Adherens junctions associated protein 1 serves as a predictor of recurrence of squamous cell carcinoma of the esophagus

  • Authors:
    • Haruyoshi Tanaka
    • Mitsuro Kanda
    • Masahiko Koike
    • Naoki Iwata
    • Dai Shimizu
    • Kazuhiro Ezaka
    • Satoshi Sueoka
    • Yuri Tanaka
    • Hideki Takami
    • Ryoji Hashimoto
    • Chie Tanaka
    • Suguru Yamada
    • Tsutomu Fujii
    • Goro Nakayama
    • Hiroyuki Sugimoto
    • Michitaka Fujiwara
    • Yasuhiro Kodera
  • View Affiliations

  • Published online on: September 16, 2015     https://doi.org/10.3892/ijo.2015.3167
  • Pages: 1811-1818
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Esophageal squamous cell carcinoma (ESCC), the most common esophageal cancer in East Asia, is among the six cancers with the highest fatality rates worldwide. Unfortunately, multidisciplinary treatment strategies have not achieved satisfactory outcomes. Therefore, novel insights into the molecular biology of ESCC are required to improve treatment. The gene encoding the transmembrane adherens junctions-associated protein-1 (AJAP1) expressed by epithelial cells resides in chromosome 1p36, which is frequently lost or epigenetically silenced in several malignancies. Here, we investigated the expression levels and regulatory mechanism of AJAP1 transcription. We determined the levels of AJAP1 mRNA and the genes encoding potentially interacting proteins expressed by ESCC cell lines, as well as the chromosomal copy number of AJAP1 and the methylation status of its promoter region. AJAP1 mRNA levels of 78 pairs of surgically resected specimens were determined to evaluate the association of AJAP1 expression and clinicopathological factors. Nine ESCC cell lines differentially expressed AJAP1 mRNA, and demethylation of hypermethylated AJAP1 genomic DNA reactivated AJAP1 mRNA expression. The copy number of sequences upstream or downstream of the AJAP1 transcriptional start site was not detectably altered. AJAP1 mRNA levels correlated inversely with those of ezrin (EZR) and were significantly lower in ESCC tissues compared with adjacent normal tissues. AJAP1 mRNA levels decreased gradually with increasing tumor stage. Patients with downregulated AJAP1 transcription were more likely to experience shorter overall and disease-free survival. Multivariate analysis of disease-free survival identified downregulated AJAP1 transcription as an independent prognostic factor. These results suggest that in ESCC, AJAP1 acts as a putative tumor suppressor and that AJAP1 transcription is regulated by promoter hypermethylation. These findings indicate that downregulated AJAP1 transcription may serve as a novel tumor biomarker to predict recurrence of ESCC after esophagectomy.

Introduction

Esophageal cancer ranks sixth among all cancers in mortality worldwide because of its extremely aggressive nature (1,2). The predominant histological types of esophageal cancer are adenocarcinoma and squamous cell carcinoma (3). Adenocarcinoma of the distal esophagus predominates in Western countries, whereas esophageal squamous cell carcinoma (ESCC) predominates in Asia (3). The mechanism of carcinogenesis of ESCC differs from that of adenocarcinoma, which has been widely studied in North America and Europe (3). Further, exogenous factors such as smoking, drinking, nitrosamines, and consumption of hot beverages correlate significantly with the development of ESCC but not with adenocarcinoma of the esophagus (4,5). Recent advances in our understanding of the molecular biology of ESCC document the role of genetic alterations in tumorigenesis (6,7). Therefore, a better understanding of the molecular mechanisms of progression and recurrence is of paramount importance, and identification of the genes that mediate ESCC pathogenesis will increase our understanding of the molecular and cellular processes involved and provide new biomarkers that may facilitate diagnosis, risk stratification, and monitoring recurrences of ESCC (8,9).

The transmembrane adherens junctions-associated protein-1 (AJAP1) targets the basolateral membrane of polarized epithelial cells and interacts with E-cadherin-catenin complexes of adherens junctions (10). The locus encoding AJAP1 resides in chromosome 1p36 and is frequently deleted from the genomes of various tumor cells or is epigenetically silenced, indicating that AJAP1 acts as a tumor suppressor (1113). Although AJAP1 is involved in cell-cell and cell-extracellular matrix interactions potentially involved in the motility, migration, and invasion of glioblastoma cells (11,14), little evidence is available on its role in oncogenesis. To our knowledge, there are no studies of the expression and regulatory mechanisms of AJAP1 transcription in gastrointestinal cancers, including ESCC. To address these issues, we analyzed ESCC cell lines and tumor tissues to evaluate AJAP1 expression and its regulatory mechanisms. Our results indicate that AJAP1 expression levels provide a potential clinical biomarker of the progression and recurrence of ESCC.

