 of PIGK gene.

Genotyping assay for SNP rs1048575

TaqMan™ (Fluorogenic 5′ nuclease) assay was used for typing our candidate SNP (rs1048575). The forward and reverse primers and respective allele-specific probes were obtained from Applied Biosystems (Applied Biosystems). PCR was conducted in ABI 9700 thermocycler, and the end-point results were auto-scored using the ABI 7900HT Sequence Detection System (SDS; version 2.3). To ensure reliability of genotyping data, each of the samples were amplified and genotyped in triplicate along with positive and negative control templates. Additionally, all the samples were sequenced unidirectionally, and there was 100% concordance between sequencing and genotyping data obtained through the TaqMan genotyping assay. All experiments were carried out at JHU.

Immunohistochemistry

To study the expression of PIGK protein, we used FFPE tissue samples collected from 45 samples described in Table I. Several serial sections (5 μm) from different regions of the tumors were stained using rabbit anti-human PIGK antibody (Abcam #38445) for determining protein expression. Staining and evaluation was performed as described earlier (13,14). For comparison, all sections were processed in parallel. All experiments were carried out at JHU.

PIGK constructs and transfection

The wild-type (wt, C/C) human PIGK gene was subcloned into SalI and NotI sites of the phosphorylated cytomegalovirus (pCMV)/myc/ER plasmid (Invitrogen) to express the exogenous protein in the endoplasmic reticulum (ER) as PIGK is localized and functions in the ER (10). The resultant plasmids were resequenced using the ABI BigDye cycle sequencing kit (Applied Biosystems) for verification of the insert sequences. An empty pCMV/myc/ER and a Green Fluorescence Protein (GFP) expressing pCMV/myc/ER-GFP plasmids were also used as controls. In transfections, HepG2 and Hep3B cells were transiently transfected with wt-PIGK plasmid in the presence of the FuGene 6 transfection reagent (Roche Applied Science). An empty pCMV/myc/ER vector was used for mock transfection. We also used GFP expressing pCMV/myc/ER plasmid vector as a control. Cells were analyzed 24 h post transfection. Positive cell clones were confirmed to express wt-PIGK by immunofluorescence analysis using the fusion protein tag anti-myc-FITC antibody (Invitrogen).

Reverse-transcription PCR

Total RNA was extracted from wt-PIGK transfected and non-transfected Hep3B cells after 24 h using Qiazol reagent following the manufacturer’s instruction (Qiagen). Conventional RT-PCR was carried out in 50 μl reaction volume as described earlier (14). The primers used for PIGK were forward 5′-CCACTTTGCCTTTCTCTCCA-3′; reverse 5′-GCCCCATTCAGATCCTCTTC-3′.

Statistical analysis

χ2 or Fisher’s exact tests were used as appropriate. Student’s t-test or non-parametric Wilcoxon rank sum test was also used as appropriate. All p-values are two-sided and all confidence intervals are at the 95% level. Computations for all the analysis were performed using the Statistical Analysis System (SAS).

Results

Distribution of SNP 1048575 among the CRC patients

In an earlier study, we observed a low expression of PIGK protein in tumors compared to paired normal tissues of some CRC patients (11). We hypothesized that such low expression could be due to mutation in the coding regions of the PIGK gene. Therefore in this pilot study, we examined all 10 exons of the PIGK gene by direct sequencing in 45 primary CRC tumors. No mutations were detected in the coding regions, however, we discovered a SNP (rs1048575; C/C→C/G or G/G) in the 3′UTR of the PIGK gene in 67% (30/45) of the CRC patients (Table I and Fig. 1). Schematic representation of the location of the ancestral and altered allele in PIGK is shown in Fig. 2. This observation was further confirmed by genotyping the SNP-1048575 in all the above samples (Table I, Fig. 1B). Of the 45 CRC patients, 26 were of Jewish and 17 were of Arabian origin. The ethnicity of the remainder of the 3 patients was unknown. Eighty-five percent (22/26) of the Jewish patients showed the altered alleles (C/G or G/G) whereas 47% (8/17) of the Arabian patient populations was detected with the altered alleles (Table I, Fig. 1A and B). The number of Jewish patients with the altered alleles was significantly higher (Student’s t-test; p=0.03) compared to the Arabian patient populations.

