Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
May-2014 Volume 44 Issue 5

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2014 Volume 44 Issue 5

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Interleukin-6 promotes the migration and invasion of nasopharyngeal carcinoma cell lines and upregulates the expression of MMP-2 and MMP-9

  • Authors:
    • Wei Sun
    • Dong-Bo Liu
    • Wen-Wen Li
    • Lin-Li Zhang
    • Guo-Xian Long
    • Jun-Feng Wang
    • Qi Mei
    • Guo-Qing Hu
  • View Affiliations / Copyright

    Affiliations: Department of Oncology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Hubei, Wuhan 430030, P.R. China
  • Pages: 1551-1560
    |
    Published online on: March 5, 2014
       https://doi.org/10.3892/ijo.2014.2323
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Nasopharyngeal carcinoma (NPC) shows the highest invasive and metastatic features among head and neck cancers. Distant metastasis remains the predominant mode of treatment failure in NPC patients. The role of interleukin-6 (IL-6) in NPC progression is not fully understood. In this study, we explored whether IL-6 could promote the migration and invasion activity of NPC cell lines, as well as whether the effect of IL-6 on cell migration and invasion is mediated through regulating the expression of matrix metalloproteinase-2 (MMP-2) and MMP-9. Our results revealed that IL-6 and its receptors are broadly expressed in various NPC cell lines including HNE1, HONE1, CNE1, CNE1-LMP1 and 5-8F. Exogenous IL-6 enhanced cell proliferation slightly, but promoted cell migration and invasion significantly in both HNE1 and CNE1-LMP1 cell lines. In addition, an elevation in the expression of MMP-2 and MMP-9 could be induced by IL-6 stimulation. On the contrary, combining treatment with monoclonal anti-human IL-6R antibody (anti-IL-6R mAb) resulted in decreased proliferation, migration and invasion capabilities of NPC cells. Anti-IL-6R mAb also inhibited the expression of MMP-2 and MMP-9 in IL-6-stimulated HNE1 and CNE1-LMP1 cells. In summary, our data suggested that IL-6 mainly promotes the cell migration and invasion of NPC cells. The effect of IL-6 on cell migration and invasion may be mediated through regulation of the expression of MMP-2 and MMP-9. Thus, IL-6 or its related signaling pathways may be a promising target for preventing and inhibiting NPC metastasis.

Introduction

Nasopharyngeal carcinoma (NPC) is a widely prevalent head and neck cancer in Southern China (1). It is closely associated with Epstein-Barr virus (EBV) and shows highly invasive and metastatic features. At the time of diagnosis, ∼75% of patients present with regional lymph node metastasis and 10% present with distant metastasis (2,3). Radiotherapy with or without concurrent chemotherapy remains the standard treatment for NPC patients (4). Although improvements both in radiotherapy and chemotherapy have been achieved, distant metastasis still occurs and remains the major patterns of failure in patients with NPC (1,5). Therefore, a better understanding of the molecular mechanisms of NPC invasion and metastasis is helpful for improving the survival of NPC patients.

It is now generally accepted that inflammatory microenvironment plays critical roles in tumor development including the tumor initiation, promotion, invasion and metastasis (6,7). Interleukin-6 (IL-6), a multifunctional cytokine, has emerged as an important contributor to the tumor microenvironment. Many studies have shown that IL-6 is widely expressed and profoundly linked to poor prognosis in a large variety of malignant tumors (8–11). The biological effects of IL-6 are mediated through a membrane receptor complex that contains an IL-6-specific binding receptor (IL-6R) and a signal transducing receptor (glycoprotein-130, gp130). Briefly, IL-6 binds to IL-6R and triggers the dimerization and phosphorylation of gp130, leading to the activation of Janus tyrosine kinase (JAK). Then the subsequent signal-transduction pathways are activated, including the JAK/signal transducer and transcription activators (JAK/STATs), Ras/mitogen activated protein kinase (Ras/MAPK), and phosphoinositol-3 kinase/Akt (PI3K/ Akt) pathways (12,13). IL-6 and its related signaling pathways have been identified to contribute to proliferation, migration and invasion of various tumor cells (14–16).

Tumor invasion and metastasis result from a multi-step process that includes the degradation of surrounding extra-cellular matrix (ECM), allowing cancer cell spread to distal organs. Matrix metalloproteinases (MMPs) are a family of zinc-dependent proteinases whose enzymatic activity is directed against components of the extracellular matrix (ECM) (17). Two of these enzymes, MMP-2 (gelatinase A, 72 kDa) and MMP-9 (gelatinase B, 92 kDa) which selectively degrade type IV collagen, a major component of ECM, play a key role in the metastatic process. Multiple studies have suggested that MMP-2 and MMP-9 are implicated in the invasion, metastasis and poor prognosis of various cancers (18–21). The expression and activation of MMP-2 and MMP-9 can be regulated by environmental influences from surrounding stroma, such as the cytokines (22–25). In addition, IL-6 was found to be able to upregulate the expression of MMP-2 and MMP-9 in some cancer cells (26–28). These results indicated that targeting IL-6 may be an effective strategy to control tumor invasion and metastasis.

Clinical studies have shown that elevated serum IL-6 is closely associated with the distant metastasis of NPC patients (29,30). It has also been observed that MMP-2 and MMP-9 are linked to metastasis and poor prognosis of NPC (31–33). However, the role of IL-6 in modulating the migration and invasion activity of NPC cells is not fully understood. It is also not clear whether IL-6 can regulate the expression of MMP-2 and MMP-9 in NPC cells. So we performed this study to investigate whether IL-6 modulates NPC migration and invasion, as well as whether the effect of IL-6 is mediated through regulating the expression of MMP-2 and MMP-9.

