Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
February-2016 Volume 48 Issue 2

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2016 Volume 48 Issue 2

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

PIK3R1 targeting by miR-21 suppresses tumor cell migration and invasion by reducing PI3K/AKT signaling and reversing EMT, and predicts clinical outcome of breast cancer

  • Authors:
    • Li-Xu Yan
    • Yan-Hui Liu
    • Jian-Wen Xiang
    • Qi-Nian Wu
    • Lei-Bo Xu
    • Xin-Lan Luo
    • Xiao-Lan Zhu
    • Chao Liu
    • Fang-Ping Xu
    • Dong-Lan Luo
    • Ping Mei
    • Jie Xu
    • Ke-Ping Zhang
    • Jie Chen
  • View Affiliations / Copyright

    Affiliations: Department of Pathology, Guangdong General Hospital, Guangdong Academy of Medical Sciences, Guangzhou, Guangdong, P.R. China, Guangdong Provincial Hospital of Chinese Medicine, Guangzhou, Guangdong, P.R. China, The First Affiliated Hospital of Guangzhou Medical University, Guangzhou, Guangdong, P.R. China, Sun Yat-sen Memorial Hospital, SunYat-sen University, Guangzhou, Guangdong, P.R. China
    Copyright: © Yan et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 471-484
    |
    Published online on: December 10, 2015
       https://doi.org/10.3892/ijo.2015.3287
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

We have previously shown that dysregulation of miR-21 functioned as an oncomiR in breast cancer. The aim of the present study was to elucidate the mechanisms by which miR-21 regulate breast tumor migration and invasion. We applied pathway analysis on genome microarray data and target-predicting algorithms for miR-21 target screening, and used luciferase reporting assay to confirm the direct target. Thereafter, we investigated the function of the target gene phosphoinositide-3-kinase, regulatory subunit 1 (α) (PIK3R1), and detected PIK3R1 coding protein (p85α) by immunohistochemistry and miR-21 by RT-qPCR on 320 archival paraffin-embedded tissues of breast cancer to evaluate the correlation of their expression with prognosis. First, we found that PIK3R1 suppressed growth, invasiveness, and metastatic properties of breast cancer cells. Next, we identified the PIK3R1 as a direct target of miR-21 and showed that it was negatively regulated by miR-21. Furthermore, we demonstrated that p85α overexpression phenocopied the suppression effects of antimiR-21 on breast cancer cell growth, migration and invasion, indicating its tumor suppressor role in breast cancer. On the contrary, PIK3R1 knockdown abrogated antimiR‑21-induced effect on breast cancer cells. Notably, antimiR-21 induction increased p85α, accompanied by decreased p-AKT level. Besides, antimiR-21/PIK3R1-induced suppression of invasiveness in breast cancer cells was mediated by reversing epithelial-mesenchymal transition (EMT). p85α downregulation was found in 25 (7.8%) of the 320 breast cancer patients, and was associated with inferior 5-year disease-free survival (DFS) and overall survival (OS). Taken together, we provide novel evidence that miR-21 knockdown suppresses cell growth, migration and invasion partly by inhibiting PI3K/AKT activation via direct targeting PIK3R1 and reversing EMT in breast cancer. p85α downregulation defined a specific subgroup of breast cancer with shorter 5-year DFS and OS, which may require more aggressive treatment.

Introduction

Breast cancer is a heterogeneous group of malignant tumors (1). Clinicopathological surrogate definitions of subtypes have been used for a long time. However, these subtypes even have subtypes considering their distinct responses to available therapy and clinical outcomes (1,2). Although accumulating evidence supports the use of multi-gene signatures to make distinctions among breast cancer patients, the cost of these assays remains prohibitive (3). The heterogeneity in tumor cell phenotypes make breast tumor categorization a challenging task (1).

The phosphoinositide 3-kinase (PI3K) pathway provides proliferative and migratory signals and is frequently activated in human breast cancer (4–7). The PI3K family of enzymes encompasses class I, II and III, with only class I being involved in human cancer (8–11). Class IA PI3K consists of a catalytic subunit (p110α as a key subunit) and a regulatory subunit (p85α as a key subunit decoded by PIK3R1) (11–13). When lacking upstream signals, p85 stabilizes p110 and suppress its catalytic activities (14). Uchino et al (7) reported that PIK3R1 was significantly downregulated in MDA-MB-231 cells and MCF-7 invasive clone compared with MCF-7 cells, thereby possibly contributing to metastasis development. Another study demonstrated that p85α downregulation was an independent prognostic marker in breast cancer (15). Although the importance of the PI3K/AKT pathway in breast cancer is well known, the function of p85α in breast cancer has not been widely studied.

miR-21-5p (previously named miR-21) is one of the most overexpressed miRNAs in numerous malignancies (16–19). miR-21 targets many important tumor suppressors to promote breast cancer growth, proliferation, migration and metastasis (20–22). We have previously shown that miR-21 was overexpressed in breast cancer and associated with inferior survival (23). We have reported on human genome microarray to screen potential targets of miR-21 (24).

In the present study, to elucidate the mechanisms by which miR-21 regulate breast tumor migration and invasion, we applied pathway enrichment analysis and target-predicting algorithms for the screening target of miR-21. PIK3R1 was predicted to be a functional target of miR-21. We further investigated the regulation of PIK3R1 coding protein p85α by miR-21, the impact of changes in antimiR-21 mediated p85α expression and the clinicopathological and prognostic significance of p85α in breast cancer patients.

Materials and methods

Cell lines

Human breast cancer cell lines (MCF-10A, MDA-MB-231 and BT-474) were purchased from the American Type Culture Collection and cultured according to specifications. Human breast cancer cell lines (MCF-7, BT-549, T47D and SK-BR-3) were purchased from the Cell Bank of Chinese Academy of Sciences. All cells were used within 2 months after resuscitation of frozen aliquots.

Quantification of miRNA and mRNA

Total RNA was isolated from cells and tissues using the Total RNA Purification kit (Norgen Biotek Corp., Thorold, ON, Canada). miR-21 expression was assessed by quantitative reverse transcription-polymerase chain reaction (RT-qPCR) analysis using microRNA PCR system (Exiqon A/S) according to the manufacturer's instructions. RT-qPCR was utilized to analyze expression changes of potential miR-21 targets as previously described (23). Primers for PCR amplifications (Table I) were designed using Primer5.0 Input (version 0.4.0). Relative mRNA levels were calculated using the 2−Δ Δ CT method (25).

Table I

Sequences of RNA and DNA oligonucleotides.

Table I

Sequences of RNA and DNA oligonucleotides.

NameSense strand/sense primer (5′-3′)Antisense strand/antisense primer (5′-3′)
Primers for RT-PCR
 PIK3R1 TTTGCCGAGCCCTATAACT TGCATATACTGGGTAGGCTAGT
 18s rRNA CCTGGATACCGCAGCTAGGA GCGGCGCAATACGAATGCCCC
Primers for the 3′-UTR of PIK3R1 cloning
 PIK3R1 XhoIF ccgctcgagAGCGCTTACTCTTTGATCCTTCTCC
 PIK3R1 NotIR CTATTAGGGTAGTGACCATATTATGGTTG
 mutPIK3R1-1 GTTTTAAATGTACCTTCAGATATTCGATCCCCACCCCAGTTTTTGTT AACAAAAACTGGGGTGGGGATCGAATATCTGAAGGTACATTTAAAAC
 mutPIK3R1-2 GTTTTGTTGGGCAGTGCCTGTATTCGATCAAAGCTGCTTTATTCAAT ATTGAATAAAGCAGCTTTGATCGAATACAGGCACTGCCCAACAAAAC
siRNA duplexes
 PIK3R1-siRNA1 CAAAGGAUUAUGCAUAAUUdTdT AAUUAUGCAUAAUCCUUUGdTdT
 PIK3R1-siRNA2 CCAAUAUUCACUGGUGGAAdTdT UUCCACCAGUGAAUAUUGGdTdT
 PIK3R1-siRNA3 CUAUUGAAGCAUUUAAUCAdTdT UCAUUAAAUGCUUCAAUAGdTdT
 Control-siRNA UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT

[i] RT, reverse transcription primer; F, forward primer; R, reverse primer; 3′-UTR, 3′-untranslated region.

