Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
May-2016 Volume 48 Issue 5

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2016 Volume 48 Issue 5

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Regulation of COX-2 expression and epithelial-to-mesenchymal transition by hypoxia-inducible factor-1α is associated with poor prognosis in hepatocellular carcinoma patients post TACE surgery

  • Authors:
    • Mingsheng Huang
    • Long Wang
    • Junwei Chen
    • Mingjun Bai
    • Churen Zhou
    • Sujuan Liu
    • Qu Lin
  • View Affiliations

    Affiliations: Department of Radiology, The Third Affiliated Hospital, Sun Yat-sen University, Guangzhou 510630, P.R. China, Department of Interventional Radiology, Guangzhou First People's Hospital, Guangzhou Medical University, Guangzhou 510630, P.R. China, Department of Medical Oncology, The Third Affiliated Hospital, Sun Yat-Sen University, Guangzhou 510630, P.R. China
  • Published online on: March 4, 2016     https://doi.org/10.3892/ijo.2016.3421
  • Pages: 2144-2154
  • Copyright: © Huang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Currently, it is not entirely clear whether hypoxia-inducible factor-1α (HIF-1α) is involved in the regulation of COX-2 expression and epithelial-to-mesenchymal transition (EMT), and whether these events affect the prognosis of hepatocellular carcinoma (HCC) patients treated with transcatheter arterial chemoembolization (TACE). In this report the relationship between HIF-1α and COX-2 protein expression, EMT in tumor specimens from HCC patients after TACE surgery and the clinical significance of HIF-1α and COX-2 expression were analyzed using statistical approaches. HepG2 cells treated with CoCl2 was employed as a hypoxia cell model in vitro to study hypoxia-induced HIF-1α, COX-2 expression, and EMT alteration. The results showed that HIF-1α and COX-2 protein expression increased in HCC tissues after TACE surgery. Moreover, there was positive correlation between upregulation of HIF-1α and COX-2. Elevated expression of HIF-1α increased both Snail and Vimentin protein expression, while it reduced E-cadherin protein expression. It was further verified that hypoxia enhanced protein expression of HIF-1α and COX-2 in HepG2 cells treated with CoCl2. Upregulation of HIF-1α and COX-2, together with EMT alteration resulted in increased migration and invasion of HepG2 cells under hypoxia. In conclusion, TACE surgery results in aggravated hypoxia status, leading to increased HIF-1α protein expression in HCC tissue. To adapt to hypoxic environment, HIF-1α stimulates COX-2 protein expression and promotes EMT process in hepatocellular cancer cells, which enhances HCC invasion and metastasis, and might contribute to poor prognosis in HCC patients post TACE treatment.

Introduction

Hepatocellular carcinoma (HCC) is the sixth most common cancer and the third leading cause of cancer-related deaths worldwide. Most HCC patients are diagnosed with the tumor at medium- or late-stage because of poor diagnosis (1–4). Transcatheter arterial chemoembolization (TACE) is considered as an important palliative therapy for late-stage HCC patients (5–7). Ideally, during the TACE treatment, iodine oil should achieve complete embolization and thus tumor necrosis. However, TACE treatment does not attain complete tumor necrosis in the majority of HCC patients, while the hypoxia status after TACE treatment plays a key role in HCC recurrence and metastasis (8,9).

Previous studies have shown that low oxygen environments are prevalent in tumors (10–12). Hypoxia-inducible factor (HIF) is a transcription factor upregulated in response to hypoxia. It is composed of HIF-1α and HIF-1α subunit, and the HIF-1α unit is vital to HIF-1 stability and expression level (13). HIF-1α is involved in transcriptional regulation of a variety of target genes in the growth of various types of cancers. TACE is a common therapeutic approach. However, it might aggravate hypoxia and thus affects HIF-1α protein expression, promoting growth, invasion and metastasis of residual cancer, which is probably the main reason influencing the long-term curative effects for TACE (14–16).

Cyclooxygenase (COX) plays a key role in physiological and pathological regulation (17,18). It consists of two subunits: COX-1 and COX-2. COX-2 is not expressed in physiological condition, while its expression is induced by pathological stimuli, such as cancer, endotoxin and hormones (19,20). It is well documented that COX-2 accelerates cancer invasion and metastasis through inhibiting cancer cell apoptosis and promoting tumor angiogenesis (21–23). High expression of COX-2 is closely correlated with poor prognosis for various types of cancers (24–26). The role of high expression of HIF-1α and COX-2 in clinical prognosis of HCC patients after TACE remains to be completely elucidated.