Materials and methods

Reagents

The recombinant human IL-6 was purchased from PeproTech (Rocky Hill, NJ, USA). Mouse monoclonal anti-human IL-6R antibody (anti-IL-6R mAb) used for blocking IL-6 activity was obtained from Invitrogen Corp. (clone BR-6; Carlsbad, CA, USA). Primary antibodies including rabbit anti-human MMP-2, MMP-9 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) monoclonal antibodies were purchased from Epitomics (Burlingame, CA, USA). The horseradish peroxidase-conjugated goat anti-rabbit secondary antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The RNAiso Plus and PrimeScript™ 1st Strand cDNA Synthesis kit were obtained from Takara Biotechnology (Dalian, China). The 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT), ECM gel (E1270) and gelatin were obtained from Sigma (St. Louis, MO, USA).

Cell lines culture

The human NPC cell lines, including HNE1, HONE1, CNE1, CNE1-LMP1 and 5–8F, were obtained from the Cancer Research Institute of Central South University (Changsha, China). HNE1 and HONE1 were both derived from a poorly differentiated NPC and lost the EBV genome as cells were passaged (34,35). CNE1 was an EBV negative poorly differentiated cell line and CNE1-LMP1 was established by introducing the gene of latent membrane protein-1 (LMP1) into CNE1 cells (36). 5–8F was constructed from the NPC cell line SUNE-1 and stably expresses LMP1 (37,38). HNE1, HONE1 and CNE1-LMP1 were maintained in Roswell Park Memorial Institute (RPMI)-1640 medium (Gibco, Grand Island, NY, USA) with 10% newborn calf serum (Gibco), while CNE1 and 5–8F were cultured in RPMI-1640 medium containing 10% fetal bovine serum (Gibco). All cell lines were incubated at 37°C in a humidified atmosphere of 5% CO2.

RNA extraction, cDNA synthesis and reverse transcription-polymerase chain reaction (RT-PCR)

Cultured cells were harvested and washed with phosphate-buffered saline (PBS). Then total RNA was extracted using RNAiso Plus according to the manufacturer’s instructions. The RNA pellets were reconstituted in 20 μl of RNase-free water and stored at −80°C. RNA concentration and purity were assessed prior to cDNA synthesis. The first strand cDNA was synthesized using the PrimeScript 1st Strand cDNA Synthesis kit according to the manufacturer’s protocol. Polymerase chain reactions (PCR) were performed in a total volume of 20 μl, containing 10 μl 2X Taq PCR Master Mix, 1 μl of each primer, 1 μl cDNA template and 7 μl of sterile water. The amplification protocol consisted of an initial denaturation at 94°C for 5 min, followed by 35 cycles of denaturation for 30 sec at 94°C, annealing for 45 sec at 54°C and extension for 1 min at 72°C, followed by a final extension at 72°C for 10 min. The PCR products were verified by 1.0% agarose gel electrophoresis and analyzed using the Gel Doc™ XR Imaging System (Bio-Rad, Foster City, CA, USA). Primers for PCR were designed by Primer Premier 5.0 software (Premier Biosoft International, Palo Alto, CA, USA) and listed in Table I.

Table I.

Primer sequences used for RT-PCR.

Table I.

Primer sequences used for RT-PCR.

GeneSense primer (5′-3′)Antisense primer (5′-3′)Product (bp)
IL-6 AATGAGGAGACTTGCCTGGTGAA ACAATCTGAGGTGCCCATGCTAC340
IL-6R CAGTATTCCCAGGAGTCCCAGAAG CATCCATGTTGTGAATGTCTTTG312
gp130 GCAACATTCTTACATTCGGACAGC ATCCCTTACCATCTTCCTTCATACAGC618
GAPDH GGTCGGAGTCAACGGATTTG GGAAGATGGTGATGGGATTTC218
Enzyme-linked immunosorbent assay (ELISA)

Fresh medium (5 ml) was added to NPC cell lines when 60–70% confluent in 25 cm2 flasks. After 24 h cell culture supernatants were collected, aliquoted, and frozen at −80°C until assayed. Cells were trypsinized and counted, and all results were standardized for amount of IL-6 secreted as pg/ml/106 cells. The quantitation of IL-6 was performed using the human IL-6 ELISA kit according to the manufacturer’s instructions (Boster, Wuhan, China). Complete medium was used as a blank.

Cell proliferation assay

The effects of IL-6 with or without anti-IL-6R mAb on NPC cell proliferation were assessed using an MTT assay. Cells were seeded in 96-well plates at a density of 3×103 cells/well and allowed to attach for 12 h. Then the cells were treated by different concentrations of IL-6 (0, 10, 20 and 50 ng/ml) with or without anti-IL-6R mAb (1 μg/ml) for 24 h. After the incubation, the effects of IL-6 with or without anti-IL-6R mAb on cell proliferation were determined by a colorimetric assay using MTT.

Wound-healing migration assay

For the wound-healing migration assay, cells were seeded in 24-well plates and grown to confluent monolayer overnight. The monolayer was scratched straight with a fine 10 μl pipette tip, and cellular debris was removed by washing with PBS. Then the cells were incubated in serum-free medium containing different concentrations of IL-6 (0, 10 and 50 ng/ml) with or without anti-IL-6R mAb (1 μg/ml). Migration was visualized at the indicated times (0, 12, and 24 h) under a microscope (TE2000, Nikon). The migration distances were measured by ImageJ analysis software (National Institutes of Health, Bethesda, MD, USA).

Transwell migration and invasion assays

Migration and invasion assays were performed using Transwell 24-well plates with 8-μm diameter filters (Corning, NY, USA). For invasion assay, filters were precoated with 40 μl of diluted ECM gel for 4 h. The following procedures were the same for both migration and invasion assays. Approximately 1×105 cells in 200 μl of serum-free medium containing different concentrations of IL-6 (0, 10 and 50 ng/ml) with or without anti-IL-6R mAb (1 μg/ml) were placed in the upper chamber and 500 μl 10% newborn calf serum was placed in the lower chamber. The plates were incubated for 20–24 h, and then cells were fixed in methanol for 15 min and stained with 0.1% crystal violet for 15 min. Cells on the upper side of the filters were removed with a cotton swab, and the filters were washed with PBS. Cells on the under side of the filters were examined and counted under a microscope at ×200 magnification. Each experiment was repeated at least three times.