Luciferase reporter assay

The 3′-untranslated region (UTR) of PIK3R1 containing the putative miR-21 target sites was amplified by PCR from genome DNA derived from HEK293T cells. The synthetic mutant 3′-UTR of PIK3R1 was produced by PCR, and then the PCR products were cloned into psiCHECK-2 vector. After digestion by XhoI and NotI, the fragment containing 3′-UTR of PIK3R1 was cloned into psiCHECK-2 vector (Promega, Madison, WI, USA). All inserts were sequenced to verify polymerase fidelity. The PCR primers are listed in Table I. HEK293T cells were cultured in 24-well plates and cotransfected with 200 ng of psiCHECK-2 vector containing 3′-UTR of PIK3R1 and 50 nM of miRNA mimic (Exiqon A/S) per well. Transfections were performed using Lipofectamine® 2000 (Invitrogen, Carlsbad, CA, USA). The luciferase analysis was performed 48 h later using the Dual-luciferase reporter assay system (cat. no. E1910; Promega) according to the manufacturer's protocol. Firefly luciferase activity was normalized to Renilla luciferase activity. miRNA mimic negative control was used as the control miRNA. Experiments were carried out in triplicate.

Cell transfection and transduction

For transient miR-21 knockdown, the LNA-antimiR-21 or LNA-control (Exiqon A/S, Vedbaek, Denmark) were delivered at a final concentration of 50 nM using Lipofectamine 2000 (Invitrogen). For PIK3R1 knockdown, three siRNAs (Sigma-Aldrich, St. Louis, MO, USA) designed against PIK3R1 (GenBank accession no. NM_181523) were included (Table I). One control siRNA (Sigma-Aldrich) exhibiting no significant sequence similarity to human, mouse or rat gene sequence served as a negative control. Transfection was performed with Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. For PIK3R1 overexpression, lentivirus was produced by transfecting HEK 293T packaging cells in DMEM (HyClone, Logan, UT, USA; cat. no. SH30022.01B) with a 3-plasmid system. DNA for transfection was prepared by mixing pHelper 1.0, pHelper 2.0 and pLVX-IRES-Neo-PIK3R1. The empty vector pLVX-IRES-Neo was purchased from Clontech Laboratories (Mountain View, CA, USA; cat. no. 632184), and the plasmid pLVX-IRES-Neo-PIK3R1 was generated by insertion of PIK3R1 sequence. MDA-MB-231 cells were transduced with lentivirus in the presence of 6 μg/ml polybrene (Sigma-Aldrich) for 24 h. Cells were then selected for 7 days in 2.5 mg/ml neomycin. Overexpression of PIK3R1 was confirmed by western blot analysis.

Cell viability and clonogenic assays

Cell growth and viability were measured by MTS-formazan reduction using CellTiter 96 Aqueous One Solution Cell Proliferation Assay (Promega) at 24, 48, 72 and 96 h post-transfection with a vector (empty pcDNA3.1) or PIK3R1. Absorbance was measured at 490 nm using a Multiskan plate reader (Thermo Labsystems, Beverly, MA, USA). Raw values were averaged, and background absorbance (medium without cells) subtracted. For this assay cells were plated at 10,000 cells/well in triplicate for each transfection condition and time-point. Raw values were averaged, and background absorbance (medium without cells) subtracted. The cellular effects of these manipulations were further investigated in MDA-MB-231 and BT-474 cells using clonogenic assays. Briefly, cells were plated on 6-well plates at 100 and 200 cells/well in triplicate and incubated at 37°C under 5% CO2 for 2 days post-transfection. After 2 weeks, plates were washed, fixed in 50% methanol and stained with 0.1% crystal violet and then the number of colonies was counted.

In vivo tumorigenicity assays

Five-week-old female BALB/c-nude mice, provided by Shanghai Laboratory Animal Center, Chinese Academy Sciences (Shanghai, China) were used. Equivalent amounts of MDA-MB-231 cells transfected with PIK3R1 or vector were injected subcutaneously (107 cells/tumor) into the left axilla of nude mice. Mice were weighed, and the longest and the shortest diameters of the tumor were measured every day. The tumor volume (V) was calculated according to the following equation: V = a×b2/2, where a is the longest diameter and b is the shortest diameter of the tumor (26). Thirty-six days after the initial injection, the animals were sacrificed and tumors were extracted and weighed. The ethics guidelines for investigations in conscious animals were followed in all experiments.

Wound healing/migration assay

To assay the migratory response of breast cancer cells to miR-21 inhibitor or PIK3R1 expression, the cellular effects of these manipulations were further investigated using a wound healing assay as previously described (24). Cells were allowed to reach confluence before dragging a 1-ml sterile pipette tip (Axygen Scientific, Inc., Union City, CA, USA) through the monolayer. Cells were washed with PBS to remove cellular debris and allowed to migrate for 48 h. Images were acquired at 0, 6, 24 and 48 h post-wounding with a digital camera system (Leica DFC480; Leica Microsystems, Bannockburn, IL, USA). Cell-free areas were measured with ImageJ software (National Institutes of Health, Bethesda, MD, USA) and were expressed as the percentage of migration compared to control, arbitrarily set at 100% (27). All experiments were carried out in triplicate.

In vitro invasion assay

Invasion of cells in vitro was assayed using the BD BioCoat Matrigel Invasion Chambers and Control Inserts (BD Biosciences, Bedford, MA, USA) respectively. Each well of a 24-well plate contained an insert with an 8-μm pore size polyethylene terephthalate membrane. Cells (1×105 per Transwell) were suspended in serum-free DMEM and seeded into the upper chamber. DMEM containing 2% fetal bovine serum was then added to the bottom chamber of 24-well plates to serve as a chemoattractant. After 48 h of incubation, cells on the upper surface of the filter were removed, and cells that migrated to the lower surface were fixed and stained with 1% toluidine blue. For quantification of cell invasion, 10 fields per experimental condition were randomly selected as previously described (28) and micrographed with IX71 microscope (Olympus, Tokyo, Japan). Images are representative of at least three independent experiments.

Western blots

Cells were harvested and lysed in radio-immunoprecipitation buffer (Upstate Biotechnology, Inc., Lake Placid, NY, USA). Antibodies used for immunoblot analysis were p85α 1:1,000 (Cell Signaling Technology, 13666), p110α 1:1,000 (Cell Signaling Technology, 42336), p-AKT (Ser473) 1:2,000 (Cell Signaling Technology, 4060), AKT 1:1,000 (Cell Signaling Technology, 9272), E-cadherin 1:1,000 (Cell Signaling Technology, 3195), N-cadherin 1:1,000 (Cell Signaling Technology, 13116), vimentin 1:1,000 (Abcam, 92547), FSP1 1:1,000 (Cell Signaling Technology, 13018), snail 1:1,000 (Cell Signaling Technology, 3879) and slug 1:1,000 (Cell Signaling Technology, 9585). GAPDH 1:3,000 (Santa Cruz Biotechnology, sc-32233) or β-actin 1:1,000 (Cell Signaling Technology, 8457) were used as loading controls. All bands were detected using a SuperSignal West Pico Chemiluminescent Substrate (Pierce, Rockford, IL, USA).

Tissue specimens

Eligible patients were women with invasive breast cancer, no special type; operable; no previous chemotherapy; adequate formalin-fixed paraffin-embedded (FFPE) tumor specimens from the pre-treatment biopsy or surgery sample for representation in tissue microarrays (TMAs); outcome data available. Patients with distant metastases or a history of a previous or concomitant malignancy were excluded. The archived FFPE tissues were obtained from the Department of Pathology, Guangdong General Hospital between 2009 and 2012. A consensus diagnosis of invasive breast cancer was confirmed by two expert pathologists according to the fourth edition of the World Health Organization (WHO) classification of tumors of the breast, published in 2012 (29). The surrogate definition of intrinsic subtypes of breast cancer was according to the St Gallen International Expert Consensus 2013 (3). The clinicopathological characteristics of the patients are summarized in Table II. Median follow-up time was 36 months (range, 5–68 months). The Research Ethics Committee of Guangdong General Hospital and Guangdong Academy of Medical Science reviewed and approved the study (no. GDREC2012022H) according to the principles expressed in the Declaration of Helsinki. The Research Ethics Committee specifically waived the need for informed consent for this retrospective study.