Materials and methods

Sample collection

Nine ESCC cell lines (TE1, TE2, TE3, NUEC1, NUEC2, NUEC3, TT, TTn and WSSC) and a control nontumorigenic epithelial cell line (FHs74) were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA), the Japanese Collection of Research Bioresources Cell Bank (Osaka, Japan), or were established in our institute. Cells were stored at −80°C using cell preservative solution (Cell Banker; Mitsubishi Chemical Medience Co., Tokyo, Japan) and cultured in RPMI-1640 (Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% fetal bovine serum and in an atmosphere containing 5% CO2 at 37°C (15,16). Seventy-eight primary ESCC tissues and adjacent normal tissues were acquired from patients who underwent radical esophageal resection at Nagoya University Hospital between December 2001 and October 2013. All tissue samples were diagnosed histologically as ESCC, frozen immediately after resection, and stored at −80°C. None of the patients underwent preoperative treatment such as chemotherapy and radiation. Specimens were classified histologically using the seventh edition of the UICC staging system for esophageal cancer.

Patients were questioned to determine their levels of alcohol consumption, and excessive alcohol consumption was defined as >210 g/week for ≥3 years (2,17). The mean age of the 78 patients was 64.9±8.2 years (mean ± standard deviation; range, 44–82 years). The male-to-female ratio was 62:16. Nine, 29, 30 and 10 patients were in stages I, II, III and IV, respectively, according to the UICC staging system (seventh edition). The median duration of patient follow-up was 73.7 months (range, 5.3–149 months) or until death. Postoperative follow-up examinations included physical examination, measurement of serum tumor markers every 3 months, and enhanced computed tomography of the chest and abdominal cavity every 6 months. Adjuvant chemotherapy was administered to selected patients according to the patient's condition and the physician's discretion.

The present study conforms to the ethical guidelines of the World Medical Association Declaration of Helsinki: Ethical Principles for Medical Research Involving Human Subjects. Written informed consent for use of clinical samples and data was required by the Institutional Review Board at Nagoya University, Japan and was obtained from all patients (18).

Analysis of the nucleotide sequences flanking the AJAP1 transcription initiation site

Nucleotide sequence analysis was conducted to determine the presence of CpG islands around the promoter region of AJAP1. CpG islands were defined as follows: ≥200-bp region with a GC content >50% and CpG:expected CpG ≥0.6 identified using CpG Island Searcher software (http://cpgislands.usc.edu/) (1921).

Methylation-specific polymerase chain reaction (MSP-PCR) and 5-aza-2′-deoxycytidine (5-aza-dC) treatment

Genomic DNA samples from 10 cell lines were subjected to bisulfite treatment, and MSP-PCR was conducted to determine the presence or absence of hypermethylation of the AJAP1 promoter. To evaluate the influence of promoter hypermethylation on AJAP1 transcription, ESCC cells (1.5×106) were treated with 10 μM of the DNA methylation inhibitor 5-aza-dC (Sigma-Aldrich) and cultured for 6 days with medium changes on days 1, 3 and 5.

Bisulfite sequence analysis

Genomic DNAs of ESCC cell lines treated with bisulfite were sequenced to verify the accuracy of the MSP-PCR results. After PCR amplification using specific primers (Table I), PCR products were subcloned into a TA cloning vector (Invitrogen, Carlsbad, CA, USA). The DNAs were mixed with 3 ml of a specific primer (M13) and 4 ml of Cycle Sequence mix (ABI PRISM Terminator v1.1 Cycle Sequencing kit; Applied Biosystems, Foster City, CA, USA). Sequence analysis was conducted using an Applied Biosystems ABI310, and sequence electropherograms were generated using ABI Sequence Analysis 3.0 software (Applied Biosystems) (22).

Table I

Primers and annealing temperature.

Table I

Primers and annealing temperature.

GeneExperimentTypeSequence (5′-3′)Product size (bp)Annealing temperature (°C)
AJAP1qRT-PCRForward GTTAGCACAACGGAGCCTTC10560
Reverse GATGATCTGATGGACAGCCA
MSPForward GGTCGCGAGTTTCGCGTTTC18464
Reverse CCGATCTCCGACTCTCGATC
U-MSPForward GTGTTGATTGGTGGTGGAGT15264
Reverse TCCCAACACACAACTCTTAC
Bisulfite sequencingForward GTTTTTAGGATTTAGGTGAG31660
Reverse CTACTAACTCCTAAAACTAC
SRCqRT-PCRForward CTGACCGCATGGACCGT10758
Reverse AAGCCAACCTGTCACTTGGTA
EZRqRT-PCRForward GATAGTCGTGTTTTCGGGGA9160
Reverse CTCTGCATCCATGGTGGTAA
FAKqRT-PCRForward GCCAAAAGGATTTCTAAACCAG11064
Reverse CCTGGTCCACTTGATCAGCTA
DPYSL3qRT-PCRForward AGAAGAAGGAGGGAGGGAGC11060
Reverse CTCCCTTGATAAGGAGACGG
GAPDHqRT-PCRForward GAAGGTGAAGGTCGGAGTC22660
Probe CAAGCTTCCCGTTCTCAGCC
Reverse GAAGATGGTGATGGGATTTC

[i] AJAP1, adherens junctions associated protein 1; SRC, cellular SRC; EZR, ezrin; FAK, focal adhesion kinase; DPYSL3, dihydropyrimidinase-like 3; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; qRT-PCR, quantitative real-time reverse-transcription polymerase chain reaction; MSP, methylation specific PCR; U-MSP, un-methylation specific PCR.