Western blot analysis

Following treatment, cells were washed with ice-cold PBS and lysed in lysis buffer (20 mmol/l Tris-HCl pH 7.5, 1% Na-deoxycholate, 1% Triton X-100, 150 mmol/l NaCl, and 1 mmol/l EDTA) on ice. The protein concentration was measured using bicinchoninic acid (BCA) protein assay kit according to the manufacturer’s instructions (Beyotime, Shanghai, China). The proteins were separated on SDS-PAGE and transferred to a polyvinylidene difluoride membrane (PVDF; Millipore, MA, USA). Immunoblots were performed by incubating PVDF membranes with 5% non-fat milk in TBST (Tris-buffered saline and 2.5% Tween-20) for 1 h at room temperature. Then each membrane was incubated with primary antibodies at 4°C for 20 h. After repeating washing with TBST, the membrane was incubated with secondary antibodies. Immunoblots were developed using enhanced chemiluminescence (ECL) detecting substrate (Pierce, Rockford, IL, USA). Images were captured with Micro-Chemi (DNR Bio-Imaging Systems, Israel), and the optical density of the bands was determined using ImageJ software.

Gelatin zymography analysis

The expression of activated MMPs in conditioned medium was detected by gelatin zymography. Cells were seeded in culture flasks and grown to 70–80% confluency. Then the cells were cultured in serum-free medium containing different concentrations of IL-6 (0, 10 and 50 ng/ml) with or without anti-IL-6R mAb (1 μg/ml) for 24 h. Afterwards the supernatants were collected and mixed with 4X SDS sample buffer without reducing agent or heating. The samples were loaded onto an SDS-polyacrylamide gel containing 0.1% (w/v) gelatin and subjected to electrophoresis. Following electrophoresis, the gel was washed with 2.5% Triton X-100 to remove SDS, and incubated with developing buffer (50 mM Tris-HCl buffer, pH 7.4, and 10 mM CaCl2) at 37°C for 40–48 h. Then gels were stained with 0.1% Coomassie Brilliant Blue R-250 (Invitrogen Corp.) for 4–6 h and washed with destaining solution until clear bands against an intensely stained background appeared.

Statistical analysis

SPSS software (version 19.0; SPSS, Inc., Chicago, IL, USA) was used to carry out the statistical analyses. All data are presented as mean ± standard deviations (SD). Statistical comparison was performed using Student’s t-test and P<0.05 was considered statistically significant.

Results

IL-6 and its receptors are expressed broadly in various NPC cell lines

Receptors involved in the recognition of IL-6 can be subdivided into two subunits, the IL-6R and gp130. While gp130 is ubiquitously expressed by cells, the expression of IL-6R is restricted in selected cells (12). As a consequence, the number of cells that respond to IL-6 is limited. Considering the relatively few studies which reported the IL-6 responsiveness of NPC cell lines, firstly we investigated NPC cell lines for the expression of IL-6 and its receptors. All tested NPC cell lines expressed mRNA for both IL-6 and its receptors though a few bands were faint in some cell lines (Fig. 1A). The IL-6 levels in NPC cell lines were also examined and they varied from 69.3 pg/ml/106 to 362.7 pg/ml/106 cells (Fig. 1B). As all tested cell lines expressed IL-6 and its receptors broadly, they were suitable to receive IL-6 stimulation. Given that HNE1 and CNE1-LMP1 had lower IL-6 levels and might be more sensitive to IL-6 exposure than other cell lines, we selected them for our subsequent experiments.

Figure 1.

Expression of IL-6 and its receptors in NPC cell lines. (A) RT-PCR analyses of IL-6, IL-6R and gp130 mRNA expression in HNE1, HONE1, CNE1, CNE1-LMP1 and 5–8F cell lines. The marker lines are 100 bp DNA ladder. (B) IL-6 secretion levels in HNE1, HONE1, CNE1, CNE1-LMP1 and 5–8F cell lines were examined by ELISA. Results are expressed as mean ± SD (n=3).

IL-6 promotes the proliferation of NPC cells

Cell proliferation experiments were performed with IL-6 added exogenously to NPC cell lines. When HNE1 treated with increasing concentrations of IL-6 (10, 20 and 50 ng/ml), the proliferation rate increased slightly with the level of 109, 112 and 116% of untreated cells, respectively (Fig. 2). As shown, the enhancing effect of IL-6 on CNE1-LMP1 proliferation was also weak. The most pronounced proliferation rate exerted by IL-6 (50 ng/ml) was only 117%. To test the specificity of IL-6 stimulation, we added the IL-6 receptor antagonist, anti-IL-6R mAb, to the culture medium to block IL-6-induced proliferation. The activity of IL-6 on cell proliferation in both HNE1 and CNE1-LMP1 cells was reversed by anti-IL-6R mAb (Fig. 2), which demonstrated that IL-6 elicits its effect upon interaction with its receptors. All these results suggested that IL-6 can promote the proliferation of NPC cells although its effect is weak.

Figure 2.

Growth effect of IL-6 on HNE1 and CNE1-LMP1 cells. NPC cells were treated by different concentrations of IL-6 (0, 10, 20 and 50 ng/ml) with or without anti-IL-6R mAb (1 μg/ml) for 24 h. Cells proliferation were determined using MTT. Results are expressed as mean ± SD (n=3). *P<0.05 vs control; **P<0.01 vs control; ##P<0.01 vs 50 ng/ml IL-6 group.