Table II

Patient clinicopathological characteristics.

Table II

Patient clinicopathological characteristics.

Patients (N=320)

CharacteristicsNo. of patients%
Median age (range), years50 (25–91)
Clinical stage at diagnosis
 I10934.1
 II14445.0
 III6720.9
Tumor stage (size cm)
 T1 (≤2.0)15749.1
 T2 (>2.0 to ≤5.0)13140.9
 T3 (>5.0)268.1
 T4a61.9
Nodal stage
 N0 (node negative)17855.6
 N1 (1–3 positive nodes)8325.9
 N2 (4–9 positive nodes)3611.3
 N3 (≥10 positive nodes)237.2
Histological grade
 Grade 1165.0
 Grade 217655.0
 Grade 312840.0
Subtypes of breast cancer
 Luminal A-like7122.2
 Luminal B-like18658.1
 HER2 positive (non-luminal)278.4
 Triple negative (ductal)319.7
 Not known51.6
ER status
 Negative6620.6
 Positive25479.4
PR status
 Negative7824.4
 Positive24275.6
HER2 status
 Negative23874.4
 Positive6921.6
 Not known134.1
Surgery
 Mastectomy28187.8
 Breast conservation3912.2
Chemotherapy
 Neoadjuvant chemotherapy7021.9
 Adjuvant chemotherapy16551.6
 Not given8526.6
Targeted therapy
 Herceptin123.8
 No herceptin30896.3

{ label (or @symbol) needed for fn[@id='tfn2-ijo-48-02-0471'] } ER, estrogen receptor; PR, progesterone receptor; HER2, human epidermal growth factor receptor 2.

a T4, tumor of any size with direct extension to the chest wall and/or to the skin.

TMA construction and immunohistochemistry (IHC)

MAs that contained three representative 2.0-mm cores from each tumor of the cases were prepared with a tissue microarrayer (Beecher Instruments, Silver Spring, MD, USA). Immunohistochemical staining was performed using Real EnVision kit (K5007; Dako, Carpinteria, CA, USA) on an automated immunostaining instrument (Leica Bond-Max; Leica Microsystems GmbH, Wetzlar, Germany) according to the manufacturer's instructions. Internal control cores were present in each TMA. Sections were subjected to staining protocols with the anti-PI3 kinase p85α antibody (EP380Y) (Abcam; cat. no. ab40755). A negative control was performed in all cases by omitting the primary antibody, which in all instances resulted in negative immunoreactivity. Positive immunohistochemical staining was defined as a brown cytoplasmic staining for p85α. A semi-quantitative intensity scale ranging from 0 (no staining) to 3+ (the most intense staining) was used by comparing neoplastic cells to adjacent breast cells belonging to normal terminal duct lobular units as previously described (15). p85α downregulation was defined by an IHC score 0, and p85α overexpression by an IHC score 1+ to 3+ (15). The localization and intensity of staining were assessed by two independent pathologists. Hormonal receptors were evaluated with the 1D5 antibody for the estrogen receptor (ER; Dako) and antibody PGR-1A6 for the progesterone receptor (PR; Dako). The human epidermal growth factor receptor 2 (HER2/neu) was detected with CB11 (Dako). Hormonal receptors and gene copy number of HER2 were assessed by IHC staining on 4-μm thick tumor sections from FFPE blocks.

Fluorescein in situ hybridization (FISH)

HER2 amplification status was detected by PathVysion kit (Abbott) according to the manufacturer's instructions. HER2 was defined as amplified when the FISH ratio was 2 or greater.

Statistical analysis

Statistical analysis was prepared using the Statistical Package of MedCalc statistical software (version 12.7.4; MedCalc Software, Mariakerke, Belgium) and Social Sciences (version 20.0; SPSS, Inc., Chicago, IL, USA). The receiver operating characteristic curves were constructed to estimate the optimal cut-off points for of p85α protein and miR-21 as the predictors for disease-free survival (DFS) and overall survival (OS). Pearson's Chi-square test and Spearman rank correlation analysis were used to determine association and correlation between variables. Survival analyses were plotted using Kaplan-Meier curves and compared using the log-rank test. Univariate and multivariate survival analyses were analyzed by Cox proportional hazards regression models. The results were considered statistically significant when two-sided P<0.05.

Results

PIK3R1 suppresses growth, invasiveness and metastatic properties of breast cancer cells

PIK3R1 overexpression significantly reduced proliferation and colony formation capabilities in MDA-MB-231 and BT-474 cell lines as compared to control cells (Fig. 1A–C). In vivo study showed that at the 36th day, the average tumor volume in the PIK3R1 group (3040±812 mm3, mean ± SD) was significantly smaller than that in the control group (Fig. 1D and E; 6258±1263 mm3, P=0.008). Moreover, the average tumor weight in the PIK3R1 group (1.78±1.05 g) was lower than that in the control group (Fig. 1D; 3.46±1.43 g, P=0.046). PIK3R1 overexpression reduced the average percentage of wound healed in both MDA-MB-231 and BT-474 cell lines as measured at 48 h (Fig. 1F and G; P<0.001 for both lines as compared to control lines). We used the BD Biocoat Matrigel Invasion Assay to test the invasive capabilities of MDA-MB-231 and BT-474 cells expressing PIK3R1. For the 2 lines, PIK3R1 strongly reduced the number of invaded cells vs. controls, with the lowest percent invasion in PIK3R1-BT-474 lines (Fig. 1H and I; 4.4%). These data suggest that PIK3R1 plays an important role in the suppression of cell proliferation, migration and invasion of breast cancer cells.

Figure 1

PIK3R1 overexpression reduces breast cancer cell proliferation, clonogenicity, migration and invasion. (A) MTS assays showed that at 48, 72 and 96 h, the PIK3R1 overexpressing lines showed significantly reduced levels of proliferation as compared to control lines. (B) Clonogenic assays performed with MDA-MB-231 and BT-474 cells plated at 200 cells/well. (C) Clonogenic assay showed that PIK3R1 overexpression resulted in a decrease in colony number as compared to control lines. (D) Growth curves for PIK3R1 group (n=6) vs. control (n=6) group in an in vivo proliferation assay. Tumors were weighed after animals were sacrificed at 36 days post-tumor cell injection. (E) Tumors extracted from PIK3R1 group and control group. (F and G) Migration assays performed with PIK3R1 overexpression and control cells. (H and I) Invasion assays in the control and PIK3R1-transfected cells. Data represent mean ± SD. *P<0.05; **P<0.01.

PIK3R1 is a direct target of miR-21

We have previously identified miR-21 as an oncomiR in breast cancer and have used human genome microarray to identify potential targets of miR-21 (24). In the present study, to biologically and metabolically interpret of the array data, we applied pathway enrichment analysis with KEGG (http://www.genome.jp/kegg/), GenMAPP (http://www.genmapp.org/), and BioCarta (http://www.biocarta.com/), and identified a set of interesting genes, including PIK3R1, NFKB2, STAT3 and AK3 (Table III). To narrow down candidate target genes, we applied mRNA target-predicting algorithms (TargetScan, picTar, miRDB, PITA and microRNA.org) based on the presence of binding sites in the 3′-UTR. All the five algorithms identified PIK3R1 as the potential target of miR-21.

Table III

Top three signaling pathways for PIK3R1 in breast cancer cells.

Table III

Top three signaling pathways for PIK3R1 in breast cancer cells.