Quantitative real-time reverse transcription-PCR (qRT-PCR)

The levels of AJAP1 mRNA were determined using qRT-PCR. Total RNA (10 μg) isolated from cell lines, 78 primary ESCCs, and adjacent normal tissues were used as templates for cDNA synthesis. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA levels (TaqMan, GAPDH Control Reagents; Applied Biosystems) were quantified to normalize expression levels. qRT-PCR was performed using the SYBR-Green PCR Core Reagents kit (Applied Biosystems) as follows: one cycle at 95°C for 10 min, 40 cycles at 95°C for 5 sec, and 60°C for 60 sec. All samples were tested in triplicate, and samples without template were included in each PCR plate as negative controls. Real-time detection of SYBR-Green fluorescence was conducted using an ABI StepOnePlus Real-Time PCR system (Applied Biosystems). The expression level of each sample is shown as the value of the AJAP1 amplicon divided by that of GAPDH (23,24). To identify cell adhesion molecules that may interact with AJAP1, 10 cell lines were analyzed using qRT-PCR to determine the expression levels of the ezrin (EZR), focal adhesion kinase (FAK), SRC (SRC), and dihydropyrimidinase-like 3 (DPYSL3) genes (18,25,26). Primers specific for AJAP1, GAPDH, EZR, FAK, SRC, and DPYSL3 are listed in Table I.

Copy number analysis

AJAP1 copy numbers of 10 cell lines were determined using TaqMan Copy Number Assays (Applied Biosystems). Twenty nanograms of genomic DNA was amplified using specific primer pairs according to the manufacturer's instructions. Two assays were employed as follows: upstream (assay ID Hs04540488_cn, chromosome 1, map position 4798221 in AJAP1 intron 2) and downstream (assay ID Hs01575789_cn, chromosome 1, map position 4834502 in the intron 4 to exon 5 of AJAP1 gene). Data were analyzed using CopyCaller software (Invitrogen Life Technologies, Carlsbad, CA, USA). Copy number loss was defined as the copy number value equal to 1 determined in the regions upstream, downstream, or both of the AJAP1 loci.

Statistical analysis

Correlations between the levels of AJAP1 mRNA with those of EZR, FAK, SRC, and DPYSL3 were analyzed using the Spearman's rank correlation test. Differences in the levels of AJAP1 mRNA between ESCC and adjacent normal tissues were analyzed using the Mann-Whitney test. The χ2 test was used to analyze the significance of the association between the expression levels of AJAP1 and clinicopathological parameters. Overall and disease-free survival rates were calculated using the Kaplan-Meier method, and the difference in survival curves was analyzed using the log-rank test. We performed multivariate regression analysis using the Cox proportional hazards model to identify prognostic factors, and variables with P-values <0.05 were entered into the final model. Statistical analyses were performed using JMP 10 software (SAS Institute, Inc., Cary, NC, USA). P<0.05 was considered statistically significant.

Results

Expression, methylation, and copy number analysis of cell lines. AJAP1

harbors a CpG island (length 3305 bases, 70.3% GC, and Observed CpG:Expected CpG=0.883) flanking the transcription initiation site (Fig. 1A). AJAP1 mRNA expression levels differed among the nine ESCC cell lines, and five expressed levels <50% of that of the control FHs74 cells (Fig. 1B). MSP-PCR detected methylation of the DNAs of NUEC2, TE1, TE2, and TTn cells, which expressed reduced levels of AJAP1 mRNA. When we compared the levels of AJAP1 mRNA in ESCC cell lines before and after demethylation, reactivation of AJAP1 transcription was detected in cells with complete methylation of AJAP1 before treatment with 5-aza-dC. Moreover, there was no detectable loss of copy number in ESCC cell lines and FHs74 cells (Fig. 1B).

Bisulfite sequence analysis

Sequence analysis revealed that all CpG sites in TTn DNA (complete methylation) were CG (cytosine and guanine) and that the corresponding positions in NUEC1 DNA (absence of methylation) were TG (thymine and guanine) (Fig. 2). These results confirm the MSP-PCR results.

Analysis of the levels of AJAP1 mRNA and those representing potentially interacting molecules

We evaluated the expression levels of genes encoding other cell adhesion molecules that may functionally interact with AJAP1. The relative expression levels of EZR, FAK, SRC, DPYSL3, and AJAP1 mRNAs in the ESCC and FHs74 cell lines are shown in Fig. 3A. The AJAP1 mRNA levels correlated inversely with those of EZR (correlation coefficient −0.661, P=0.038), and there was no significant correlation with the levels of FAK, SRC and DPYSL3 mRNAs (Fig. 3B).

