Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
September-2015 Volume 47 Issue 3

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2015 Volume 47 Issue 3

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Downregulation of N-myc downstream regulated gene 1 caused by the methylation of CpG islands of NDRG1 promoter promotes proliferation and invasion of prostate cancer cells

  • Authors:
    • Yalin Li
    • Pan Pan
    • Pengfei Qiao
    • Ranlu Liu
  • View Affiliations / Copyright

    Affiliations: Department of Urology, Tianjin Institute of Urology, The Second Hospital of Tianjin Medical University, Tianjin 300211, P.R. China
  • Pages: 1001-1008
    |
    Published online on: July 16, 2015
       https://doi.org/10.3892/ijo.2015.3086
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Current studies tend to consider N-myc downstream regulated gene 1 (NDRG1) as a tumor suppressor gene, inhibiting cell proliferation and invasion. NDRG1 expression in cancer cells is generally low, but the molecular mechanism is unclear. Aberrant methylation of CpG islands (CGIs) in gene promoter was able to inactivate tumor suppressor genes and activate oncogenes, disordering cell proliferation and apoptosis, playing a promotion role in tumor occurrence and progression. The present study was performed to investigate the effect of epigenetic modification of NDRG1 on prostate cancer (PCa) cells. The protein expression in human specimens was measured by immunohistochemical staining. The expression level of NDRG1 was changed by plasmid vectors in PCa cells. These cells were used to study proliferation and invasiveness. NDRG1 expression in normal prostate cells was higher than that in PCa cells. Downregulation of NDRG1 expression enhanced cell proliferation and invasiveness. In contrast, its upregulation could reduce cell proliferation and invasiveness. In PCa cells, the methylation rate of CGIs in the promoter region of NDRG1 was higher than that in normal prostate cells. 5-Aza-CdR, a methylation inhibitor, was able to effectively reverse the aberrant methylation of NDRG1, enhancing its expression, inhibiting cell growth. NDRG1 can inhibit the cell proliferation and invasion of PCa, but its expression level is low. The aberrant methylation of NDRG1 promoter is an important mechanism for gene silencing, playing an important role in tumor occurrence and progression. Therefore, reversing the aberrant methylation of NDRG1 may be used for PCa treatment.

Introduction

Prostate cancer (PCa) is one of the most common malignant tumors of male urinary and reproductive system. Worldwide, PCa has the second highest incidence among malignant tumors of the male. An estimated 220,800 new cases of PCa will occur in the US during 2015. The incidence of PCa has surpassed lung cancer, becoming the first health hazard of the men, accounting for 26% of all male malignancies. With an estimated 27,540 deaths in 2015, PCa is the second-leading cause of cancer death in men (1). PCa is the most frequent cancer among males in Europe. In Europe in 2015, the number of predicted PCa deaths is 72,600 (2). China is one of the nations which have a lower incidence and mortality of PCa, but the incidence shows a continued rapid growth trend in recent years. Risk factors for PCa include age, race and heredity. Moreover, many molecular biological changes which lead to alteration of gene expression and protein functions have been found, including chromosomal aberration, gene amplification and mutation. Similar to other human malignancies, PCa is also the result of genetic and epigenetic factors working together. However, for PCa, the exact molecular mechanism of tumor occurrence and progression is still not clear.

NDRG family is a group of genes which have been found in recent years, including NDRG1, NDRG2, NDRG3 and NDRG4. Researches found that NDRG1 was related to tumor cell stress, proliferation, differentiation and invasion. NDRG1 which is conserved in evolution can interact with a variety of transcription factors, acting as a transcriptional co-repressor factor. NDRG1 was originally discovered with the mouse embryonic N-myc gene knockout (3), located on human chromosome 8q 24.3, containing 16 exons and 15 introns. NDRG1 expression can be upregulated by a variety of physiological conditions or external stimulus, which could promote cell differentiation. NDRG1 has been studied in breast (4,5), pancreatic (6–8), gastric cancer (9), colon (5,10), cervical (11), kidney cancer (12) and PCa (8,13–16), but the findings are not consistent. Whether NDRG1 has a role in tumor suppression or promotion remains controversial. The role may be associated with specific tissues or tumor microenvironment. Current research tends to consider NDRG1 as a tumor suppressor gene (17) in PCa, inhibiting cell proliferation, metastasis and invasion, however, the regulation mechanism is unclear.