Pathway analysisPathway nameTotalP-valueQ-valueGene
KEGGRegulation of actin cytoskeleton70.0120.002LIMK1, SLC9A1, GNG12, WASF2, PIK3R1, ARPC4, ACTN4
Insulin signaling pathway50.0240.003FLOT2, PRKCI, PPP1R3C, PIK3R1, PHKA2
Apoptosis40.0250.003APAF1, TRAF2, NFKB2, PIK3R1
GenMAPPLipid binding90.001<0.001PRKCI, ANXA6, SCP2, STARD3, WDFY1, ANXA2, PREX1, PIK3R1, BPI
Kinase activity50.0440.005ADCK4, GALK1, AK3, CARKL, PIK3R1, APAF1, IRF1, TRAF2, PIK3R1
Apoptosis40.0230.003
BioCartaRole of PI3K subunit p85 in regulation of actin organization and cell migration30.001<0.001ACTR2, PIK3R1, ARPC4
EGF signaling pathway30.0040.001STAT3, PIK3R1, MEF2D
PDGF signaling pathway30.0040.001STAT3, PIK3R1, MEF2D
Signaling of hepatocyte growth factor receptor30.0090.002STAT3, PIK3R1, MEF2D
Mechanism of gene regulation by peroxisome proliferators via PPARα30.0200.003PPARBP, EHHADH, PIK3R1

Interestingly, p85α has previously been shown to exert tumor suppressor properties through negative regulation of growth factor signaling (30). PIK3R1 expression was significantly decreased by 18% in breast cancer tissues (31) and cell lines (7), and was associated with decreased survival in breast cancer patients (15). Therefore, we conducted analyses to determine whether miR-21 might target PIK3R1. First, we examined miR-21 and PIK3R1 mRNA in a range of metastatic (BT-474, MDA-MB-231 and BT-549), and non-metastatic (MCF-7, SK-BR-3 and T-47D) human breast cancer cell lines and breast epithelial cell line MCF-10A. All breast cancer lines tested, except SK-BR-3 and T-47D, exhibited elevated levels of miR-21 compared to MCF-10A cells, with corresponding reductions in PIK3R1 levels (Fig. 1A). Next, to establish a direct relationship between miR-21 and the predicted target gene, a luciferase construct containing the 3′-UTR of PIK3R1 was transfected with a miR-21 mimic, or a miRNA-negative control mimic (Fig. 1B); a 44% reduction in luciferase activity was observed only with the miR-21 mimic (Fig. 1C). To further show that miR-21 interacts directly with two seed-binding regions within the 3′-UTR of PIK3R1, two point mutations were generated in each seed-binding region and were denoted as Mut845 and Mut1091 (Fig. 1B). Although a significant reduction in luciferase activity was observed for the WT construct, high luciferase activity was maintained in all of the mutants (Fig. 1C), thereby supporting the direct interaction between miR-21 and these two targeted regions within the PIK3R1 3′-UTR.

AntimiR-21 suppresses tumor growth, invasiveness and metastasis by targeting PIK3R1 via PI3K/AKT signaling

We previously found that LNA-antimiR-21 suppressed breast cancer cell growth and migration in vitro (24). In order to determine whether antimiR-21-induced suppression of growth, invasiveness and metastases of breast cancer cells are indeed executed via PIK3R1, we utilized MDA-MB-231 and BT-474 cells, which express high levels of endogenous miR-21, and transfected them with LNA-antimiR-21. Indeed, inhibition of miR-21 in breast cancer cells resulted in a 7- to 9-fold increase in PIK3R1 mRNA levels (Fig. 3A) and an approximate 3-fold increase in protein (p85α) levels (Fig. 3B). Furthermore, over-expression of miR-21 resulted in a 30–50% reduction in PIK3R1 mRNA levels (Fig. 3A) and an approximate 30% reduction in protein levels (Fig. 3B) in both MDA-MB-231 and BT-474 cells. Concomitant with the increase in p85α, a decrease in PI3K pathway activation was observed, as evidenced by decreased p-AKT expression (Fig. 3C). These results suggest that miR-21-dependent proto-oncogene PI3K/AKT pathway is active in breast cancer cell lines.

Figure 3

The miR-21-dependent proto-oncogene PI3K/AKT pathway is active in breast cancer cell lines. PIK3R1 expression was measured by (A) RT-qPCR and (B) western blot analysis in breast cancer cell lines with upregulated miR-21, miR-21 knockdown or control. (C) Immunoblots using the stated antibodies of lysates from breast cancer cells transfected with LNA-antimiR-21 or LNA-control. GAPDH served as the loading control. Data represent mean ± SD. *P<0.05; **P<0.01.

Moreover, PIK3R1 overexpression phenocopied the suppression effects of LNA-antimiR-21 on cell proliferation and colony formation capabilities. Notably, PIK3R1 knockdown abrogated LNA-antimiR-21-induced suppression of cell proliferation and colony formation capabilities (Fig. 4A–C). LNA-antimiR-21 reduced the average percentage of wound healed in both cell lines as measured at 48 h (P<0.001). In BT-474 cells, PIK3R1 knockdown significantly abrogated LNA-antimiR-21-mediated cell migration (P=0.007). Although not in a statistically significant manner, PIK3R1 knockdown also abrogated LNA-antimiR-21-mediated cell migration in MDA-MB-231 cells (Fig. 4D and E). We used the BD Biocoat Matrigel Invasion Assay to test the invasive capability of MDA-MB-231 and BT-474 cells lacking miR-21. For these lines, LNA-antimiR-21 strongly reduced the number of invaded cells vs. controls, with the lowest percent invasion in the PIK3R1-BT-474 line (Fig. 4F and G; 4.4%). Furthermore, PIK3R1 knockdown significantly abrogated LNA-antimiR-21-mediated cell invasion in MDA-MB-231 (P=0.004) and BT-474 lines (P<0.001). Together, these data support the hypothesis that miR-21 by targeting PIK3R1 promotes breast cancer cell growth, invasion and migration.

Figure 4

AntimiR-21-induced suppression of proliferation, clonogenicity, invasiveness, and metastatic properties of breast cancer cells is mediated by direct repression of PIK3R1. (A) MTS assays were conducted on breast cancer cells after transfection with antimiR-21 (50 nmol/l), antimiR-21 + PIK3R1-shRNA or control. At 48, 72 and 96 h, the antimiR-21 lines showed significantly reduced levels of proliferation as compared to control lines. PIK3R1-shRNA reversed the effect of antimiR-21 on cells. (B) Representative images depicting clonogenic assays performed with cells plated at 200 cells/well. (C) In MDA-MB-231 and BT-474 lines, antimiR-21 resulted in a decrease in colony number as compared to control lines. PIK3R1-shRNA reversed the effect of antimiR-21 on cells. (D) Representative images depicting cell migration assays. (E) Cell migration was quantitated as percentage of wound-healed area from corresponding control and transfected cells. (F) Invasion assays in these control and transfected cells. (G) For each cell line, antimiR-21 resulted in reduced invasion as compared to controls. PIK3R1 knockdown reversed the effect of antimiR-21 on cell migration in both cell lines. (H) MDA-MB-231 and BT-474 lines were transfected with PIK3R1, antimiR-21, antimiR-21 + PIK3R1-shRNA or control, followed by western blot analysis of the indicated EMT-related proteins. Relative E-cadherin, N-cadherin, vimentin, FSP1, snail and slug levels were normalized to the β-actin level. (I) Breast cancer lines were transfected with PIK3R1, antimiR-21, antimiR-21 + PIK3R1-shRNA or control, followed by RT-qPCR analysis of the indicated EMT-related mRNAs. Data represent mean ± SD. *P<0.05; **P<0.01.

AntimiR-21 reverses the epithelial-mesenchymal transition (EMT) target PIK3R1 suppression of invasiveness in breast cancer

To determine whether antimiR-21/PIK3R1-induced suppression of invasiveness in breast cancer cells is mediated by reversing EMT, we transfected the MDA-MB-231 and BT-474 cell lines, which exhibit a mesenchymal phenotype, with antimiR-21 or PIK3R1. Transfection of breast cancer cells with antimiR-21 or PIK3R1 resulted in reversal of EMT, as evidenced by repression of the mesenchymal markers N-cadherin, vimentin, FSP1, snail and slug and induction of the epithelial marker E-cadherin. Furthermore, PIK3R1 shRNA reversed the effect of antimiR-21 or PIK3R1 on EMT (Fig. 4H and I).

p85α downregulation in patient tumor specimens

To establish the relevance of our findings in the patient tumors, we analyzed the expression of miR-21 by RT-qPCR and p85α by IHC in 320 primary human invasive breast cancers, and the adjacent non-tumor-affected epidermis. Alteration of p85α was also verified at the protein level by IHC staining on TMAs. Positive staining of p85α was found in the cytoplasm (Fig. 5A). Tumor cells showed p85α moderate expression, while residual normal mammary epithelial cells presented strong IHC staining intensity (Fig. 5B).