Figure 1 Distribution of the SNP-1048575 allele and PIGK expression in CRC patients. (A) Distribution of the SNP-1048575 allele in the CRC patients determined by DNA sequencing. Presence of altered allele (C/G) is indicated by an asterisk. (B) Genotyping of the SNP-1048575 allele in CRC patients. The distribution pattern (C/C, C/G or G/G) is indicated in the allelic discrimination plot. (C) Significantly low (P<0.002) expression of corresponding PIGK protein in CRC patients with altered (C/G) alleles compared to the patients with the ancestral (C/C) alleles (indicated by arrows). T, tumor.

Figure 2 Schematic representation of the location of SNP-1048575 at the 3′UTR of the PIGK gene. The ancestral allele (C) is shown in red whereas the altered allele (G) in blue at the 3′UTR (blue square indicated by an arrow). The SNP-1048575 is located immediately after the stop codon (TAG) as indicated. E, exon.

Association between SNP-1048575 and PIGK protein expression in CRC patients

To examine whether there was any correlation between the altered alleles (C/G, G/G) and PIGK protein expression in the CRC patients, we performed IHC on FFPE tissue sections from all 45 CRC patients. The expression of PIGK protein was significantly lower (p<0.002) in all of the patients with altered genotype (C/G or G/G; 30/45, 67%) compared to the ancestral genotype (C/C; 15/45, 33%) (Table I and Fig. 1C).

Association between SNP-1048575 and PIGK protein expression in transformed colon cell lines

We also determined the SNP-1048575 allele distribution and corresponding PIGK expression in a couple of transformed colon cell lines. One colon line (CCD841) exhibited the ancestral alleles (C/C), whereas the other line (FHC) exhibited the altered alleles (C/G) (Fig. 3A). Immunohistochemical analysis also revealed a significantly lower (Student’s t-test, p<0.002) expression of the PIGK protein in the FHC-colon line carrying the altered alleles (C/G) compared to the CCD-841 cell line with the ancestral alleles (C/C) (Fig. 3B).

Figure 3 Distribution of SNP-1048575 allele and PIGK expression in transformed colon cell lines. (A) Distribution pattern of SNP-1048575 allele in CCD841 and FHC colon cell lines. Presence of altered allele (C/G) is indicated by an asterisk. (B) Expression of PIGK protein in FHC cell line with altered allele (C/G) is significantly low (P<0.002) compared to the CCD841 cell line with ancestral alleles (C/C).

Association between SNP-1048575 and PIGK protein expression in HCC patients and cell lines

Similar to the CRC patients, our earlier study also demonstrated a low expression of PIGK in some primary HCC tumors (11). Therefore, we also examined 5 HCC patients and two HCC cell lines (Hep3B and HepG2) for PIGK genotype (SNP-1048575) and corresponding protein expression. We observed altered alleles (C/G or G/G) (Fig. 4A) and corresponding low PIGK protein expression (Fig. 4B) in 4 out of 5 (80%) primary HCC tumors. Among the HCC cell lines, HepG2 line exhibited ancestral C/C alleles, whereas Hep3B showed altered C/G alleles (Fig. 4C, upper panel). Similar to the HCC patients, Hep3B line with the altered alleles (C/G) exhibited significantly low (Student’s t-test, P<0.002) PIGK protein expression compared to the Hep3B line carrying the ancestral (C/C) alleles (Fig. 4C, lower panel).