IL-6 promotes the migration activity of NPC cells

The wound-healing migration assay and transwell migration assay were used to examine the effect of IL-6 on NPC migration. As shown in Fig. 3A, IL-6 increased wound-healing migration activity of NPC cells significantly. When HNE1 and CNE1-LMP1 were incubated with IL-6 (50 ng/ml) for 24 h, the migration rate was increased to 90.4 and 91.0%, respectively (Fig. 3B). We also found that IL-6 can improve the transwell migration activity of NPC cells. When IL-6 (10 and 50 ng/ml) was added to the upper compartment of the transwell plates, the number of cells that migrated to the lower filters increased significantly (Fig. 4). In addition, when HNE1 and CNE1-LMP1 cells were stimulated by IL-6 (50 ng/ ml) in combination with anti-IL-6R mAb (1 μg/ml), the IL-6-induced cell migration was markedly inhibited (Figs. 3 and 4). These data implied that IL-6 could clearly accelerate the migration ability of NPC cells.

Figure 3.

Effect of IL-6 on the wound-healing ability of HNE1 and CNE1-LMP1 cells. (A) Monolayers of HNE1 and CNE1-LMP1 cells were scraped and photographed at indicated times (×100; 0, 12 and 24 h). (B) Quantitative assessment of wound-healing rate at indicated times (12 and 24 h). Results are expressed as mean ± SD (n=3). **P<0.01 vs control; ***P<0.001 vs control; ###P<0.001 vs 50 ng/ml IL-6 group.

Figure 4.

Effect of IL-6 on the migration ability of HNE1 and CNE1-LMP1 cells. (A) Cells were incubated with IL-6 or anti-IL-6R mAb for 24 h, and in vitro migration were measured with the Transwell assay (×200). (B) Quantitative assessment of the number of cells migrated to the lower chamber. Results are expressed as mean ± SD (n=3). *P<0.05 vs control; **P<0.01 vs control; ***P<0.001 vs control; ##P<0.01 vs 50 ng/ml IL-6 group.

IL-6 promotes the invasion activity of NPC cells

To examine the effect of IL-6 on NPC invasion, artificial ECM was precoated to the upper side of all filters. Treatment with IL-6 (50 ng/ml) accelerated significantly the invasion ability of HNE1 and CNE1-LMP1 cells. As shown in Fig. 5, the number of cells that invaded through ECM raised markedly upon IL-6 stimulation. On the contrary, the IL-6-stimulated invasive ability could be blocked by IL-6R antibody. The number of cells that penetrated into the lower chamber decreased upon anti-IL-6R mAb (1 μg/ml) treatment. These results demonstrated IL-6 can augment the invasiveness of NPC cells in vitro.

Figure 5.

Effect of IL-6 on the invasion ability of HNE1 and CNE1-LMP1 cells. (A) Cells were incubated with IL-6 or anti-IL-6R mAb for 24 h, and in vitro invasion were measured with the Transwell assay (×200). (B) Quantitative assessment of the number of cells invaded to the lower chamber. Results are expressed as mean ± SD (n=3). **P<0.01 vs control; ***P<0.001 vs control; ##P<0.01 vs 50 ng/ml IL-6 group; ###P<0.001 vs 50 ng/ml IL-6 group.

IL-6 upregulates the expression of MMP-2 and MMP-9

We next assessed the IL-6-stimulated NPC cells in terms of the expression of invasion-linked MMP-2 and MMP-9. As shown in Figs. 6 and 7, the expression of MMP-2 and MMP-9 was relatively low in the original HNE1 and CNE1-LMP1 cells, but increased dose-dependently upon addition of IL-6. On the other hand, this increase in MMP-2 and MMP-9 expression by IL-6 stimulation could be suppressed by anti-IL-6R mAb. These results indicated that IL-6-induced invasion of NPC cells might result from upregulating the expression of MMP-2 and MMP-9, and IL-6R antibody could suppress the expression of MMP-2 and MMP-9.

Figure 6.

Effect of IL-6 on MMP-2 and MMP-9 protein expression in HNE1 and CNE1-LMP1 cells. (A and C) MMP-2 and MMP-9 protein levels from whole-cell lysates were analysed by Western blotting. (B and D) Relative protein expression of MMP-2 and MMP-9 in HNE1 and CNE1-LMP1 cells. Results are expressed as mean ± SD (n=3). ***P<0.001 vs control; ###P<0.001 vs 50 ng/ml IL-6 group.

Figure 7.

Effect of IL-6 on activated MMP-2 and MMP-9 expression in HNE1 and CNE1-LMP1 cells. (A and C) The activated MMP-2 and MMP-9 levels in conditioned media were analysed by gelatin zymography. (B and D) Relative expression of activated MMP-2 and MMP-9 in HNE1 and CNE1-LMP1 cells. Results are expressed as mean ± SD (n=3). *P<0.05 vs control; **P<0.01 vs control; #P<0.05 vs 50 ng/ml IL-6 group; ##P<0.01 vs 50 ng/ml IL-6 group.

Discussion

NPC is highly radiosensitive and, as a consequence, radiotherapy is the backbone of treatments for this disease. With the improvement in local control achieved by more precise radiotherapies, such as the intensity-modulated radiotherapy (IMRT), local control has been substantially improved and distant metastasis become the main cause of treatment failure (39). Thus, identifying factors related to NPC metastasis may provide a potential drug target for preventing and inhibiting NPC metastasis. In this study, we provided evidence that IL-6 can promote the migration and invasion of NPC cell lines and upregulate the expression of MMP-2 and MMP-9.