Figure 5

Tissue microarray based immunohistochemical analysis of p85α expression in breast cancer tissues. (A) Representative sections for staining intensity −, +, ++ and +++ of p85α protein are shown. Images were taken at ×40 and ×200 magnification. (B) Breast cancer cells exhibited a weaker p85α expression (staining intensity ++) than surrounding residual normal duct lobular units (staining intensity +++). (C) miR-21 expression in p85α overexpression (p85α +) and p85α downregulation (p85α −) breast cancers was analyzed by RT-qPCR.

Staining scores and log2 of CT values were analyzed using MedCalc statistical software to determine the optimal survival cut-off points for dichotomizing expression of p85α protein and miR-21. The cut points correspond to the maximum Chi-square value of the Kaplan-Meier test for OS between groups above and below the cut-point threshold. p85α down-regulation was found in 25 (7.8%) of the 320 breast cancer patients. miR-21 high expression was found in 119 (37.2%) of 320 patients. Next, we investigated the negative regulation of endogenous p85α protein by endogenous miR-21. Correlation analysis demonstrated that endogenous p85α protein levels were not statistically correlated with miR-21 in the patient tumor specimens (Fig. 5C; rs=−0.109, P=0.052, Spearman's correlation analysis).

Correlation of p85α expression with breast cancer clinicopathological characteristics and prognosis

p85α downregulation was associated with PR positive status (Table IV; P=0.047). No significant correlation was observed between p85α and clinical stage, tumor size, node status, histological grade, ER or HER2 status. miR-21 overexpression was associated with high clinical stage (Table IV; P=0.016). No correlation was observed between miR-21 and other characteristic.

Table IV

Correlation between p85α protein expression and clinicopathological parameters of breast cancer patients.

Table IV

Correlation between p85α protein expression and clinicopathological parameters of breast cancer patients.

p85αmiR-21


CharacteristicsOverexpression (n=295)
N (%)
Downregulation (n=25)
N (%)
P-valueLow (n=201)
N (%)
High (n=119)
N (%)
P-value
Clinical stage
 I100 (34)9 (36)0.86073 (36)36 (30)0.016
 II134 (45)10 (40)96 (48)48 (40)
 III61 (21)6 (24)32 (16)35 (29)
Tumor size (cm)
 ≤2144 (49)13 (52)0.76097 (48)66 (55)0.213
 >2151 (51)12 (48)104 (52)53 (45)
Node
 Negative164 (56)14 (56)0.969118 (59)60 (50)0.149
 Positive131 (44)11 (44)83 (41)59 (50)
Histological grade
 113 (4)3 (12)0.24513 (6)3 (3)0.110
 2163 (55)13 (52)103 (51)73 (61)
 3119 (40)9 (36)85 (42)43 (36)
Subtypes of breast cancer
 Luminal A-like63 (21)8 (32)0.095a43 (21)28 (23)0.095a
 Luminal B-like170 (58)16 (64)113 (56)73 (61)
HER2 positive27 (9)0 (0)18 (9)9 (8)
 Triple negative30 (10)1 (4)24 (12)7 (6)
 Not known5 (2)0 (0)3 (2)2 (2)
ER
 Negative64 (22)2 (8)0.10447 (23)19 (16)0.113
 Positive231 (78)23 (92)154 (77)100 (84)
PR
 Negative76 (26)2 (8)0.04755 (27)23 (19)0.106
 Positive219 (74)23 (92)146 (73)96 (81)
HER2
 Negative218 (74)20 (80)0.467b154 (77)84 (71)0.591b
 Positive65 (22)4 (16)42 (21)27 (23)
 Not known12 (4)1 (4)5 (2)8 (7)

{ label (or @symbol) needed for fn[@id='tfn4-ijo-48-02-0471'] } P-values were derived from Pearson's Chi-square test. Italics indicate significance.

a P-value Luminal A and B vs.

b P-value HER2-negative vs. HER2-positive and triple negative.

Next, we investigated the prognostic impact of p85α and miR-21 expression on breast cancer patients. The survival curves showed that p85α downregulation was significantly associated with inferior 5-year DFS and OS of breast cancer patients (Fig. 6A and B; DFS: P=0.005, OS: P=0.021; log-rank tests). Within early stage stratum, patients with p85α downregulation had inferior 5-year DFS and OS compared to those with p85α overexpression (Fig. 6C and D; P<0.001 for DFS, P=0.004 for OS, log-rank test). However, within the late stage stratum, p85α expression was not related with the patient survival (Fig. 6E and F). Consistent with our previous study in another cohort, high miR-21 expression was significantly associated with inferior 5-year DFS and 5-year OS in this cohort (DFS: P=0.035; OS, P=0.028).

Figure 6

Prognostic impact of p85α protein expression in breast cancer patients. Kaplan-Meier estimates of (A) 5-year DFS and (B) 5-year OS for all patients with p85α overexpression or downregulation. Kaplan-Meier estimates of (C) 5-year DFS and (D) 5-year OS for patients with clinical stage I and II breast cancer. Kaplan-Meier estimates of (E) 5-year DFS and (F) 5-year OS for patients with clinical stage III breast cancer. OS, overall survival; DFS, disease-free survival.

In univariate analysis, p85α downregulation, high miR-21, high clinical stage, tumor size >2 cm, node positive, high histological grade and breast conservation were associated with inferior 5-year DFS and 5-year OS of the breast cancer patients (Table V). While, subtypes of breast cancer, hormone receptor status, HER2 status, and chemotherapy were not associated with inferior 5-year DFS or 5-year OS. Multivariate Cox regression model that incorporated significant factors in the univariate analyses showed that only p85α downregulation and high clinical stage maintained independent prognostic factors for both inferior 5-year OS and DFS (Table VI).

Table V

Univariate Cox models for patients with invasive breast cancer.

Table V

Univariate Cox models for patients with invasive breast cancer.

OSDFS


CharacteristicsHR95% CIPHR95% CIP-value
p85α overexpression vs. downregulation3.061.13–8.310.0282.681.30–5.540.008
miR-21 low vs. high2.471.08–5.650.0331.801.03–3.120.038
Clinical stage I vs. II vs. III4.202.15–8.20 <0.0013.592.35–5.50 <0.001
Tumor size (cm) ≤2 vs. >23.441.28–9.270.0153.821.95–7.46 <0.001
Node negative vs. positive5.382.00–14.450.0013.762.02–6.98 <0.001
Histological grade 1 vs. 2 vs. 32.571.19–5.550.0172.251.47–3.45 <0.001
Subtypes of breast cancer1.250.77–2.040.3711.010.72–1.430.944
ER negative vs. positive0.630.25–1.590.3270.950.46–1.970.891
PR negative vs. positive0.960.36–2.580.9331.190.57–2.460.646
HER2 negative vs. positive0.700.20–2.390.5770.990.48–2.070.991
Mastectomy vs. breast conservation0.500.26–0.950.0330.630.42–0.950.026
Neoadjuvant chemotherapy vs. adjuvant chemotherapy vs. not given0.330.05–2.480.2820.550.20–1.520.246

{ label (or @symbol) needed for fn[@id='tfn7-ijo-48-02-0471'] } Italics indicate significance.

a Sample sizes differ due to complete data set per Cox model.

Table VI

Multivariate Cox model for patients with invasive breast cancer.

Table VI

Multivariate Cox model for patients with invasive breast cancer.