Studies have shown that DNA methylation may be associated with the expression level of NDRG1 in breast cancer (5). But in PCa, how the expression level of NDRG1 changes and its epigenetic regulatory mechanisms are not entirely clear. This research was conducted by a preliminary study of the expression and function of NDRG1 in PCa, and then by study of the methylation of NDRG1 promoter which could be one of the epigenetic molecular mechanisms of the changes of NDRG1 expression level.

Materials and methods

Ethics statement

The study was approved by the ethics board of the Second Hospital of Tianjin Medical University. All samples were obtained from patients who signed informed consent approving the use of their tissues for research purposes after operation.

Prostate tissue samples

All of the PCa tissues were collected after radical prostatectomy at the Department of Urology of the hospital. None of the patients had received neoadjuvant hormone therapy before the operation. Benign prostatic hyperplasia (BPH) tissues were collected after suprapubic enucleation of the prostate. Fresh prostate tissues were sampled directly after surgical removal of the gland and were immediately frozen in liquid nitrogen. A diagnostic H&E section was prepared to identify the tissues by pathologists.

Cell culture

Human PCa cell lines (LNCap, PC-3, DU145 and 22Rv1) and normal prostate epithelial cell line (RWPE-1) were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA) and maintained in our laboratory. Cells were cultured in RPMI-1640 (Gibco) supplemented with 10% fetal calf serum and penicillin (100 U/ml). Cultures were maintained under an atmosphere containing 5% CO2.

RT-qPCR

Total RNA was extracted using TRIZol reagent (Invitrogen, Carlsbad, CA, USA). cDNA was synthesized using M-MLV MicroRNA reverse transcription kit (Promega, Madison, WI, USA). RT-qPCR was performed with SYBR Premix Ex Taq™ (Takara, Biotechnology Co., Ltd., Dalian, China). PCR primer for NDRG1 was 5′-CCGACAACCA CTACCTGA-3′ (forward) and 5′-CGTGAAGAATGTGCGAG AC-3′ (reverse). The expression level were normalized to GAPDH. PCR primer for GAPDH was 5′-GGATTTGGTCG TATTGGG-3′ (forward) and 5′-GGAAGATGGTGATGGGA TT-3′ (reverse). PCR was performed under the following conditions: 94°C for 4 min, followed by 40 cycles at 94°C for 30 sec, 50°C for 30 sec and 72°C for 40 sec. Each sample was run in triplicate.

Western blot analysis

All proteins were resolved on a 10% SDS-denatured polyacrylamide gel and were then transferred onto a nitrocellulose membrane. Membranes were incubated with blocking buffer for 60 min at room temperature and then incubated with primary antibody overnight at 4°C. The membranes were washed and incubated with a horseradish peroxidase (HRP)-conjugated secondary antibody. Protein expression was assessed by enhanced chemiluminescence and exposure to chemiluminescent film. The LabWorks image acquisition and analysis software (UVP, LLC Upland, CA, USA) was used to quantify band intensities. All antibodies were purchased from Tianjin Saier Biotechnology Co., Ltd. (Tianjin, China).

Immunohistochemistry staining (IHC)

Paraffin-embedded sections (4 μm) were deparaffinized and hydrated in xylene, followed by graded alcohols to water. Antigen retrieval was performed twice in 0.01 M citrate 10 min in a microwave oven, followed by a 60-min cool down. Slides were then incubated with various primary antibodies followed by EnVision-plus-labeled polymer-conjugated horseradish peroxidase and DAB monitoring staining (Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd., Beijing). Then, slides were counter-stained and dehydrated for viewing and imaging. The antibody was anti-NDRG1 (GeneTech, Shanghai, China).

Plasmid vector construction and cell transfection

Two types of plasmid vectors were constructed for changing the expression level of NDRG1. PC-3 cells were divided into several groups as follows according to different transfection contents: i) for downregulation: a, PBS; b, pRNAT-U6.1/Neo (NC); c, PSiHIV-U6/shRNA-1; d, PSiHIV-U6/shRNA-2; e, PSiHIV-U6/shRNA-3; f, PSiHIV-U6/shRNA-4; ii) for upregulation: a, PBS; b, pReceiver-Lv103 (NC); c, pReceiver-Lv103-Expression. PC-3 cells were seeded in triplicate in 96-well plates, allowed to settle for 24 h and then co-transfected with different contents by using Lipofectamine 2000 (Invitrogen). After the transfection, using light microscope the growth of the cells was observed.

MTT assay

PC-3 cells were plated on 96-well plates at 1×104 cells/well. Viable cells were measured on day 1, 2, 3 and 4 after plating. After incubation with 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), the cells were lysed in 150 ml of 100% dimethylsulfoxide (DMSO) and UV-visible absorbance was read at 490 nm. Each sample was run in triplicate.