Epithelial-to-mesenchymal transition (EMT) is a process in which epithelial cells are transmitted to mesenchymal cells that have higher ability of migration (27,28). EMT is regulated by HIF-1α and COX-2, playing an important role in tumor occurrence and metastasis (29,30). The relationship between EMT and HIF-1α, COX-2 protein expression in HCC tissue after TACE surgery is hardly investigated. In this study, we detected HIF-1α and COX-2 protein expression in HCC tissues after TACE surgery and in HepG2 cells treated with hypoxia in vitro. In addition, the relationship between EMT and HIF-1 protein expression was evaluated. This study aimed to provide clues to increasing survival time for HCC patients post TACE.

Materials and methods

Clinical characteristics and medical records

This study complied with the Declaration of Helsinki and the ethics committee of the Third Affiliated Hospital, Sun Yat-Sen University approved the study protocol. Informed consent from all participants was obtained before the initial coronary angiography.

Paired cancer tissues and adjacent normal liver tissues from HCC patients undergoing TACE surgery were prospectively collected between November 2006 and September 2013 at the Third Affiliated Hospital, Sun Yat-Sen University. A total of 51 HCC patients were enrolled in this study, including 48 males and 3 females, and their age ranged from 29 to 72 years (median, 50.5 years). All HCC specimens were procured and processed following standard procedures. The tissue was fixed using 10% formaldehyde solution, embedded within paraffin, and then sectioned into 5-μm slices. The general information of all patients including name, gender and age was collected. Other clinical characteristics including AFP level before surgery, liver function and medical imaging data (CT or MRI), tumor size, tumor number, BCLC stage of cancer, presence of cancer capsule, the presence of vascular invasion and distant metastasis were also recorded. Cancer tissues from 61 HCC patients without TACE surgery were collected and served as controls. Postoperative follow-up was carried out regularly through telephone and letter. The mean postoperative follow-up period was 36.0 months (range, 3.0–75.0 months). Overall survival was calculated from the date of surgery to the date of death or the last follow-up.

Culture of HepG2 cells and hypoxia treatment

HepG2 cells were cultured in DMEM medium with 10% fetal calf serum (FBS, Gibco, USA) at 37°C in a humidified atmosphere containing 5% CO2. Different concentrations of CoCl2 (Sigma, USA) was added into culture medium to mimic the hypoxic microenvironment (31).

CCK-8 assay

HepG2 cells were detached with trypsin and seeded on a 96-well plate (1×104 cells/well). After culture in DMEM culture medium supplemented with 10% FBS to allow cells become adherent, cells were treated with 0, 100, 200 and 300 μM CoCl2 diluted in DMEM/10% FBS for 24 h. Cells without CoCl2 treatment served as controls. Then 10 μl CCK-8 solution was added into each well and the plate was incubated for additional 1 h. Afterwards, the absorbance at 450 nm was measured using a microplate reader. Wells without addition of CCK-8 solution were taken as the blank. The cell viability was calculated using the formula: Cell viability (100%) = (mean OD of CoCl2 group - mean OD of blank group)/mean OD of control group - mean OD of blank group) × 100. We performed 3 parallel repeats in each group. This experiment was carried out independently 3 times.

Quantitative reverse transcription PCR (qRT-PCR) analysis

HepG2 cells (105 cell/ml) were seeded in a 6-well plate and treated with 0, 100, 200 and 300 μM CoCl2 diluted in DMEM/10% FBS for 12 and 24 h. Total RNA was extracted using TRIzol (Invitrogen, USA) according to the manufacturer's instructions. Total RNA (1 μg) was reverse transcribed into cDNA with a reverse transcription kit (Promega, USA). The PCR reaction was carried out in a total of 20 μl reaction mixture using Invitrogen PCR kit and the reactions were performed as follows, 50°C for 2 min, 95°C for 2 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 32 sec. β-actin was used as the endogenous reference to measure the relative expression levels of HIF-1α and COX-2. The primer sequences are shown in Table I.

Table I

The primer sequences.

Table I

The primer sequences.