5-year OS5-year DFS


CharacteristicsHR95% CIP-valueaHR95% CIP-valuea
p85α overexpression vs. downregulation3.421.24–9.410.0172.901.39–6.040.004
Clinical stage I vs. II vs. III4.592.27–9.31 <0.0013.342.19–5.10 <0.001

{ label (or @symbol) needed for fn[@id='tfn9-ijo-48-02-0471'] } Italics indicate significance.

a Cox regression forward LR method.

Discussion

In the present study, we present evidence that PIK3R1 is a direct miR-21 target. PIK3R1 phenocopies the effect of miR-21 knockdown. Furthermore, we expanded our previous findings that miR-21 knockdown suppresses cell growth, migration and invasion by inhibiting PI3K/AKT activation via targeting PIK3R1. AntimiR-21/PIK3R1-induced suppression of invasiveness in breast cancer cells is mediated by reversing EMT. Additionally, we show an inverse correlation between p85α expression levels and PR expression in patient tumors. Finally, we demonstrate that p85α is downregulated in patients with invasive breast cancer, indicating an inferior prognosis. Taken together, our data provide novel insight into the regulation of p85α expression in breast cancer and its potential role on prognosis predication.

miR-21 is an oncomiR in breast cancer and targets several tumor suppressor genes important for various cellular processes (22). Here, we show that p85α is downregulated in 7.8% of breast cancer tumors, and is a direct target of miR-21. This finding is consistent with a recent study by Toste et al (32). They demonstrated a direct regulation of p85α by miR-21 and an inverse correlation between miR-21 and p85α expression levels in human pancreatic tumors. However, we did not find a statistically significant correlation between miR-21 and p85α expression levels in patient tumors (P=0.052). We speculate that patient tumor sections for quantitative detection of miR-21, which inevitably contain both normal and malignant cells, are the most possible reason for this inconsistent result.

The protein p85α is necessary for stabilization and membrane recruitment of the p110α subunit of PI3K (6). Loss of the p85α protein leads to downstream PI3K pathway activation (30,32–35). Therefore, the impact of p85α down-regulation on pathway signaling could be caused by the loss of the inhibitory effect of p85α on p110α and PI3K pathway activity (33,36). p85α protein has also been reported to be a positive regulator of PTEN via stabilization of this protein (37,38). Besides, several studies evidenced that PTEN is one of miR-21 targets (21,38,39). These studies support the notion that miR-21 actives PI3K pathway via multiple targets. Our finding that p-AKT levels are decreased after p85α overexpression in breast cancer cells is consistent with these previous observations. In addition, PIK3R1 overexpression phenocopies the effect of miR-21 knockdown on breast cancer cells and PIK3R1 knockdown inversely abrogates LNA-antimiR-21-mediated cell growth and invasion suppression. These findings suggest that PIK3R1 exerts tumor suppressor properties in breast cancer. Furthermore, the concept that p85α downregulation can be protumorigenic (30) is supported by our finding that p85α downregulation is seen in breast cancer tissues when compared with normal tissues. In the present study, this newly identified p85α downregulation by miR-21 has significant importance for interpretation of miR-21 promoting breast cancer cells growth, migration and invasion through the PI3K/AKT pathway.

Prognosis of invasive breast cancer, no special type, is influenced by the classical variables of histological grade, tumor size, lymph node status and clinical stage (14,29,40,41). However, heterogeneity in tumor cell phenotypes make breast tumor categorization a challenging task, especially as it is relevant to therapeutic responses and patient prognosis (1). Our previous study and other research demonstrated that elevated miR-21 could predict unfavorable prognosis in breast cancer patients (23,42–44). In this study, we performed an evaluation of the prognostic significance of p85α, as well as miR-21, in a 320 patient cohort, and confirmed that miR-21 was a prognostic marker for inferior 5-year DFS and 5-year OS in breast cancer patients. Noticeably, p85α downregulation was a prognostic marker for inferior clinical stage. This finding is consistent with the association between p85α downregulation and an inferior prognosis not only in breast cancer (15) but also pancreatic cancer (32,45), hepatocellular cancers (30), neuroblastoma (46) and lung cancers (47). All these results support the notion that p85α plays as a tumor suppressor gene in invasive breast cancer tumors. Additional in vivo studies will be necessary to confirm the relationship between miR-21 and p85α, and the role of p85α in breast cancer.

In conclusion, we provided evidence that PIK3R1 is a direct target of miR-21. miR-21 knockdown induced increased p85α level, accompanied by decreased p-AKT level. miR-21 may play a role in breast cancer development by promoting breast cancer cell growth, migration and invasion partly by inhibiting PI3K/AKT activation via targeting PIK3R1 and reversing EMT. Furthermore, alterations in miR-21 and p85α had a complementary impact on breast cancer patient survival. Finally, p85α downregulation defined a specific subgroup of breast cancer with shorter 5-year DFS and OS, which may require more aggressive treatment.

Acknowledgements

We thank Xin-Chuang Cai and Jia Fu for support with TMAs construction and IHC staining. The present study was funded by the National Natural Science Foundation of China (NSFC, http://www.nsfc.gov.cn/) (grant nos. 81202111 and 81302143), the Guangdong Natural Science Foundation (grant no. S2012040006409), and a National Clinical Key Subject Construction Project Foundation of China. All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. This research involved formalin-fixed paraffin-embedded tissue specimens from breast cancer patients. For retrospective studies formal consent was not required.

References

1 

Polyak K: Heterogeneity in breast cancer. J Clin Invest. 121:3786–3788. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Banerji S, Cibulskis K, Rangel-Escareno C, Brown KK, Carter SL, Frederick AM, Lawrence MS, Sivachenko AY, Sougnez C, Zou L, et al: Sequence analysis of mutations and translocations across breast cancer subtypes. Nature. 486:405–409. 2012. View Article : Google Scholar : PubMed/NCBI

3 

Goldhirsch A, Winer EP, Coates AS, Gelber RD, Piccart-Gebhart M, Thürlimann B, Senn HJ, Albain KS, Andre F, Bergh J, et al: Panel members: Personalizing the treatment of women with early breast cancer: Highlights of the St Gallen International Expert Consensus on the Primary Therapy of Early Breast Cancer 2013. Ann Oncol. 24:2206–2223. 2013. View Article : Google Scholar : PubMed/NCBI

4 

Elkabets M, Vora S, Juric D, Morse N, Mino-Kenudson M, Muranen T, Tao J, Campos AB, Rodon J, Ibrahim YH, et al: mTORC1 inhibition is required for sensitivity to PI3K p110α inhibitors in PIK3CA-mutant breast cancer. Sci Transl Med. 5:196ra992013. View Article : Google Scholar

5 

Myhre S, Lingjærde OC, Hennessy BT, Aure MR, Carey MS, Alsner J, Tramm T, Overgaard J, Mills GB, Børresen-Dale AL, et al: Influence of DNA copy number and mRNA levels on the expression of breast cancer related proteins. Mol Oncol. 7:704–718. 2013. View Article : Google Scholar : PubMed/NCBI

6 

Yuan TL and Cantley LC: PI3K pathway alterations in cancer: Variations on a theme. Oncogene. 27:5497–5510. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Uchino M, Kojima H, Wada K, Imada M, Onoda F, Satofuka H, Utsugi T and Murakami Y: Nuclear beta-catenin and CD44 upregulation characterize invasive cell populations in non-aggressive MCF-7 breast cancer cells. BMC Cancer. 10:4142010. View Article : Google Scholar : PubMed/NCBI

8 

Engelman JA: Targeting PI3K signalling in cancer: Opportunities, challenges and limitations. Nat Rev Cancer. 9:550–562. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Hennessy BT, Smith DL, Ram PT, Lu Y and Mills GB: Exploiting the PI3K/AKT pathway for cancer drug discovery. Nat Rev Drug Discov. 4:988–1004. 2005. View Article : Google Scholar : PubMed/NCBI

10 

Zhao L and Vogt PK: Class I PI3K in oncogenic cellular transformation. Oncogene. 27:5486–5496. 2008. View Article : Google Scholar : PubMed/NCBI