As with other human solid tumors, NPC is a tissue and systemic disease. The nasopharyngeal epithelial cells are continuously exposed to the environmental challenges and NPC stroma is rich in inflammatory cells (40). Moreover, NPC cells can directly maintain and amplify the local inflammation process recruiting and activating additional immune cells in the nasopharyngeal path and promoting tumor progression (41). The evidence indicated that inflammation may play a role in NPC initiation and progression. IL-6 is a pro-inflammatory cytokine produced primarily by the cells which constitute the tumor microenvironment. Several studies have shown that serum level of IL-6 in NPC patients is elevated and correlated with the advanced stages (29,30,42). In addition, IL-6 is related to EBV infection which is commonly observed in NPC. EBV infection can activate the STAT3 and NF-κB signal cascades in nasopharyngeal epithelial cells, and then upregulates the expression of their downstream targets, including IL-6 (43,44). In turn, IL-6 increases phosphorylated STAT3 levels which permit the EBV LMP1 expression. This would establish a positive feedback loop of IL-6 induction, STAT3 phosphorylation, and reinforced LMP1 expression (45). Therefore, targeting of IL-6 might be considered as a rational therapeutic strategy for treatment of NPC.

IL-6 has been found to play an important role in cell proliferation, survival, migration, invasion and angiogenesis (46). However, the effect of IL-6 on tumor behavior may depend on the tumor cell types (47). In colorectal cancer, IL-6 can only stimulate proliferation of selected cell lines, as different cells possess different IL-6 and IL-6R expression capabilities (48). Thus, we tested the expression of IL-6 and its receptors in NPC cell lines at the start of this study. In our test, all NPC cell lines expressed IL-6 and its receptors, indicating that they were suitable to receive IL-6 stimulation. In the subsequent experiments, we observed that IL-6 was able to promote the proliferation of NPC. The amounts of cells in IL-6 stimulation were increased, although only slightly higher than that of control group. The weak effect of IL-6 on NPC cell proliferation may result from the cell type-specificity. We further examined the effect of IL-6 on the migration and invasion activity of NPC cells. Our results indicated that IL-6 could promote cell migration and invasion significantly. Upon IL-6 stimulation, both the wound-healing rate and cell number of migration and invasion were clearly accelerated. Based on these findings, we considered that IL-6 is able to promote malignant behavior especially the migration and invasion of NPC cell lines.

MMPs, especially MMP-2 and MMP-9, play crucial roles in tumor invasion and metastasis. A variety of cytokines and growth factors, such as interleukin 1β (IL-1β), tumor necrosis factor-α (TNF-α) and epidermal growth factor (EGF), could influence their expressions (22–25). Some previous studies have indicated that IL-6 induced the expression of MMP-2 and MMP-9 (26–28). Thus, we hypothesized that IL-6 may promote the migration and invasion activity of NPC cells via upregulating the expression of MMP-2 and MMP-9. The IL-6 stimulation of the expression of MMP-2 and MMP-9 in NPC cells identified in this study was in agreement with the above studies. MMP-2 and MMP-9 protein levels in both HNE1 and CNE1-LMP1 cells ascended upon IL-6 stimulation. In addition, the elevation of activated MMP-2 and MMP-9 in conditioned media was detected by zymography. Our results confirmed that IL-6 could upregulate the expression of MMP-2 and MMP-9 in NPC cell lines.

Given the importance of IL-6 in various cancers, IL-6 blockade using monoclonal antibodies directed against IL-6 and IL-6R have been tested preclinically and clinically (46,49). Siltuximab (CNTO-328), a human-murine anti-IL-6 monoclonal antibody, has been applied to a number of preclinical and clinical trials targeting malignancies ranging from ovarian and renal cancer to prostate cancer and multiple myeloma (50–55). Results from these trials showed that siltuximab could inhibit tumor growth either alone or in combination with cytotoxic chemotherapies. Tocilizumab, a humanized anti-IL-6R monoclonal antibody, also shows its effectiveness in treating malignant diseases including oral cancer, glioma and multiple myeloma (56–58). In the present study, we demonstrated that targeting IL-6 with an anti-IL-6R monoclonal antibody was able to reverse the IL-6-stimulated proliferation, migration and invasion of NPC cell lines. Moreover, the addition of anti-IL-6R antibody to IL-6-stimulated NPC cells diminished the expression of both MMP-2 and MMP-9. The inhibition effect of anti-IL-6R mAb identified in this study was consistent with the results of a previous study (59).

In conclusion, we have demonstrated that IL-6 is able to promote malignant behavior, especially the migration and invasion of NPC cell lines. The effect of IL-6 on NPC migration and invasion may result from the upregulation of the expression of MMP-2 and MMP-9. Targeting IL-6 signaling with anti-IL-6R antibody was sufficient to reverse the effect of IL-6. Thus, IL-6 or its related signaling pathway may be a promising target for preventing and inhibiting NPC metastasis.

Acknowledgements

This study was supported by the National Natural Science Foundation of China (81272491).

References

1. 

Chan AT: Nasopharyngeal carcinoma. Ann Oncol. 21(Suppl 7): vii308–vii312. 2010.PubMed/NCBI

2. 

Wei WI and Mok VW: The management of neck metastases in nasopharyngeal cancer. Curr Opin Otolaryngol Head Neck Surg. 15:99–102. 2007. View Article : Google Scholar : PubMed/NCBI

3. 

Huang CJ, Leung SW, Lian SL, Wang CJ, Fang FM and Ho YH: Patterns of distant metastases in nasopharyngeal carcinoma. Kaohsiung J Med Sci. 12:229–234. 1996.PubMed/NCBI

4. 

Lee AW, Lin JC and Ng WT: Current management of nasopharyngeal cancer. Semin Radiat Oncol. 22:233–244. 2012. View Article : Google Scholar : PubMed/NCBI

5. 

Wang J, Shi M, Hsia Y, et al: Failure patterns and survival in patients with nasopharyngeal carcinoma treated with intensity modulated radiation in Northwest China: a pilot study. Radiat Oncol. 7:22012. View Article : Google Scholar : PubMed/NCBI

6. 