Flow cytometry

PC-3 cells were collected and fixed with 70% ethanol for the detection of early apoptosis. The dyeing of cells was performed according to the instructions of Annexin V-R-PE cell apoptosis detection kit (SouthernBiotech, Birmingham, AL USA). Flow cytometry (BD Biosciences, San Jose, CA, USA) was used to detect the percentage of early apoptosis. The measurement was performed in triplicate.

Transwell migration assay

PC-3 cells were collected. PC-3 (5×104) cells were placed on the upper chamber of each insert coated with 50 ml of 2 mg/ml Matrigel (growth factor reduced BD Matrigel™ matrix), and 600 ml of RPMI-1640 with 20% FBS was added to the lower part of the chamber. After incubating for 24 h, the chambers were disassembled, and the membranes were stained with a 2% crystal violet solution for 15 min and placed on a glass slide. Then, cells that had migrated across the membrane were counted in five random visual fields using a microplate reader at 490 nm. All assays were performed three independent times in triplicate.

Bisulfite sequencing PCR (BSP) primer design

NDRG1 promoter was predicted by NCBI (www.ncbi.nlm.nih.gov/gene) and Prosean (www-bimas.cit.nih.gov/molbio/Proscan/). BSP Primer was designed by Promoter 2.0 (www.cbs.dtu.dk/services/Promoter/), BLAST (www.ncbi.nlm.nih.gov/BLAST/), methBLAST (medgen.ugent.be/methBLAST/) and MethPrimer (www.urogene.org/methprimer/).

BSP

After genomic DNA treatment by bisulfite, all of the unmethylated cytosines were converted to uracils, whereas methylated cytosines were unchanged. BSP primers were designed for PCR. Purified products were used for TA cloning. Positive clones were selected from each of the TA clones. The methylation site changes in CGIs of NDRG1 promoter were observed by comparing with the original gene sequences (DNAMAN V6).

Statistical analysis

The data are presented as mean ± standard deviation (± SD). The two-tailed Student's t-test was used to evaluate the significance of the differences between two groups. P<0.05 was considered significant.

Results

NDRG1 expression in normal prostate and PCa

IHC showed that NDRG1 protein expressed both in the cytoplasm and nucleus, but mainly in the cytoplasm (Fig. 1). NDRG1 expression in RWPE-1 cells was higher than that in PC-3 and LNCap cells. NDRG1 expression in PCa tissues was lower than that in BPH tissues (Fig. 2). RT-qPCR showed that NDRG1 mRNA expression was higher in RWPE-1 cells than that in LNCap and PC-3 cells (Fig. 3). Western blot analysis showed that NDRG1 protein expression in RWPE-1 cells was higher than that in LNCap and PC-3 cells (Fig. 4).

Figure 1

Immunohistochemical NDRG1 protein expression in RWPE-1 cells (A, ×200 magnification), PC-3 cells (B, ×200 magnification) and in LNCap cells (C, ×200 magnification). Brown granules in the cytoplasm are NDRG1 protein.

Figure 2

IHC showed NDRG1 protein expression in BPH tissues (A, ×200 magnification) and in PCa tissues (B, ×200 magnification). Brown granules in the cytoplasm are NDRG1 protein.

Figure 3

The expression level of NDRG1 mRNA in RWPE-1, LNCap and PC-3 cells. RT-PCR results were analyzed. The expression level in RWPE-1 cells was regarded as 100%, and the other cell lines were compared with RWPE-1. The bars represent the means ± SD and the control sample is set to a value of 1.0.

Figure 4

NDRG1 protein expression in RWPE-1, PC-3 and LNCap cells (β-tubulin, internal control).

NDRG1 expression is changed by transfection with plasmid vectors

After PC-3 cell transfection with PSiHIV-U6/shRNA, NDRG1 expression was downregulated. RT-qPCR showed that NDRG1 mRNA expression was significantly decreased, and PSiHIV-U6/shRNA-1 had the most preferably interference effect (Fig. 5). Western blot analysis showed that NDRG1 protein expression was significantly decreased, and PSiHIV-U6/shRNA-1 had the most preferably interference effect (Fig. 6). PSiHIV-U6/shRNA-1 was chosen for the following experiments. Transwell assay showed that after the transfection, the invasive ability of PC-3 cells was significantly increased (Table I), suggesting that downregulation of NDRG1 expression had a significant enhancing effect on the migration of PC-3 cells (Fig. 7). Flow cytometry showed that PSiHIV-U6/shRNA-1 group had the lowest early apoptosis rate at 0.02%. NC group had the highest early apoptosis rate at 1.34% and PBS group was 1.94%. MTT assay showed that the cell proliferation rate of PSiHIV-U6/shRNA-1 group was significantly higher than the others (Fig. 8). After transfection for 24, 48, 72 and 96 h, the number of cells in PSiHIV-U6/shRNA-1 group was always significantly higher than the other groups (P<0.01). Howecer, at each time-point, the difference between PBS group and NC group was no statistically significant (P>0.05).