Figure 4 Distribution of SNP-1048575 allele and PIGK expression in HCC patients. (A) Distribution of SNP-1048575 allele in the HCC patients. The distribution pattern (C/C, C/G or G/G) is indicated in the allelic discrimination plot. (B) Expression of PIGK protein is significantly low (P<0.002) in HCC patients with altered (C/G, HCC5) alleles compared to the patients with the ancestral (C/C, HCC3) alleles. (C) Distribution pattern of SNP-1048575 allele in HepG2 and Hep3B liver cancer cell lines (upper panel) determined by DNA sequencing. Presence of altered allele (C/G) is indicated by asterisk. Expression of PIGK protein is significantly low (P<0.002) in Hep3B line with altered (C/G) alleles compared to HepG2 cell line with ancestral (C/C) alleles (lower panel). (D) Exogenously expressed wild-type PIGK protein (PIGK-wt) was detectable in the HepG2 cells but not Hep3B cells (upper panel). Control GFP proteins were detectable in both the cell types using the same expression cassette. The PIGK-wt gene was not detected at the mRNA level in Hep3B cells. ACTIN was used as a control. T, transfected; NT, mock transfected.

Forced overexpression of wild-type PIGK in liver cancer cell lines

To examine the exogenous PIGK protein expression status, we transiently transfected both HepG2 (C/C alleles) and Hep3B (C/G alleles) cell lines with wt-PIGK constructs. As shown in Fig. 4D (upper panel), we could detect exogenously expressed PIGK protein in HepG2 (C/C) cells, but no PIGK expression was detectable in Hep3B (C/G) cells. The control GFP protein was detectable in both cell lines using the same expression cassette. We also examined the mRNA expression level of the exogenously expressed wt-PIGK in Hep3B (C/G) cells. As shown in Fig. 4D (lower panel), no mRNA expression was detected in Hep3B cells.

Discussion

The human PIGK gene is involved in the key step of transferring GPI-anchor to the respective protein molecules in the plasma membrane (10). However, its precise role in tumorigenesis remains poorly defined. In an earlier study, we observed a significantly low expression of the PIGK protein in some human CRC, HCC and UCC patients (11). Thus, we hypothesized that somatic mutation in the coding regions of PIGK might be associated with such low expression as shown for other genes in human cancers (15). Therefore, we examined the coding regions of the PIGK gene and corresponding protein expression in 45 CRC patients of both Jewish and Arabic ethnicity where CRC incidences are high, particularly among the Jewish population (2–4). No somatic mutations were detected in the coding regions of PIGK, but we discovered an SNP (rs1048575) located immediately after the stop codon at the 3′ UTR in a majority of the CRC patients with a concomitant decrease in PIGK protein expression. As per the HapMap database (16; http://www.ncbi.nlm.nih.gov), the altered SNP-1048575 was reported in different population with C allele (wild-type) being more frequent. However, no association of the altered allele G with any diseases has so far been reported. Our observation in CRC patients correlates well with the results obtained in a several transformed colon cell lines, further suggesting that altered PIGK expression may be an early event in colon carcinogenesis. In a recent study, 3′ UTR polymorphisms in the BRCA1 gene were shown to be associated with reduced gene activity and this alteration was proposed as a possible breast and ovarian cancer risk factor (17). Similar to the CRC patients, we observed altered alleles (C/G or G/G) and corresponding low PIGK protein expression in some HCC patients and cell lines. Moreover, by forced overexpression, wild-type PIGK protein was detectable in the HCC cell line HepG2 with the ancestral (C/C) alleles but not in Hep3B carrying the altered alleles (C/G). This could be a consequence of transcriptional deregulation of the PIGK gene as we could not detect the exogenously expressed PIGK mRNA. Another possible mechanism could be regulation of PIGK by potential micro-RNAs through perfect or imperfect complementarity mechanism(s) at the sites located within the 3′ UTR of this gene (18,19).

In summary, our results demonstrate for the first time a link between deregulated expression of PIGK and SNP-1048575 in CRC patients and also suggest a possible association between altered PIGK expression and CRC susceptibility.

Acknowledgements

The study was supported by a grant from Flight Attendant Medical Research Institute and Elsa U. Pardee Foundation to B. Trink; US-Egypt Joint Science and Technology fund (58-3148-169), A.D. Williams (646299) and Elsa U. Pardee Foundation (548424) to S. Dasgupta. PBF holds the Thelma Newmeyer Corman Chair in Cancer Research in the VCU Massey Cancer Center.

References