Grivennikov SI, Greten FR and Karin M: Immunity, inflammation, and cancer. Cell. 140:883–899. 2010. View Article : Google Scholar

7. 

Coussens LM and Werb Z: Inflammation and cancer. Nature. 420:860–867. 2002. View Article : Google Scholar : PubMed/NCBI

8. 

Chang CH, Hsiao CF, Yeh YM, et al: Circulating interleukin-6 level is a prognostic marker for survival in advanced nonsmall cell lung cancer patients treated with chemotherapy. Int J Cancer. 132:1977–1985. 2013. View Article : Google Scholar : PubMed/NCBI

9. 

Ravishankaran P and Karunanithi R: Clinical significance of preoperative serum interleukin-6 and C-reactive protein level in breast cancer patients. World J Surg Oncol. 9:182011. View Article : Google Scholar : PubMed/NCBI

10. 

Schafer ZT and Brugge JS: IL-6 involvement in epithelial cancers. J Clin Invest. 117:3660–3663. 2007. View Article : Google Scholar : PubMed/NCBI

11. 

Yanaihara N, Anglesio MS, Ochiai K, et al: Cytokine gene expression signature in ovarian clear cell carcinoma. Int J Oncol. 41:1094–1100. 2012.PubMed/NCBI

12. 

Heinrich PC, Behrmann I, Haan S, Hermanns HM, Muller-Newen G and Schaper F: Principles of interleukin (IL)-6-type cytokine signalling and its regulation. Biochem J. 374:1–20. 2003. View Article : Google Scholar : PubMed/NCBI

13. 

Grivennikov S and Karin M: Autocrine IL-6 signaling: a key event in tumorigenesis? Cancer Cell. 13:7–9. 2008. View Article : Google Scholar : PubMed/NCBI

14. 

Yi H, Cho HJ, Cho SM, et al: Blockade of interleukin-6 receptor suppresses the proliferation of H460 lung cancer stem cells. Int J Oncol. 41:310–316. 2012.PubMed/NCBI

15. 

Xie G, Yao Q, Liu Y, et al: IL-6-induced epithelial-mesenchymal transition promotes the generation of breast cancer stem-like cells analogous to mammosphere cultures. Int J Oncol. 40:1171–1179. 2012.

16. 

Ara T and Declerck YA: Interleukin-6 in bone metastasis and cancer progression. Eur J Cancer. 46:1223–1231. 2010. View Article : Google Scholar : PubMed/NCBI

17. 

Kleiner DE and Stetler-Stevenson WG: Matrix metalloproteinases and metastasis. Cancer Chemother Pharmacol. 43(Suppl): S42–S51. 1999. View Article : Google Scholar : PubMed/NCBI

18. 

Kallakury BV, Karikehalli S, Haholu A, Sheehan CE, Azumi N and Ross JS: Increased expression of matrix metalloproteinases 2 and 9 and tissue inhibitors of metalloproteinases 1 and 2 correlate with poor prognostic variables in renal cell carcinoma. Clin Cancer Res. 7:3113–3119. 2001.PubMed/NCBI

19. 

Libra M, Scalisi A, Vella N, et al: Uterine cervical carcinoma: role of matrix metalloproteinases (review). Int J Oncol. 34:897–903. 2009. View Article : Google Scholar : PubMed/NCBI

20. 

Kurahara S, Shinohara M, Ikebe T, et al: Expression of MMPs, MT-MMP, and TIMPs in squamous cell carcinoma of the oral cavity: correlations with tumor invasion and metastasis. Head Neck. 21:627–638. 1999. View Article : Google Scholar : PubMed/NCBI

21. 

Kataoka M, Yamagata S, Takagi H, et al: Matrix metalloproteinase 2 and 9 in esophageal cancer. Int J Oncol. 8:773–779. 1996.PubMed/NCBI

22. 

Roomi MW, Monterrey JC, Kalinovsky T, Rath M and Niedzwiecki A: Patterns of MMP-2 and MMP-9 expression in human cancer cell lines. Oncol Rep. 21:1323–1333. 2009.PubMed/NCBI

23. 

Roomi MW, Monterrey JC, Kalinovsky T, Rath M and Niedzwiecki A: In vitro modulation of MMP-2 and MMP-9 in human cervical and ovarian cancer cell lines by cytokines, inducers and inhibitors. Oncol Rep. 23:605–614. 2010.

24. 

Roomi MW, Monterrey JC, Kalinovsky T, Niedzwiecki A and Rath M: Modulation of MMP-2 and MMP-9 by cytokines, mitogens and inhibitors in lung cancer and malignant mesothelioma cell lines. Oncol Rep. 22:1283–1291. 2009.PubMed/NCBI

25. 

Roomi MW, Kalinovsky T, Monterrey J, Rath M and Niedzwiecki A: In vitro modulation of MMP-2 and MMP-9 in adult human sarcoma cell lines by cytokines, inducers and inhibitors. Int J Oncol. 43:1787–1798. 2013.

26. 

Kossakowska AE, Edwards DR, Prusinkiewicz C, et al: Interleukin-6 regulation of matrix metalloproteinase (MMP-2 and MMP-9) and tissue inhibitor of metalloproteinase (TIMP-1) expression in malignant non-Hodgkin’s lymphomas. Blood. 94:2080–2089. 1999.PubMed/NCBI

27. 

Wang Y, Li L, Guo X, et al: Interleukin-6 signaling regulates anchorage-independent growth, proliferation, adhesion and invasion in human ovarian cancer cells. Cytokine. 59:228–236. 2012. View Article : Google Scholar : PubMed/NCBI

28. 

Wang X, Lee SO, Xia S, et al: Endothelial cells enhance prostate cancer metastasis via IL-6→androgen receptor→TGF-β→MMP-9 signals. Mol Cancer Ther. 12:1026–1037. 2013.PubMed/NCBI

29. 