Figure 5

The expression level of NDRG1 mRNA in each group. RT-PCR results were analyzed. The expression level in PBS group was regarded as 100%, and the other groups were compared with PBS group. The bars represent the means ± SD and the control sample is set to a value of 1.0.

Figure 6

NDRG1 protein expression in PC-3 cells after the transfection (GAPDH, internal control).

Figure 7

Cell migration of PSiHIV-U6/shRNA-1 group (A, ×100 magnification) and PBS group (B, ×100 magnification). Migration cells are stained purple.

Figure 8

Cell growth curves. PC-3 cells were plated on 96-well plates at 1×104 cells/well and were measured on day 1, 2, 3 and 4 after plating. After incubation with MTT, the cells were lysed in DMSO and read by UV-visible absorbance at 490 nm. The cell growth rate of PSiHIV-U6/shRNA-1 group was significantly higher than the other groups.

Table I

Results of Transwell migration assay after downregulation of NDRG1 expression (mean ± SD).

Table I

Results of Transwell migration assay after downregulation of NDRG1 expression (mean ± SD).

GroupFields countedInvasion cells per fieldtP-value
PSiHIV-U6/shRNA-Expression-11567±132.15<0.05
PBS1521±6

After PC-3 cell transfection with pReceiver-Lv103-Expression, NDRG1 expression was upregulated. Western blot analysis showed that NDRG1 protein expression was higher in pReceiver-Lv103-expression group than that in control group (Fig. 9). Transwell assay showed that after the transfection, the invasive ability of PC-3 cells was significantly decreased (Table II), suggesting that upregulation of NDRG1 expression did have a significant weakening effect on the migration of PC-3 cells (Fig. 10). Flow cytometry showed that pReceiver-Lv103-Expression group had the highest early apoptosis rate at 26.48%. NC group had the lowest early apoptosis rate at 0.64% and PBS group was 4.97%. MTT assay showed that the cell proliferation rate of pReceiver-Lv103-Expression group was significantly lower than the others (Fig. 11). After transfection for 24, 48, 72 and 96 h, the number of cells in pReceiver-Lv103-Expression group was always significantly lower than the other groups (P<0.01). At each time-point, the difference between PBS group and NC group was no statistically significant (P>0.05).

Figure 9

NDRG1 protein expression in PC-3 cells after the transfection (GAPDH, internal control).

Figure 10

Cell migration of pReceiver-Lv103 group (A, ×100 magnification) and PBS group (B, ×100 magnification). Migration cells are stained purple.

Figure 11

Cell growth curves. PC-3 cells were plated on 96-well plates at 1×104 cells/well and were measured on day 1, 2, 3 and 4 after plating. After incubation with MTT, the cells were lysed in DMSO and read by UV-visible absorbance at 490 nm. The cell growth rate of pReceiver-Lv103-expression (NDRG1-Expression) group was significantly lower than the other groups.

Table II

Results of Transwell migration assay after upregulation of NDRG1 expression (mean ± SD).

Table II

Results of Transwell migration assay after upregulation of NDRG1 expression (mean ± SD).

GroupFields countedInvasion cells per fieldtP-value
pReceiver-Lv103-Expression1519±72.15<0.05
PBS1571±6
The methylation status of NDRG1 promoter in prostate cells

There are four CGIs which may occur aberrant methylation in the promoter region of human NDRG1 from −3000 bp to +70 bp. The present study analyzed the first CGI from −213 bp to +78 bp, containing 21 CpG sites (Table III). With BSP primer for NDRG1 promoter, using PCR amplified bisulfite modified DNA. The molecular weight of PCR products were close to 291 bp. The rate of methylation of the first CGI was analyzed in different samples by BIQ Analyzer (Fig. 12). The results were 24.8% (PC-3 cells), 36.2% (22RV1 cells), 48.6% (LNCap cells), 69.5% (DU145 cells), 4.8% (RWPE-1 cells), 48.6% (PCa tissues) and 4.3% (BPH tissues). The rate of methylation in PCa cells or tissues was significantly higher than that in normal prostate cells or tissues (P<0.01). DU145 cells which had the highest rate of methylation were chosen for the following experiments. In PCa, the CpG site which was most likely to occur aberrant methylation was the seventeenth CpG site (−127 bp) from the 5′ end. Approximately 50% of methylation occurred at this site.