Clinical significance of AJAP1 mRNA levels

In resected samples, AJAP1 mRNA levels were lower in ESCC tissues compared with those of adjacent normal tissues in 67 (86%) of 78 patients. AJAP1 mRNA levels gradually decreased according to the UICC stage (Fig. 4A). The AJAP1 mRNA levels of 45 patients with ESCC were less than half of those of adjacent normal tissues, and these patients were designated as the ‘downregulated AJAP1 transcription’ group in the following analyses. Downregulation of AJAP1 transcription associated significantly with male individuals but not with clinicopathological factors (Table II). Patients with downregulated AJAP1 transcription were more likely to experience shorter overall survival compared with that of other patients (5-year survival rates were 40 and 66%, respectively; P=0.046) (Fig. 4B). Moreover, the disease-free survival of patients with downregulated AJAP1 transcription was significantly shorter compared with those of other patients (3-year survival rates were 37 and 64%, respectively; P=0.009) (Fig. 4C). Multivariate analysis of disease-free survival identified downregulated AJAP1 transcription as an independent prognostic factor (hazard ratio 2.04, 95% confidence interval (CI), 1.11–3.90; P=0.022) (Table III).

Table II

Association between the expression of AJAP1 mRNA and clinicopathological parameters of 78 patients with squamous cell carcinoma of the esophagus.

Table II

Association between the expression of AJAP1 mRNA and clinicopathological parameters of 78 patients with squamous cell carcinoma of the esophagus.

Clinicopathological parametersDownregulated AJAP1 transcription (n)Other (n)P-value
Age (years)0.874
 <652417
 ≥652116
Gender0.016a
 Male4022
 Female511
Preoperative symptoms0.705
 Absent87
 Present3726
Brinkman index0.167
 <1,0002322
 ≥1,0002211
Excessive alcohol consumption0.453
 Absent99
 Present3624
CEA (ng/ml)0.225
 ≤54228
 >535
SCC (ng/ml)0.240
 ≤1.52724
 >1.5189
Tumor size (cm)0.724
 <5.02016
 ≥5.02517
UICC T factor0.838
 T1–21611
 T3–42922
Differentiation0.961
 Moderate to well3828
 Poor75
Lymphatic involvement0.421
 Absent1010
 Present3523
Vessel invasion0.898
 Absent2821
 Present1712
Intraepithelial spread0.875
 Absent1220
 Present1320
Lymph node metastasis0.522
 Absent2420
 Present2113

{ label (or @symbol) needed for fn[@id='tfn2-ijo-47-05-1811'] } χ2 test.

a Statistically significant (P<0.05).

{ label (or @symbol) needed for fn[@id='tfn4-ijo-47-05-1811'] } CEA, carcinoembryonic antigen; SCC, squamous cell carcinoma-related antigen; UICC, Union for International Cancer Control.

Table III

Prognostic factors for disease-free survival of 78 patients with squamous cell carcinoma of the esophagus.

Table III

Prognostic factors for disease-free survival of 78 patients with squamous cell carcinoma of the esophagus.

UnivariateMultivariate


VariablenHazard ratio95% CIP-valueHazard ratio95% CIP-value
Age (≥65)371.700.87–3.350.119
Gender (male)622.691.06–9.060.0351.860.70–6.450.227
Preoperative symptoms631.290.60–3.200.541
Brinkman index (≥1,000)331.610.83–3.120.153
Excessive alcohol consumption600.990.47–2.320.975
CEA (>5 ng/ml)81.380.47–3.250.521
SCC (>1.5 ng/ml)270.800.37–1.610.539
Tumor size (≥5.0 cm)421.200.62–2.310.591
UICC T factor (T3–4)511.600.79–3.480.197
Tumor differentiation (poor)121.750.74–3.670.186
Lymphatic involvement585.181.85–21.5<0.0014.371.38–19.40.011a
Vessel invasion291.890.97–3.660.0621.390.70–2.760.346
Intraepithelial spread331.020.52–1.970.951
Lymph node metastasis341.920.95–4.180.0691.010.43–2.080.973
Downregulated AJAP1 transcription452.531.26–5.510.0092.191.07–4.900.032a

a Statistically significant in multivariate analysis (P<0.05).

{ label (or @symbol) needed for fn[@id='tfn6-ijo-47-05-1811'] } CI, confidence interval; CEA, carcinoembryonic antigen; SCC, squamous cell carcinoma-related antigen; UICC, Union for International Cancer Control. Univariate analysis was performed using the log-rank test. Multivariate analysis was performed using the Cox proportional hazards model.

Discussion

Despite numerous and intensive recent studies devoted to improving the treatment of esophageal cancer, clinical outcomes remain unsatisfactory as indicated dramatically by 5-year survival rates of 49.3 and 2.8% for localized and metastatic disease, respectively (1,27). To develop novel treatment options for ESCC, molecular biological approaches were applied to identify specific molecular diagnostic markers and therapeutic targets (28). We decided to study AJAP1 for this purpose, because it encodes a transmembrane protein of adherens junctions in epithelial cells that plays pivotal roles in cell growth and migration and is involved in the pathogenesis of glioblastoma (11,13).