Chow KC, Chiou SH, Ho SP, et al: The elevated serum interleukin-6 correlates with the increased serum butyrate level in patients with nasopharyngeal carcinoma. Oncol Rep. 10:813–819. 2003.PubMed/NCBI

30. 

Tan EL, Selvaratnam G, Kananathan R and Sam CK: Quantification of Epstein-Barr virus DNA load, interleukin-6, interleukin-10, transforming growth factor-beta1 and stem cell factor in plasma of patients with nasopharyngeal carcinoma. BMC Cancer. 6:2272006. View Article : Google Scholar : PubMed/NCBI

31. 

Horikawa T, Yoshizaki T, Sheen TS, Lee SY and Furukawa M: Association of latent membrane protein 1 and matrix metalloproteinase 9 with metastasis in nasopharyngeal carcinoma. Cancer. 89:715–723. 2000. View Article : Google Scholar : PubMed/NCBI

32. 

Wong TS, Kwong DL, Sham JS, Wei WI, Kwong YL and Yuen AP: Clinicopathologic significance of plasma matrix metalloproteinase-2 and -9 levels in patients with undifferentiated nasopharyngeal carcinoma. Eur J Surg Oncol. 30:560–564. 2004. View Article : Google Scholar

33. 

Liu Z, Li L, Yang Z, et al: Increased expression of MMP9 is correlated with poor prognosis of nasopharyngeal carcinoma. BMC Cancer. 10:2702010. View Article : Google Scholar : PubMed/NCBI

34. 

Glaser R, Zhang HY, Yao KT, et al: Two epithelial tumor cell lines (HNE-1 and HONE-1) latently infected with Epstein-Barr virus that were derived from nasopharyngeal carcinomas. Proc Natl Acad Sci USA. 86:9524–9528. 1989. View Article : Google Scholar : PubMed/NCBI

35. 

Du CW, Wen BG, Li DR, et al: Latent membrane protein-1 of Epstein-Barr virus increases sensitivity to arsenic trioxide-induced apoptosis in nasopharyngeal carcinoma cell. Exp Oncol. 27:267–272. 2005.PubMed/NCBI

36. 

Yan Z, Yong-Guang T, Fei-Jun L, Fa-Qing T, Min T and Ya C: Interference effect of epigallocatechin-3-gallate on targets of nuclear factor kappaB signal transduction pathways activated by EB virus encoded latent membrane protein 1. Int J Biochem Cell Biol. 36:1473–1481. 2004.

37. 

Song LB, Yan J, Jian SW, et al: Molecular mechanisms of tumorgenesis and metastasis in nasopharyngeal carcinoma cell sublines. Ai Zheng. 21:158–162. 2002.(In Chinese).

38. 

Li J, Fan Y, Chen J, Yao KT and Huang ZX: Microarray analysis of differentially expressed genes between nasopharyngeal carcinoma cell lines 5-8F and 6-10B. Cancer Genet Cytogenet. 196:23–30. 2010.

39. 

Chan AT: Current treatment of nasopharyngeal carcinoma. Eur J Cancer. 47(Suppl 3): S302–S303. 2011. View Article : Google Scholar : PubMed/NCBI

40. 

Gourzones C, Barjon C and Busson P: Host-tumor interactions in nasopharyngeal carcinomas. Semin Cancer Biol. 22:127–136. 2012. View Article : Google Scholar : PubMed/NCBI

41. 

Liao Q, Guo X, Li X, et al: Analysis of the contribution of nasopharyngeal epithelial cancer cells to the induction of a local inflammatory response. J Cancer Res Clin Oncol. 138:57–64. 2012. View Article : Google Scholar : PubMed/NCBI

42. 

Chang KP, Chang YT, Wu CC, et al: Multiplexed immuno-bead-based profiling of cytokine markers for detection of nasopharyngeal carcinoma and prognosis of patient survival. Head Neck. 33:886–897. 2011. View Article : Google Scholar : PubMed/NCBI

43. 

Eliopoulos AG, Stack M, Dawson CW, et al: Epstein-Barr virus-encoded LMP1 and CD40 mediate IL-6 production in epithelial cells via an NF-kappaB pathway involving TNF receptor-associated factors. Oncogene. 14:2899–2916. 1997. View Article : Google Scholar

44. 

Lo AK, Lo KW, Tsao SW, et al: Epstein-Barr virus infection alters cellular signal cascades in human nasopharyngeal epithelial cells. Neoplasia. 8:173–180. 2006. View Article : Google Scholar : PubMed/NCBI

45. 

Chen H, Hutt-Fletcher L, Cao L and Hayward SD: A positive autoregulatory loop of LMP1 expression and STAT activation in epithelial cells latently infected with Epstein-Barr virus. J Virol. 77:4139–4148. 2003. View Article : Google Scholar : PubMed/NCBI

46. 

Ataie-Kachoie P, Pourgholami MH and Morris DL: Inhibition of the IL-6 signaling pathway: a strategy to combat chronic inflammatory diseases and cancer. Cytokine Growth Factor Rev. 24:163–173. 2013. View Article : Google Scholar : PubMed/NCBI

47. 

Weidle UH, Klostermann S, Eggle D and Kruger A: Interleukin 6/interleukin 6 receptor interaction and its role as a therapeutic target for treatment of cachexia and cancer. Cancer Genomics Proteomics. 7:287–302. 2010.PubMed/NCBI

48. 

Hsu CP and Chung YC: Influence of interleukin-6 on the invasiveness of human colorectal carcinoma. Anticancer Res. 26:4607–4614. 2006.PubMed/NCBI

49. 

Sansone P and Bromberg J: Targeting the interleukin-6/Jak/Stat pathway in human malignancies. J Clin Oncol. 30:1005–1014. 2012. View Article : Google Scholar : PubMed/NCBI

50. 