Figure 12

The methylation rate of the first CGI located in the promoter of NDRG1 in prostate cell lines, PCa and BPH tissues.

Table III

BSP primer sequences (designed by methyl primer).

Table III

BSP primer sequences (designed by methyl primer).

NDRG1Primer sequence (5′-3′)
MethylatedF: TTTAGTGGGTAAGGTTTAGTGAGTGT
R: CCTCAAAATTTCTTCTAAAAATCTC

[i] F, forward; R, reverse.

NDRG1 is demethylated by 5-Aza-CdR in DU145 cells

RT-qPCR showed that after treatment with 5-Aza-CdR for 24, 48 and 72 h, NDRG1 mRNA expression in DU145 cells was significantly upregulated (P<0.05), dose-dependently (Fig. 13). MTT assay showed that after treatment with different concentrations of 5-Aza-CdR, the density of cells was significantly reduced, and cells appeared shrunken and non-viable. The inhibiting effect was dose-dependent (Fig. 14). After 72 h, the methylation rate of the first CGI located in the promoter region of NDRG1 was 11.4%, which was significant at <69.5% (Fig. 15). The results showed that 5-Aza-CdR was able to reverse the methylation status of NDRG1 promoter in DU145 cells.

Figure 13

NDRG1 mRNA expression in DU145 cells was measured on day 1, 2 and 3 after treatment with different concentrations of 5-Aza-CdR. RT-PCR results were analyzed. The expression level in control group was regarded as 100%, and the other groups were compared with control group. The bars represent the means ± SD and the control sample is set to a value of 1.0.

Figure 14

The impact of 5-Aza-CdR on the growth inhibition rate of DU145 cells. PC-3 cells were plated on 96-well plates at 1×104 cells/well and were measured on day 1, 2 and 3 after treatment with different concentrations of 5-Aza-CdR.

Figure 15

The methylation rate of the first CGI located in the promoter region of NDRG1 in DU145 cells. After the demethylation intervention, the methylation rate of DU145 cells was significantly reduced.

Discussion

In the present study, we studied NDRG1 expression in prostate tissues and cells. NDRG1 protein expressed in both the cytoplasm and nucleus but mainly in the cytoplasm. NDRG1 expression in PC-3 and LNCap cells was lower than that in RWPE-1 cells. With these results, we confirmed that NDRG1 was associated with PCa.

For further research, we designed two types of plasmid vectors, changing the expression level of NDRG1 in PC-3 cells. After downregulation of NDRG1 expression, the cell invasive ability and proliferation rate in the experimental group was significantly increased. The rate of early apoptosis significantly decreased. After upregulation of NDRG1 expression, the cell invasive ability and proliferation rate in the experimental group was significantly decreased. The rate of early apoptosis significantly increased. We can conclude that NDRG1 expression in PCa is lower than that in normal prostate, and NDRG1 may have an inhibitory effect on the progression and metastasis of PCa. NDRG1 is the downstream gene of p53 and may cooperate with p53, promoting cell differentiation, maturation and apoptosis (18). Upregulation of NDRG1 reduced the expression of vascular endothelial growth factor (VEGF) and interleukin-8, inhibiting tumor angiogenesis and metastasis (19). Moreover, it can change the adhesion between tumor cells, inhibiting the extracellular matrix degradation. NDRG1 expression was negatively correlated with the activity of matrix metalloproteinase MMP-9, inhibiting the extracellular matrix degradation and tumor metastasis (17).