Here, we determined the levels of AJAP1 expression in patients with ESCC to determine the underlying regulatory mechanism. We detected reduced levels of AJAP1 mRNA in 78 and 86% of ESCC cell lines and resected ESCC tissues, respectively, and the loss of AJAP1 expression correlated with methylation of the AJAP1 promoter region without loss of copy number. Moreover, AJAP1 transcription was restored when ESCC cell lines were treated with 5-aza-dC. Downregulation of AJAP1 was associated with worse patient outcomes, particularly postoperative recurrence. The present study shows that the levels of AJAP1 mRNA were frequently decreased in ESCC cell lines and tissues, indicating that AJAP1 plays a role in the pathogenesis of ESCC.

In the ESCC cell lines, differentially expressed AJAP1 mRNA, and AJAP1 promoter hypermethylation were detected only in cells with significantly decreased AJAP1 mRNA levels. Further, AJAP1 mRNA levels were increased in cells treated with a DNA methylation inhibitor, indicating that promoter hypermethylation is a pivotal regulatory mechanism of AJAP1 transcription, which is consistent with studies of patients with glioma (11,14,29,30). In contrast, we identified some ESCC cells with reduced expression of AJAP1 mRNA without DNA methylation, leading us to assume that other mechanisms regulate AJAP1 transcription, such as loss of heterozygosity (LOH), because AJAP1 resides within chromosome 1p36, a known hotspot of chromosomal alterations (13,31,32). However, we did not detect a loss of AJAP1 copy number in ESCC cell lines. Because copy number analysis addressed a limited region of the AJAP1 locus, further investigations, including detection of LOH and epigenetic modifications other than DNA methylation are required.

In the present study, we determined the relative levels of mRNAs encoding selected cell adhesion molecules to identify novel proteins that may interact with AJAP1 in ESCC cells. Thus, cell adhesion molecules act coordinately to mediate the migration and invasion of tumor cells (33). We found that the levels of AJAP1 mRNA correlated significantly with those of EZR in ESCC and FHs74 cell lines. EZR is a member of the ezrin-radixin-moesin family and acts as a cross-linker between the plasma membrane and the actin cytoskeleton (34). Inactive EZR is located in the cytoplasm, and its C-terminal domain, an F-actin-binding site, is masked by the EZR N-terminal domain or those of other ERM proteins (35). Moreover, EZR is a key signaling molecule that is involved in a wide variety of cellular processes such as cell adhesion, survival, and motility as well as signal transduction (36,37). Moreover, EZR contributes to tumorigenesis, development, invasion, and metastasis, likely through regulation of adhesion molecules and signaling to other cell membrane channels in tumors, including ESCC (3840). Further, the AKT/EZR/NF-κB signaling pathway regulates the epidermal growth factor-induced epithelial-mesenchymal transition (EMT) in squamous cell carcinoma of the tongue (41). Our present results indicate a possible interaction between AJAP1 and EZR that may provide the first step required to understand the role of AJAP1 in oncogenesis. Further investigation of the correlation between the expression of AJAP1 and EMT-associated molecules are required.

We show here that AJAP1 mRNA levels gradually decreased as a function of UICC tumor stage, highlighting the diagnostic implications of analyzing AJAP1 expression in esophageal tissues. Downregulation of AJAP1 mRNA in ESCC tissues associated significantly with worse prognosis after curative esophagectomy, particularly with disease-free survival. This finding emphasizes that AJAP1 expression is a potential biomarker for patients with ESCC who are susceptible to recurrence.

Taken together, our analyses of AJAP1 promise to improve clinical management of ESCC as follows: i) The expression levels of AJAP1 in biopsy tissue obtained using endoscopic surveillance may identify patients requiring intensive systemic treatment or neoadjuvant therapy; ii) the expression levels of AJAP1 in surgical specimens may predict recurrence and subsequent adverse prognosis, leading to the design of appropriate therapeutic strategies; and iii) demethylating agents targeting AJAP1 may serve as therapeutics. However, this study is limited by its lack of direct functional analysis of AJAP1, and we are unable to conclude that AJAP1 acts a suppressor of ESCC. Further, the mechanisms that regulate AJAP1 expression, other than promoter hypermethylation, remain to be determined. Further studies are therefore necessary to identify the molecular mechanisms underlying the phenotypes of ESCC cells.

In summary, our data suggest that AJAP1 expression is frequently suppressed in ESCC and that hypermethylation of the AJAP1 promoter region is a pivotal regulatory mechanism of AJAP1 expression in ESCC. Downregulation of AJAP1 in ESCC tissues may represent a promising biomarker for predicting ESCC recurrence.