Hudes G, Tagawa ST, Whang YE, et al: A phase 1 study of a chimeric monoclonal antibody against interleukin-6, siltuximab, combined with docetaxel in patients with metastatic castration-resistant prostate cancer. Invest New Drugs. 31:669–676. 2013. View Article : Google Scholar

51. 

Guo Y, Nemeth J, O’Brien C, et al: Effects of siltuximab on the IL-6-induced signaling pathway in ovarian cancer. Clin Cancer Res. 16:5759–5769. 2010. View Article : Google Scholar : PubMed/NCBI

52. 

Rossi JF, Negrier S, James ND, et al: A phase I/II study of siltuximab (CNTO 328), an anti-interleukin-6 monoclonal antibody, in metastatic renal cell cancer. Br J Cancer. 103:1154–1162. 2010. View Article : Google Scholar

53. 

Hunsucker SA, Magarotto V, Kuhn DJ, et al: Blockade of interleukin-6 signalling with siltuximab enhances melphalan cytotoxicity in preclinical models of multiple myeloma. Br J Haematol. 152:579–592. 2011. View Article : Google Scholar : PubMed/NCBI

54. 

Voorhees PM, Chen Q, Small GW, et al: Targeted inhibition of interleukin-6 with CNTO 328 sensitizes pre-clinical models of multiple myeloma to dexamethasone-mediated cell death. Br J Haematol. 145:481–490. 2009. View Article : Google Scholar : PubMed/NCBI

55. 

Voorhees PM, Manges RF, Sonneveld P, et al: A phase 2 multicentre study of siltuximab, an anti-interleukin-6 monoclonal antibody, in patients with relapsed or refractory multiple myeloma. Br J Haematol. 161:357–366. 2013. View Article : Google Scholar : PubMed/NCBI

56. 

Shinriki S, Jono H, Ota K, et al: Humanized anti-interleukin-6 receptor antibody suppresses tumor angiogenesis and in vivo growth of human oral squamous cell carcinoma. Clin Cancer Res. 15:5426–5434. 2009. View Article : Google Scholar : PubMed/NCBI

57. 

Kudo M, Jono H, Shinriki S, et al: Antitumor effect of humanized anti-interleukin-6 receptor antibody (tocilizumab) on glioma cell proliferation. Laboratory investigation. J Neurosurg. 111:219–225. 2009. View Article : Google Scholar : PubMed/NCBI

58. 

Yoshio-Hoshino N, Adachi Y, Aoki C, Pereboev A, Curiel DT and Nishimoto N: Establishment of a new interleukin-6 (IL-6) receptor inhibitor applicable to the gene therapy for IL-6-dependent tumor. Cancer Res. 67:871–875. 2007. View Article : Google Scholar : PubMed/NCBI

59. 

Hsu CP, Chen YL, Huang CC, et al: Anti-interleukin-6 receptor antibody inhibits the progression in human colon carcinoma cells. Eur J Clin Invest. 41:277–284. 2011. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Sun W, Liu D, Li W, Zhang L, Long G, Wang J, Mei Q and Hu G: Interleukin-6 promotes the migration and invasion of nasopharyngeal carcinoma cell lines and upregulates the expression of MMP-2 and MMP-9. Int J Oncol 44: 1551-1560, 2014.
APA
Sun, W., Liu, D., Li, W., Zhang, L., Long, G., Wang, J. ... Hu, G. (2014). Interleukin-6 promotes the migration and invasion of nasopharyngeal carcinoma cell lines and upregulates the expression of MMP-2 and MMP-9. International Journal of Oncology, 44, 1551-1560. https://doi.org/10.3892/ijo.2014.2323
MLA
Sun, W., Liu, D., Li, W., Zhang, L., Long, G., Wang, J., Mei, Q., Hu, G."Interleukin-6 promotes the migration and invasion of nasopharyngeal carcinoma cell lines and upregulates the expression of MMP-2 and MMP-9". International Journal of Oncology 44.5 (2014): 1551-1560.
Chicago
Sun, W., Liu, D., Li, W., Zhang, L., Long, G., Wang, J., Mei, Q., Hu, G."Interleukin-6 promotes the migration and invasion of nasopharyngeal carcinoma cell lines and upregulates the expression of MMP-2 and MMP-9". International Journal of Oncology 44, no. 5 (2014): 1551-1560. https://doi.org/10.3892/ijo.2014.2323
Copy and paste a formatted citation
x
Spandidos Publications style
Sun W, Liu D, Li W, Zhang L, Long G, Wang J, Mei Q and Hu G: Interleukin-6 promotes the migration and invasion of nasopharyngeal carcinoma cell lines and upregulates the expression of MMP-2 and MMP-9. Int J Oncol 44: 1551-1560, 2014.
APA
Sun, W., Liu, D., Li, W., Zhang, L., Long, G., Wang, J. ... Hu, G. (2014). Interleukin-6 promotes the migration and invasion of nasopharyngeal carcinoma cell lines and upregulates the expression of MMP-2 and MMP-9. International Journal of Oncology, 44, 1551-1560. https://doi.org/10.3892/ijo.2014.2323
MLA
Sun, W., Liu, D., Li, W., Zhang, L., Long, G., Wang, J., Mei, Q., Hu, G."Interleukin-6 promotes the migration and invasion of nasopharyngeal carcinoma cell lines and upregulates the expression of MMP-2 and MMP-9". International Journal of Oncology 44.5 (2014): 1551-1560.
Chicago
Sun, W., Liu, D., Li, W., Zhang, L., Long, G., Wang, J., Mei, Q., Hu, G."Interleukin-6 promotes the migration and invasion of nasopharyngeal carcinoma cell lines and upregulates the expression of MMP-2 and MMP-9". International Journal of Oncology 44, no. 5 (2014): 1551-1560. https://doi.org/10.3892/ijo.2014.2323
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team