Epigenetic (20) changes are early molecular events occurring in the transcription of tumor cells. DNA methylation is a common epigenetic change, mostly occurring at 5′-CpG-3′ dinucleotide. The density of CpG sequence is high in the genome regions named CGIs (21). CGIs usually locate in the gene promoter region and may extend to the exon. The methylation of CGIs was able to silence gene expression. In the human genome, the CpG sites are usually methylated out of CGIs but stay unmethylated in CGIs. This methylation pattern can be stably maintained during cell division (22). Therefore, the methylation of CGIs plays an important role in tumor cell proliferation, DNA repair, cell cycle regulation and apoptosis (23–25). DNA methylation may prevent the combination of specific transcription factors and promoter recognition, inhibiting gene expression. Kalaydjieva et al (26) found a CGI located at the 5′ end of NDRG1 and considered that NDRG1 expression may be regulated by DNA methylation. Guan et al (27) reported that NDRG1 expression was regulated through multiple mechanisms, including DNA methylation (27). Han et al (4) found the high methylation rate of NDRG1 promoter in DNA promoter region was related to the occurrence and progression of breast cancer. Chang et al (9) reported that the methylation of DNA promoter may be related to the occurrence and progression of gastric cancer. Gravina et al (28) found that increased levels of DNA methyltransferases (DNMT) are associated with the tumorigenic capacity of PCa cells. Gillio-Tos et al (29) reported that the DNMT3b may play an important role in PCa progression. Therefore, we speculated that the low expression of NDRG1 in PCa may be related to the methylation status of CGIs in gene promoter region. Then, we analyzed the methylation rate of the first CGI located in the promoter region of NDRG1 in prostate cells and tissues. The results showed that the methylation rate in PCa was higher than that in BPH, which could explain the abnormal expression of NDRG1. Our research suggested that the high methylation rate of NDRG1 promoted the occurrence and progression of PCa.

Next, we treated DU145 cells with 5-Aza-CdR, reducing the methylation levels of NDRG1 and observed changes in cell biological behavior. The expression level and methylation rate of NDRG1 was significantly increased. The survival rate of DU145 cells was significantly decreased. Thus, we conclude that DNA methylation silenced NDRG1 expression.

In conclusion, the key finding of this study is that the low expression of NDRG1 can increase the proliferation and invasion of PCa cells. Methylation of CGIs in the NDRG1 promoter may be one of the reasons which lead to the low expression of NDRG1. This result indicates that the methylation of NDRG1 promoter plays an essential role in regulating the proliferation and invasion of PCa cells. NDRG1 may serve as a novel therapeutic target for the treatment of PCa.

Acknowledgements

The present study was supported by grants from the Key Project of Tianjin Municipal Science and Technology Commission (no. 15JCZDJC35900), the Tianjin Municipal Education Commission (no. 20140122) and the Key Project of Tianjin Health Bureau (no. 13KG141).

References

1 

Siegel RL, Miller KD and Jemal A: Cancer statistics, 2015. CA Cancer J Clin. 65:5–29. 2015. View Article : Google Scholar : PubMed/NCBI

2 

Malvezzi M, Bertuccio P, Rosso T, Rota M, Levi F, La Vecchia C and Negri E: European cancer mortality predictions for the year 2015: Does lung cancer have the highest death rate in EU women? Ann Oncol. 26:779–786. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Okuda T and Kondoh H: Identification of new genes ndr2 and ndr3 which are related to Ndr1/RTP/Drg1 but show distinct tissue specificity and response to N-myc. Biochem Biophys Res Commun. 266:208–215. 1999. View Article : Google Scholar : PubMed/NCBI

4 

Han LL, Hou L, Zhou MJ, Ma ZL, Lin DL, Wu L and Ge YL: Aberrant NDRG1 methylation associated with its decreased expression and clinicopathological significance in breast cancer. J Biomed Sci. 20:522013. View Article : Google Scholar : PubMed/NCBI

5 

Kovacevic Z, Fu D and Richardson DR: The iron-regulated metastasis suppressor, Ndrg-1: Identification of novel molecular targets. Biochim Biophys Acta. 1783:1981–1992. 2008. View Article : Google Scholar : PubMed/NCBI

6 

Angst E, Dawson DW, Nguyen A, Park J, Go VL, Reber HA, Hines OJ and Eibl G: Epigenetic regulation affects N-myc downstream-regulated gene 1 expression indirectly in pancreatic cancer cells. Pancreas. 39:675–679. 2010. View Article : Google Scholar : PubMed/NCBI

7 

Kim-Fuchs C, Winterhalder S, Winter A, Malinka T, Born D, Schäfer S, Stroka D, Gloor B, Candinas D and Angst E: The silencing of N-myc downstream-regulated gene-1 in an orthotopic pancreatic cancer model leads to more aggressive tumor growth and metastases. Dig Surg. 31:135–142. 2014. View Article : Google Scholar : PubMed/NCBI