References

1 

Siegel R, Naishadham D and Jemal A: Cancer statistics, 2012. CA Cancer J Clin. 62:10–29. 2012. View Article : Google Scholar : PubMed/NCBI

2 

Oya H, Kanda M, Takami H, Hibino S, Shimizu D, Niwa Y, Koike M, Nomoto S, Yamada S, Nishikawa Y, et al: Overexpression of melanoma-associated antigen D4 is an independent prognostic factor in squamous cell carcinoma of the esophagus. Dis Esophagus. 28:188–195. 2015. View Article : Google Scholar

3 

Enzinger PC and Mayer RJ: Esophageal cancer. N Engl J Med. 349:2241–2252. 2003. View Article : Google Scholar : PubMed/NCBI

4 

Mayne ST and Navarro SA: Diet, obesity and reflux in the etiology of adenocarcinomas of the esophagus and gastric cardia in humans. J Nutr. 132(Suppl): 3467S–3470S. 2002.PubMed/NCBI

5 

Kamangar F, Chow WH, Abnet CC and Dawsey SM: Environmental causes of esophageal cancer. Gastroenterol Clin North Am. 38:27–57. vii2009. View Article : Google Scholar : PubMed/NCBI

6 

Song Y, Li L, Ou Y, Gao Z, Li E, Li X, Zhang W, Wang J, Xu L, Zhou Y, et al: Identification of genomic alterations in oesophageal squamous cell cancer. Nature. 509:91–95. 2014. View Article : Google Scholar : PubMed/NCBI

7 

Tang JC, Lam KY, Law S, Wong J and Srivastava G: Detection of genetic alterations in esophageal squamous cell carcinomas and adjacent normal epithelia by comparative DNA fingerprinting using inter-simple sequence repeat PCR. Clin Cancer Res. 7:1539–1545. 2001.PubMed/NCBI

8 

Hibino S, Kanda M, Oya H, Takami H, Shimizu D, Nomoto S, Hishida M, Niwa Y, Koike M, Yamada S, et al: Reduced expression of DENND2D through promoter hypermethylation is an adverse prognostic factor in squamous cell carcinoma of the esophagus. Oncol Rep. 31:693–700. 2014.

9 

Oya H, Kanda M, Koike M, Iwata N, Niwa Y, Shimizu D, Takami H, Sueoka S, Hashimoto R, Ezaka K, et al: Detection of serum melanoma-associated antigen D4 in patients with squamous cell carcinoma of the esophagus. Dis Esophagus. May 8–2015.(Epub ahead of print). View Article : Google Scholar

10 

Schreiner A, Ruonala M, Jakob V, Suthaus J, Boles E, Wouters F and Starzinski-Powitz A: Junction protein shrew-1 influences cell invasion and interacts with invasion-promoting protein CD147. Mol Biol Cell. 18:1272–1281. 2007. View Article : Google Scholar : PubMed/NCBI

11 

Han L, Zhang KL, Zhang JX, Zeng L, Di CH, Fee BE, Rivas M, Bao ZS, Jiang T, Bigner D, et al: AJAP1 is dysregulated at an early stage of gliomagenesis and suppresses invasion through cytoskeleton reorganization. CNS Neurosci Ther. 20:429–437. 2014. View Article : Google Scholar : PubMed/NCBI

12 

McDonald JM, Dunlap S, Cogdell D, Dunmire V, Wei Q, Starzinski-Powitz A, Sawaya R, Bruner J, Fuller GN, Aldape K, et al: The SHREW1 gene, frequently deleted in oligodendrogliomas, functions to inhibit cell adhesion and migration. Cancer Biol Ther. 5:300–304. 2006. View Article : Google Scholar : PubMed/NCBI

13 

Lin N, Di C, Bortoff K, Fu J, Truszkowski P, Killela P, Duncan C, McLendon R, Bigner D, Gregory S, et al: Deletion or epigenetic silencing of AJAP1 on 1p36 in glioblastoma. Mol Cancer Res. 10:208–217. 2012. View Article : Google Scholar : PubMed/NCBI

14 

Zeng L, Fee BE, Rivas MV, Lin J and Adamson DC: Adherens junctional associated protein-1: A novel 1p36 tumor suppressor candidate in gliomas (Review). Int J Oncol. 45:13–17. 2014.PubMed/NCBI

15 

Kanda M, Shimizu D, Nomoto S, Takami H, Hibino S, Oya H, Hashimoto R, Suenaga M, Inokawa Y, Kobayashi D, et al: Prognostic impact of expression and methylation status of DENN/MADD domain-containing protein 2D in gastric cancer. Gastric Cancer. 18:288–296. 2015. View Article : Google Scholar

16 

Kanda M, Sugimoto H, Nomoto S, Oya H, Hibino S, Shimizu D, Takami H, Hashimoto R, Okamura Y, Yamada S, et al: B cell translocation gene 1 serves as a novel prognostic indicator of hepatocellular carcinoma. Int J Oncol. 46:641–648. 2015.