11 

Juric D, Castel P, Griffith M, Griffith OL, Won HH, Ellis H, Ebbesen SH, Ainscough BJ, Ramu A, Iyer G, et al: Convergent loss of PTEN leads to clinical resistance to a PI(3)Kα inhibitor. Nature. 518:240–244. 2015. View Article : Google Scholar :

12 

Brachmann SM, Ueki K, Engelman JA, Kahn RC and Cantley LC: Phosphoinositide 3-kinase catalytic subunit deletion and regulatory subunit deletion have opposite effects on insulin sensitivity in mice. Mol Cell Biol. 25:1596–1607. 2005. View Article : Google Scholar : PubMed/NCBI

13 

Zhao L and Vogt PK: Helical domain and kinase domain mutations in p110alpha of phosphatidylinositol 3-kinase induce gain of function by different mechanisms. Proc Natl Acad Sci USA. 105:2652–2657. 2008. View Article : Google Scholar : PubMed/NCBI

14 

Araújo TG, Paiva CE, Rocha RM, Maia YC, Sena AA, Ueira-Vieira C, Carneiro AP, Almeida JF, de Faria PR, Santos DW, et al: A novel highly reactive Fab antibody for breast cancer tissue diagnostics and staging also discriminates a subset of good prognostic triple-negative breast cancers. Cancer Lett. 343:275–285. 2014. View Article : Google Scholar

15 

Cizkova M, Vacher S, Meseure D, Trassard M, Susini A, Mlcuchova D, Callens C, Rouleau E, Spyratos F, Lidereau R, et al: PIK3R1 underexpression is an independent prognostic marker in breast cancer. BMC Cancer. 13:5452013. View Article : Google Scholar : PubMed/NCBI

16 

Visani M, de Biase D, Marucci G, Cerasoli S, Nigrisoli E, Bacchi Reggiani ML, Albani F, Baruzzi A and Pession A: PERNO study group: Expression of 19 microRNAs in glioblastoma and comparison with other brain neoplasia of grades I–III. Mol Oncol. 8:417–430. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Jamali Z, Asl Aminabadi N, Attaran R, Pournagiazar F, Ghertasi Oskouei S and Ahmadpour F: MicroRNAs as prognostic molecular signatures in human head and neck squamous cell carcinoma: A systematic review and meta-analysis. Oral Oncol. 51:321–331. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Zhang F, Yang Z, Cao M, Xu Y, Li J, Chen X, Gao Z, Xin J, Zhou S, Zhou Z, et al: MiR-203 suppresses tumor growth and invasion and down-regulates MiR-21 expression through repressing Ran in esophageal cancer. Cancer Lett. 342:121–129. 2014. View Article : Google Scholar

19 

Abue M, Yokoyama M, Shibuya R, Tamai K, Yamaguchi K, Sato I, Tanaka N, Hamada S, Shimosegawa T, Sugamura K, et al: Circulating miR-483-3p and miR-21 is highly expressed in plasma of pancreatic cancer. Int J Oncol. 46:539–547. 2015.

20 

Shi Z, Zhang J, Qian X, Han L, Zhang K, Chen L, Liu J, Ren Y, Yang M, Zhang A, et al: AC1MMYR2, an inhibitor of dicer-mediated biogenesis of Oncomir miR-21, reverses epithelial-mesenchymal transition and suppresses tumor growth and progression. Cancer Res. 73:5519–5531. 2013. View Article : Google Scholar : PubMed/NCBI

21 

Li LQ, Li XL, Wang L, Du WJ, Guo R, Liang HH, Liu X, Liang DS, Lu YJ, Shan HL, et al: Matrine inhibits breast cancer growth via miR-21/PTEN/Akt pathway in MCF-7 cells. Cell Physiol Biochem. 30:631–641. 2012. View Article : Google Scholar : PubMed/NCBI

22 

Baffa R, Fassan M, Volinia S, O'Hara B, Liu CG, Palazzo JP, Gardiman M, Rugge M, Gomella LG, Croce CM, et al: MicroRNA expression profiling of human metastatic cancers identifies cancer gene targets. J Pathol. 219:214–221. 2009. View Article : Google Scholar : PubMed/NCBI

23 

Yan LX, Huang XF, Shao Q, Huang MY, Deng L, Wu QL, Zeng YX and Shao JY: MicroRNA miR-21 overexpression in human breast cancer is associated with advanced clinical stage, lymph node metastasis and patient poor prognosis. RNA. 14:2348–2360. 2008. View Article : Google Scholar : PubMed/NCBI

24 

Yan LX, Wu QN, Zhang Y, Li YY, Liao DZ, Hou JH, Fu J, Zeng MS, Yun JP, Wu QL, et al: Knockdown of miR-21 in human breast cancer cell lines inhibits proliferation, in vitro migration and in vivo tumor growth. Breast Cancer Res. 13:R22011. View Article : Google Scholar : PubMed/NCBI

25 

Gramantieri L, Ferracin M, Fornari F, Veronese A, Sabbioni S, Liu CG, Calin GA, Giovannini C, Ferrazzi E, Grazi GL, et al: Cyclin G1 is a target of miR-122a, a microRNA frequently down-regulated in human hepatocellular carcinoma. Cancer Res. 67:6092–6099. 2007. View Article : Google Scholar : PubMed/NCBI

26 

Gao L, Song JR, Zhang JW, Zhao X, Zhao QD, Sun K, Deng WJ, Li R, Lv G, Cheng HY, et al: Chloroquine promotes the anti-cancer effect of TACE in a rabbit VX2 liver tumor model. Int J Biol Sci. 9:322–330. 2013. View Article : Google Scholar

27 

Sun L, Li H, Chen J, Dehennaut V, Zhao Y, Yang Y, Iwasaki Y, Kahn-Perles B, Leprince D, Chen Q, et al: A SUMOylation-dependent pathway regulates SIRT1 transcription and lung cancer metastasis. J Natl Cancer Inst. 105:887–898. 2013. View Article : Google Scholar : PubMed/NCBI

28 

De Bacco F, Luraghi P, Medico E, Reato G, Girolami F, Perera T, Gabriele P, Comoglio PM and Boccaccio C: Induction of MET by ionizing radiation and its role in radioresistance and invasive growth of cancer. J Natl Cancer Inst. 103:645–661. 2011. View Article : Google Scholar : PubMed/NCBI

29 

Sunil RL, Lan OE, Stuart JS, Puay HT and Marc JV: WHO Classification of Tumours. Fred TB, Elain SJ, Sunil RL and Hiroko O: IARC Press; Lyon: pp. 2402012

30 

Taniguchi CM, Winnay J, Kondo T, Bronson RT, Guimaraes AR, Alemán JO, Luo J, Stephanopoulos G, Weissleder R, Cantley LC, et al: The phosphoinositide 3-kinase regulatory subunit p85alpha can exert tumor suppressor properties through negative regulation of growth factor signaling. Cancer Res. 70:5305–5315. 2010. View Article : Google Scholar : PubMed/NCBI

31 

Richardson AL, Wang ZC, De Nicolo A, Lu X, Brown M, Miron A, Liao X, Iglehart JD, Livingston DM and Ganesan S: X chromosomal abnormalities in basal-like human breast cancer. Cancer Cell. 9:121–132. 2006. View Article : Google Scholar : PubMed/NCBI

32 

Toste PA, Li L, Kadera BE, Nguyen AH, Tran LM, Wu N, Madnick DL, Patel SG, Dawson DW and Donahue TR: p85α is a microRNA target and affects chemosensitivity in pancreatic cancer. J Surg Res. 196:285–293. 2015. View Article : Google Scholar : PubMed/NCBI

33 

Shekar SC, Wu H, Fu Z, Yip SC, Nagajyothi, Cahill SM, Girvin ME and Backer JM: Mechanism of constitutive phos-phoinositide 3-kinase activation by oncogenic mutants of the p85 regulatory subunit. J Biol Chem. 280:27850–27855. 2005. View Article : Google Scholar : PubMed/NCBI