8 

Youns M and Fathy GM: Upregulation of extrinsic apoptotic pathway in curcumin-mediated antiproliferative effect on human pancreatic carcinogenesis. J Cell Biochem. 114:2654–2665. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Chang X, Zhang S, Ma J, Li Z, Zhi Y, Chen J, Lu Y and Dai D: Association of NDRG1 gene promoter methylation with reduced NDRG1 expression in gastric cancer cells and tissue specimens. Cell Biochem Biophys. 66:93–101. 2013. View Article : Google Scholar

10 

Li Q and Chen H: Transcriptional silencing of N-Myc downstream-regulated gene 1 (NDRG1) in metastatic colon cancer cell line SW620. Clin Exp Metastasis. 28:127–135. 2011. View Article : Google Scholar

11 

Geng XX, Quan LN, Ma R and Tang LP: Effects of As2O3 and all-trans retinoic acid on the growth of HeLa cell line and their relation with gene NDRG1. Zhonghua Zhong Liu Za Zhi. 33:8–12. 2011.(In Chinese). PubMed/NCBI

12 

Hosoya N, Sakumoto M, Nakamura Y, Narisawa T, Bilim V, Motoyama T, Tomita Y and Kondo T: Proteomics identified nuclear N-myc downstream-regulated gene 1 as a prognostic tissue biomarker candidate in renal cell carcinoma. Biochim Biophys Acta. 1834:2630–2639. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Dixon KM, Lui GY, Kovacevic Z, Zhang D, Yao M, Chen Z, Dong Q, Assinder SJ and Richardson DR: Dp44mT targets the AKT, TGF-β and ERK pathways via the metastasis suppressor NDRG1 in normal prostate epithelial cells and prostate cancer cells. Br J Cancer. 108:409–419. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Liu W, Iiizumi-Gairani M, Okuda H, Kobayashi A, Watabe M, Pai SK, Pandey PR, Xing F, Fukuda K, Modur V, et al: KAI1 gene is engaged in NDRG1 gene-mediated metastasis suppression through the ATF3-NFkappaB complex in human prostate cancer. J Biol Chem. 286:18949–18959. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Ghalayini MK, Dong Q, Richardson DR and Assinder SJ: Proteolytic cleavage and truncation of NDRG1 in human prostate cancer cells, but not normal prostate epithelial cells. Biosci Rep. 33:332013. View Article : Google Scholar

16 

Symes AJ, Eilertsen M, Millar M, Nariculam J, Freeman A, Notara M, Feneley MR, Patel HR, Masters JR and Ahmed A: Quantitative analysis of BTF3, HINT1, NDRG1 and ODC1 protein over-expression in human prostate cancer tissue. PLoS One. 8:e842952013. View Article : Google Scholar

17 

Lee JC, Chung LC, Chen YJ, Feng TH and Juang HH: N-myc downstream-regulated gene 1 downregulates cell proliferation, invasiveness, and tumorigenesis in human oral squamous cell carcinoma. Cancer Lett. 355:242–252. 2014. View Article : Google Scholar : PubMed/NCBI

18 

Kovacevic Z, Sivagurunathan S, Mangs H, Chikhani S, Zhang D and Richardson DR: The metastasis suppressor, N-myc downstream regulated gene 1 (NDRG1), upregulates p21 via p53-independent mechanisms. Carcinogenesis. 32:732–740. 2011. View Article : Google Scholar : PubMed/NCBI

19 

Hosoi F, Izumi H, Kawahara A, Murakami Y, Kinoshita H, Kage M, Nishio K, Kohno K, Kuwano M and Ono M: N-myc downstream regulated gene 1/Cap43 suppresses tumor growth and angiogenesis of pancreatic cancer through attenuation of inhibitor of kappaB kinase beta expression. Cancer Res. 69:4983–4991. 2009. View Article : Google Scholar : PubMed/NCBI

20 

Holliday R: The inheritance of epigenetic defects. Science. 238:163–170. 1987. View Article : Google Scholar : PubMed/NCBI

21 

Ushijima T: Detection and interpretation of altered methylation patterns in cancer cells. Nat Rev Cancer. 5:223–231. 2005. View Article : Google Scholar : PubMed/NCBI

22 

Cottrell SE: Molecular diagnostic applications of DNA methylation technology. Clin Biochem. 37:595–604. 2004. View Article : Google Scholar : PubMed/NCBI

23 

Esteller M, Corn PG, Baylin SB and Herman JG: A gene hypermethylation profile of human cancer. Cancer Res. 61:3225–3229. 2001.PubMed/NCBI

24 

Yang B, Guo M, Herman JG and Clark DP: Aberrant promoter methylation profiles of tumor suppressor genes in hepatocellular carcinoma. Am J Pathol. 163:1101–1107. 2003. View Article : Google Scholar : PubMed/NCBI