17 

Long MJ, Jiang CQ, Lam TH, Lin JM, Chan YH, Zhang WS, Jin YL, Liu B, Thomas GN and Cheng KK: Alcohol consumption and electrocardiographic left ventricular hypertrophy and mediation by elevated blood pressure in older Chinese men: The Guangzhou Biobank Cohort Study. Alcohol. 47:473–480. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Tanaka Y, Kanda M, Sugimoto H, Shimizu D, Sueoka S, Takami H, Ezaka K, Hashimoto R, Okamura Y, Iwata N, et al: Translational implication of Kallmann syndrome-1 gene expression in hepatocellular carcinoma. Int J Oncol. 46:2546–2554. 2015.PubMed/NCBI

19 

Kanda M, Shimizu D, Nomoto S, Hibino S, Oya H, Takami H, Kobayashi D, Yamada S, Inokawa Y, Tanaka C, et al: Clinical significance of expression and epigenetic profiling of TUSC1 in gastric cancer. J Surg Oncol. 110:136–144. 2014. View Article : Google Scholar : PubMed/NCBI

20 

Takai D and Jones PA: The CpG island searcher: A new WWW resource. In Silico Biol. 3:235–240. 2003.PubMed/NCBI

21 

Kanda M, Sugimoto H, Nomoto S, Oya H, Shimizu D, Takami H, Hashimoto R, Sonohara F, Okamura Y, Yamada S, et al: Clinical utility of PDSS2 expression to stratify patients at risk for recurrence of hepatocellular carcinoma. Int J Oncol. 45:2005–2012. 2014.PubMed/NCBI

22 

Kanda M, Nomoto S, Oya H, Hashimoto R, Takami H, Shimizu D, Sonohara F, Kobayashi D, Tanaka C, Yamada S, et al: Decreased expression of prenyl diphosphate synthase subunit 2 correlates with reduced survival of patients with gastric cancer. J Exp Clin Cancer Res. 33:882014. View Article : Google Scholar : PubMed/NCBI

23 

Kanda M, Nomoto S, Oya H, Takami H, Hibino S, Hishida M, Suenaga M, Yamada S, Inokawa Y, Nishikawa Y, et al: Downregulation of DENND2D by promoter hypermethylation is associated with early recurrence of hepatocellular carcinoma. Int J Oncol. 44:44–52. 2014.

24 

Kanda M, Oya H, Nomoto S, Takami H, Shimizu D, Hashimoto R, Sueoka S, Kobayashi D, Tanaka C, Yamada S, et al: Diversity of Clinical Implication of B-cell translocation gene 1 expression by histopathologic and anatomic subtypes of gastric cancer. Dig Dis Sci. 60:1256–1264. 2014. View Article : Google Scholar : PubMed/NCBI

25 

Oya H, Kanda M, Sugimoto H, Shimizu D, Takami H, Hibino S, Hashimoto R, Okamura Y, Yamada S, Fujii T, et al: Dihydropyrimidinase-like 3 is a putative hepatocellular carcinoma tumor suppressor. J Gastroenterol. 50:590–600. 2015. View Article : Google Scholar

26 

Kanda M, Nomoto S, Oya H, Shimizu D, Takami H, Hibino S, Hashimoto R, Kobayashi D, Tanaka C, Yamada S, et al: Dihydropyrimidinase-like 3 facilitates malignant behavior of gastric cancer. J Exp Clin Cancer Res. 33:662014. View Article : Google Scholar : PubMed/NCBI

27 

Shim HJ, Shin MH, Kim HN, Kim JH, Hwang JE, Bae WK, Chung IJ and Cho SH: The prognostic significance of FGFR4 Gly388 polymorphism in esophageal squamous cell carcinoma after concurrent chemoradiotherapy. Cancer Res Treat. May 14–2015.(Epub ahead of print). View Article : Google Scholar

28 

Lee HW, Kwon J, Kang MC, Noh MK, Koh JS, Kim JH and Park JH: Overexpression of HSP47 in esophageal squamous cell carcinoma: Clinical implications and functional analysis. Dis Esophagus. May 8–2015.(Epub ahead of print). View Article : Google Scholar

29 

Cogdell D, Chung W, Liu Y, McDonald JM, Aldape K, Issa JP, Fuller GN and Zhang W: Tumor-associated methylation of the putative tumor suppressor AJAP1 gene and association between decreased AJAP1 expression and shorter survival in patients with glioma. Chin J Cancer. 30:247–253. 2011. View Article : Google Scholar : PubMed/NCBI

30 

Zeng L, Kang C, Di C, Fee BE, Rivas M, Lin J and Adamson DC: The adherens junction-associated protein 1 is a negative transcriptional regulator of MAGEA2, which potentiates temozolomide-induced apoptosis in GBM. Int J Oncol. 44:1243–1251. 2014.PubMed/NCBI

31 

Mori T, Nomoto S, Koshikawa K, Fujii T, Sakai M, Nishikawa Y, Inoue S, Takeda S, Kaneko T and Nakao A: Decreased expression and frequent allelic inactivation of the RUNX3 gene at 1p36 in human hepatocellular carcinoma. Liver Int. 25:380–388. 2005. View Article : Google Scholar : PubMed/NCBI