34 

Luo J and Cantley LC: The negative regulation of phosphoinositide 3-kinase signaling by p85 and it's implication in cancer. Cell Cycle. 4:1309–1312. 2005. View Article : Google Scholar : PubMed/NCBI

35 

Rabinovsky R, Pochanard P, McNear C, Brachmann SM, Duke-Cohan JS, Garraway LA and Sellers WR: p85 associates with unphosphorylated PTEN and the PTEN-associated complex. Mol Cell Biol. 29:5377–5388. 2009. View Article : Google Scholar : PubMed/NCBI

36 

Jaiswal BS, Janakiraman V, Kljavin NM, Chaudhuri S, Stern HM, Wang W, Kan Z, Dbouk HA, Peters BA, Waring P, et al: Somatic mutations in p85alpha promote tumorigenesis through class IA PI3K activation. Cancer Cell. 16:463–474. 2009. View Article : Google Scholar : PubMed/NCBI

37 

Cheung LW, Hennessy BT, Li J, Yu S, Myers AP, Djordjevic B, Lu Y, Stemke-Hale K, Dyer MD, Zhang F, et al: High frequency of PIK3R1 and PIK3R2 mutations in endometrial cancer elucidates a novel mechanism for regulation of PTEN protein stability. Cancer Discov. 1:170–185. 2011. View Article : Google Scholar : PubMed/NCBI

38 

Darido C, Georgy SR, Wilanowski T, Dworkin S, Auden A, Zhao Q, Rank G, Srivastava S, Finlay MJ, Papenfuss AT, et al: Targeting of the tumor suppressor GRHL3 by a miR-21-dependent proto-oncogenic network results in PTEN loss and tumorigenesis. Cancer Cell. 20:635–648. 2011. View Article : Google Scholar : PubMed/NCBI

39 

Xiong B, Cheng Y, Ma L and Zhang C: MiR-21 regulates biological behavior through the PTEN/PI-3 K/Akt signaling pathway in human colorectal cancer cells. Int J Oncol. 42:219–228. 2013.

40 

Badwe R, Hawaldar R, Parmar V, Nadkarni M, Shet T, Desai S, Gupta S, Jalali R, Vanmali V, Dikshit R, et al: Single-injection depot progesterone before surgery and survival in women with operable breast cancer: A randomized controlled trial. J Clin Oncol. 29:2845–2851. 2011. View Article : Google Scholar : PubMed/NCBI

41 

Uji K, Naoi Y, Kagara N, Shimoda M, Shimomura A, Maruyama N, Shimazu K, Kim SJ and Noguchi S: Significance of TP53 mutations determined by next-generation ‘deep’ sequencing in prognosis of estrogen receptor-positive breast cancer. Cancer Lett. 342:19–26. 2014. View Article : Google Scholar

42 

Müller V, Gade S, Steinbach B, Loibl S, von Minckwitz G, Untch M, Schwedler K, Lübbe K, Schem C, Fasching PA, et al: Changes in serum levels of miR-21, miR-210, and miR-373 in HER2-positive breast cancer patients undergoing neoadjuvant therapy: A translational research project within the Geparquinto trial. Breast Cancer Res Treat. 147:61–68. 2014. View Article : Google Scholar : PubMed/NCBI

43 

Markou A, Yousef GM, Stathopoulos E, Georgoulias V and Lianidou E: Prognostic significance of metastasis-related microRNAs in early breast cancer patients with a long follow-up. Clin Chem. 60:197–205. 2014. View Article : Google Scholar

44 

Lee JA, Lee HY, Lee ES, Kim I and Bae JW: Prognostic implications of MicroRNA-21 overexpression in invasive ductal carcinomas of the breast. J Breast Cancer. 14:269–275. 2011. View Article : Google Scholar

45 

Donahue TR, Tran LM, Hill R, Li Y, Kovochich A, Calvopina JH, Patel SG, Wu N, Hindoyan A, Farrell JJ, et al: Integrative survival-based molecular profiling of human pancreatic cancer. Clin Cancer Res. 18:1352–1363. 2012. View Article : Google Scholar : PubMed/NCBI

46 

Fransson S, Abel F, Kogner P, Martinsson T and Ejeskär K: Stage-dependent expression of PI3K/Akt-pathway genes in neuroblastoma. Int J Oncol. 42:609–616. 2013.

47 

Lu Y, Lemon W, Liu PY, Yi Y, Morrison C, Yang P, Sun Z, Szoke J, Gerald WL, Watson M, et al: A gene expression signature predicts survival of patients with stage I non-small cell lung cancer. PLoS Med. 3:e4672006. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yan L, Liu Y, Xiang J, Wu Q, Xu L, Luo X, Zhu X, Liu C, Xu F, Luo D, Luo D, et al: PIK3R1 targeting by miR-21 suppresses tumor cell migration and invasion by reducing PI3K/AKT signaling and reversing EMT, and predicts clinical outcome of breast cancer. Int J Oncol 48: 471-484, 2016.
APA
Yan, L., Liu, Y., Xiang, J., Wu, Q., Xu, L., Luo, X. ... Chen, J. (2016). PIK3R1 targeting by miR-21 suppresses tumor cell migration and invasion by reducing PI3K/AKT signaling and reversing EMT, and predicts clinical outcome of breast cancer. International Journal of Oncology, 48, 471-484. https://doi.org/10.3892/ijo.2015.3287
MLA
Yan, L., Liu, Y., Xiang, J., Wu, Q., Xu, L., Luo, X., Zhu, X., Liu, C., Xu, F., Luo, D., Mei, P., Xu, J., Zhang, K., Chen, J."PIK3R1 targeting by miR-21 suppresses tumor cell migration and invasion by reducing PI3K/AKT signaling and reversing EMT, and predicts clinical outcome of breast cancer". International Journal of Oncology 48.2 (2016): 471-484.
Chicago
Yan, L., Liu, Y., Xiang, J., Wu, Q., Xu, L., Luo, X., Zhu, X., Liu, C., Xu, F., Luo, D., Mei, P., Xu, J., Zhang, K., Chen, J."PIK3R1 targeting by miR-21 suppresses tumor cell migration and invasion by reducing PI3K/AKT signaling and reversing EMT, and predicts clinical outcome of breast cancer". International Journal of Oncology 48, no. 2 (2016): 471-484. https://doi.org/10.3892/ijo.2015.3287
Copy and paste a formatted citation
x
Spandidos Publications style
Yan L, Liu Y, Xiang J, Wu Q, Xu L, Luo X, Zhu X, Liu C, Xu F, Luo D, Luo D, et al: PIK3R1 targeting by miR-21 suppresses tumor cell migration and invasion by reducing PI3K/AKT signaling and reversing EMT, and predicts clinical outcome of breast cancer. Int J Oncol 48: 471-484, 2016.
APA
Yan, L., Liu, Y., Xiang, J., Wu, Q., Xu, L., Luo, X. ... Chen, J. (2016). PIK3R1 targeting by miR-21 suppresses tumor cell migration and invasion by reducing PI3K/AKT signaling and reversing EMT, and predicts clinical outcome of breast cancer. International Journal of Oncology, 48, 471-484. https://doi.org/10.3892/ijo.2015.3287
MLA
Yan, L., Liu, Y., Xiang, J., Wu, Q., Xu, L., Luo, X., Zhu, X., Liu, C., Xu, F., Luo, D., Mei, P., Xu, J., Zhang, K., Chen, J."PIK3R1 targeting by miR-21 suppresses tumor cell migration and invasion by reducing PI3K/AKT signaling and reversing EMT, and predicts clinical outcome of breast cancer". International Journal of Oncology 48.2 (2016): 471-484.
Chicago
Yan, L., Liu, Y., Xiang, J., Wu, Q., Xu, L., Luo, X., Zhu, X., Liu, C., Xu, F., Luo, D., Mei, P., Xu, J., Zhang, K., Chen, J."PIK3R1 targeting by miR-21 suppresses tumor cell migration and invasion by reducing PI3K/AKT signaling and reversing EMT, and predicts clinical outcome of breast cancer". International Journal of Oncology 48, no. 2 (2016): 471-484. https://doi.org/10.3892/ijo.2015.3287
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team