25 

Edamoto Y, Hara A, Biernat W, Terracciano L, Cathomas G, Riehle HM, Matsuda M, Fujii H, Scoazec JY and Ohgaki H: Alterations of RB1, p53 and Wnt pathways in hepatocellular carcinomas associated with hepatitis C, hepatitis B and alcoholic liver cirrhosis. Int J Cancer. 106:334–341. 2003. View Article : Google Scholar : PubMed/NCBI

26 

Kalaydjieva L, Gresham D, Gooding R, Heather L, Baas F, de Jonge R, Blechschmidt K, Angelicheva D, Chandler D, Worsley P, et al: N-myc downstream-regulated gene 1 is mutated in hereditary motor and sensory neuropathy-Lom. Am J Hum Genet. 67:47–58. 2000. View Article : Google Scholar : PubMed/NCBI

27 

Guan RJ, Ford HL, Fu Y, Li Y, Shaw LM and Pardee AB: Drg-1 as a differentiation-related, putative metastatic suppressor gene in human colon cancer. Cancer Res. 60:749–755. 2000.PubMed/NCBI

28 

Gravina GL, Ranieri G, Muzi P, Marampon F, Mancini A, Di Pasquale B, Di Clemente L, Dolo V, D'Alessandro AM and Festuccia C: Increased levels of DNA methyltransferases are associated with the tumorigenic capacity of prostate cancer cells. Oncol Rep. 29:1189–1195. 2013.

29 

Gillio-Tos A, Fiano V, Zugna D, Vizzini L, Pearce N, Delsedime L, Merletti F and Richiardi L: DNA methyltransferase 3b (DNMT3b), tumor tissue DNA methylation, Gleason score, and prostate cancer mortality: Investigating causal relationships. Cancer Causes Control. 23:1549–1555. 2012. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li Y, Pan P, Qiao P and Liu R: Downregulation of N-myc downstream regulated gene 1 caused by the methylation of CpG islands of NDRG1 promoter promotes proliferation and invasion of prostate cancer cells. Int J Oncol 47: 1001-1008, 2015.
APA
Li, Y., Pan, P., Qiao, P., & Liu, R. (2015). Downregulation of N-myc downstream regulated gene 1 caused by the methylation of CpG islands of NDRG1 promoter promotes proliferation and invasion of prostate cancer cells. International Journal of Oncology, 47, 1001-1008. https://doi.org/10.3892/ijo.2015.3086
MLA
Li, Y., Pan, P., Qiao, P., Liu, R."Downregulation of N-myc downstream regulated gene 1 caused by the methylation of CpG islands of NDRG1 promoter promotes proliferation and invasion of prostate cancer cells". International Journal of Oncology 47.3 (2015): 1001-1008.
Chicago
Li, Y., Pan, P., Qiao, P., Liu, R."Downregulation of N-myc downstream regulated gene 1 caused by the methylation of CpG islands of NDRG1 promoter promotes proliferation and invasion of prostate cancer cells". International Journal of Oncology 47, no. 3 (2015): 1001-1008. https://doi.org/10.3892/ijo.2015.3086
Copy and paste a formatted citation
x
Spandidos Publications style
Li Y, Pan P, Qiao P and Liu R: Downregulation of N-myc downstream regulated gene 1 caused by the methylation of CpG islands of NDRG1 promoter promotes proliferation and invasion of prostate cancer cells. Int J Oncol 47: 1001-1008, 2015.
APA
Li, Y., Pan, P., Qiao, P., & Liu, R. (2015). Downregulation of N-myc downstream regulated gene 1 caused by the methylation of CpG islands of NDRG1 promoter promotes proliferation and invasion of prostate cancer cells. International Journal of Oncology, 47, 1001-1008. https://doi.org/10.3892/ijo.2015.3086
MLA
Li, Y., Pan, P., Qiao, P., Liu, R."Downregulation of N-myc downstream regulated gene 1 caused by the methylation of CpG islands of NDRG1 promoter promotes proliferation and invasion of prostate cancer cells". International Journal of Oncology 47.3 (2015): 1001-1008.
Chicago
Li, Y., Pan, P., Qiao, P., Liu, R."Downregulation of N-myc downstream regulated gene 1 caused by the methylation of CpG islands of NDRG1 promoter promotes proliferation and invasion of prostate cancer cells". International Journal of Oncology 47, no. 3 (2015): 1001-1008. https://doi.org/10.3892/ijo.2015.3086
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team