32 

Zhang H, Zhai Y, Hu Z, Wu C, Qian J, Jia W, Ma F, Huang W, Yu L, Yue W, et al: Genome-wide association study identifies 1p36.22 as a new susceptibility locus for hepatocellular carcinoma in chronic hepatitis B virus carriers. Nat Genet. 42:755–758. 2010. View Article : Google Scholar : PubMed/NCBI

33 

Xin M, Dong XW and Guo XL: Role of the interaction between galectin-3 and cell adhesion molecules in cancer metastasis. Biomed Pharmacother. 69:179–185. 2015. View Article : Google Scholar : PubMed/NCBI

34 

Jin T, Jin J, Li X, Zhang S, Choi YH, Piao Y, Shen X and Lin Z: Prognostic implications of ezrin and phosphorylated ezrin expression in non-small cell lung cancer. BMC Cancer. 14:1912014. View Article : Google Scholar : PubMed/NCBI

35 

Bretscher A, Edwards K and Fehon RG: ERM proteins and merlin: Integrators at the cell cortex. Nat Rev Mol Cell Biol. 3:586–599. 2002. View Article : Google Scholar : PubMed/NCBI

36 

Srivastava J, Elliott BE, Louvard D and Arpin M: Src-dependent ezrin phosphorylation in adhesion-mediated signaling. Mol Biol Cell. 16:1481–1490. 2005. View Article : Google Scholar : PubMed/NCBI

37 

Wang X, Liu M and Zhao CY: Expression of ezrin and moesin related to invasion, metastasis and prognosis of laryngeal squamous cell carcinoma. Genet Mol Res. 13:8002–8013. 2014. View Article : Google Scholar : PubMed/NCBI

38 

Xie JJ, Xu LY, Xie YM, Zhang HH, Cai WJ, Zhou F, Shen ZY and Li EM: Roles of ezrin in the growth and invasiveness of esophageal squamous carcinoma cells. Int J Cancer. 124:2549–2558. 2009. View Article : Google Scholar : PubMed/NCBI

39 

Kong J, Li Y, Liu S, Jin H, Shang Y, Quan C, Li Y and Lin Z: High expression of ezrin predicts poor prognosis in uterine cervical cancer. BMC Cancer. 13:5202013. View Article : Google Scholar : PubMed/NCBI

40 

Ghaffari A, Hoskin V, Szeto A, Hum M, Liaghati N, Nakatsu K, LeBrun D, Madarnas Y, Sengupta S and Elliott BE: A novel role for ezrin in breast cancer angio/lymphangiogenesis. Breast Cancer Res. 16:4382014. View Article : Google Scholar : PubMed/NCBI

41 

Wang Y, Lin Z, Sun L, Fan S, Huang Z, Zhang D, Yang Z, Li J and Chen W: Akt/Ezrin Tyr353/NF-κB pathway regulates EGF-induced EMT and metastasis in tongue squamous cell carcinoma. Br J Cancer. 110:695–705. 2014. View Article : Google Scholar :

Related Articles

Journal Cover

November-2015
Volume 47 Issue 5

Print ISSN: 1019-6439
Online ISSN:1791-2423

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Tanaka H, Kanda M, Koike M, Iwata N, Shimizu D, Ezaka K, Sueoka S, Tanaka Y, Takami H, Hashimoto R, Hashimoto R, et al: Adherens junctions associated protein 1 serves as a predictor of recurrence of squamous cell carcinoma of the esophagus. Int J Oncol 47: 1811-1818, 2015
APA
Tanaka, H., Kanda, M., Koike, M., Iwata, N., Shimizu, D., Ezaka, K. ... Kodera, Y. (2015). Adherens junctions associated protein 1 serves as a predictor of recurrence of squamous cell carcinoma of the esophagus. International Journal of Oncology, 47, 1811-1818. https://doi.org/10.3892/ijo.2015.3167
MLA
Tanaka, H., Kanda, M., Koike, M., Iwata, N., Shimizu, D., Ezaka, K., Sueoka, S., Tanaka, Y., Takami, H., Hashimoto, R., Tanaka, C., Yamada, S., Fujii, T., Nakayama, G., Sugimoto, H., Fujiwara, M., Kodera, Y."Adherens junctions associated protein 1 serves as a predictor of recurrence of squamous cell carcinoma of the esophagus". International Journal of Oncology 47.5 (2015): 1811-1818.
Chicago
Tanaka, H., Kanda, M., Koike, M., Iwata, N., Shimizu, D., Ezaka, K., Sueoka, S., Tanaka, Y., Takami, H., Hashimoto, R., Tanaka, C., Yamada, S., Fujii, T., Nakayama, G., Sugimoto, H., Fujiwara, M., Kodera, Y."Adherens junctions associated protein 1 serves as a predictor of recurrence of squamous cell carcinoma of the esophagus". International Journal of Oncology 47, no. 5 (2015): 1811-1818. https://doi.org/10.3892/ijo.2015.3167