Forward (5′→3′)Reverse (5′→3′)
HIF-1α AAGCACTAGACAAAGCTCACCTG TTGACCATATCGCTGTCCAC
COX-2 TTGACCATATCGCTGTCCAC TTGACCATATCGCTGTCCAC
β-actin TTGACCATATCGCTGTCCAC TCGGCCACATTGTGAACTTT
Western blot detection

Cells were lyzed in RIPA buffer and centrifuged to extract total protein. Protein concentration of samples was determined using the Bradford assay method. Sample protein (30 μg) was separated in 8% SDS-PAGE and transferred to PVDF membrane. The membrane was blocked with 5% skim milk in TBST, and then incubated with primary antibodies overnight at 4°C using mouse anti-rat HIF-1α polyclonal antibody (Santa Cruz, USA, dilution, 1:300), mouse anti-rat COX-2 polyclonal antibody (Santa Cruz, 1:500) and mouse anti-rat β-actin polyclonal antibody (Santa Cruz, 1:2,000). The next day, after 3 washes in TBST, the membrane was incubated with goat anti-mouse HRP-labeled secondary antibody (Santa Cruz, 1:5,000) for 1 h at room temperature (RT). Bands were developed with an ECL chemiluminescence reagent system (Beyotime, China).

Invasion assay

Melting Matrigel (50 mg/l, BD, USA) was diluted 1:6 with pre-cooled serum-free DMEM culture medium, which was then used to coat the upper membrane surface of the top chamber. Then the Transwell plate was incubated at 37°C for 1.5 h. HepG2 cells were digested using trypsin, centrifuged at 130 × g for 5 min and re-suspended in serum-free DMEM containing 0 or 200 μM CoCl2. Cells/well (1×105) were seeded into the top chamber. DMEM (500 μl)/10% FBS was added in the bottom chamber. After 24-h incubation, the top chamber was taken out and fixed using 4% paraformaldehyde solution for 30 min. After 3 washes with PBS, cells on the upper membrane surface were removed using a cotton swab. Cells on the bottom membrane surface were stained with Giemsa for 8 min followed by washing with PBS, 3 times for 5 min. The number of cells on bottom membrane surface (invading cells) was calculated randomly under a microscope in highly magnified field (q). The experiment was repeated 3 times.

Wound-healing assay

Cells (1 ml) at a density of 4×105 cells/ml were seeded into each well of a 6-well plate and cultured to 100% confluence. The monolayer of cells was then scratched with a 10-μl pipette tip to create a wound gap. After 3 washes with PBS to remove suspended cells, the plate was placed back into an incubator for incubation for an additional 24 and 48 h. Images were taken at 0, 24 and 48 h after the wound was induced to observe the healing of the wound gap.

Immunohistochemistry detection

Tissue slices (4 μm) were deparaffinized using dimethylbenzene, 2 times for 5 min and rehydrated using gradient ethanol. Then slices were soaked in deionized water for 5 min and dried using absorbent paper. Antigen retrieval was carried out by heating the sample in a microwave oven. After cooled down, slices were treated with 3% H2O2 at room temperature for 10 min. Then slices were washed with PBS and blocked with 3% BSA in PBS for 1 h. After blocking, slices was incubated with primary antibody (1:50–200) at 4°C overnight, and subsequently incubated with HRP-labeled secondary antibody (Dako, Canada) at 37°C for 1 h. The slices were then treated with a chromogen, 3,3′-diaminobenzidine tetrahydrochloride (DAB) and counterstained with hematoxylin for 45 sec. Finally, slices were washed with ultrapure water, dehydrated with gradient ethanol, deparaffinized using dimethylbenzene for 10 min, dried and sealed.

Statistical analysis

Data were analyzed using SPSS 13.0 software. Quantity data were expressed as mean ± SD. The Student's t-test was used when 2 groups were compared. Fisher's exact test was used to analyzed the difference between HIF-1α, COX-2 and clinical pathological data. Spearman correlation coefficient was used to determine the relationship between HIF-1α and COX-2 protein expression. Survival analysis was performed using Kaplan-Meier estimate. The survival curves between different groups were analyzed using log-rank test. After the univariate analysis for 14 factors, only variables with P-value <0.05 were included in the multivariate analysis using the Cox proportional hazards model to identify the independent prognostic factors for overall survival. P<0.05 was considered statistically significant.

Results

Increased expression of HIF-1α and COX-2 protein in HCC tissue after TACE surgery

Immunohistochemistry experimental results showed that HIF-1α protein expression in liver cancer tissue significantly increased in 51 cases of HCC patients post TACE, compared with corresponding adjacent noncancerous liver tissue (Fig. 1 and Table II, P=0.001). The positive rate of HIF-1α protein expression in liver cancer tissue from HCC patients without TACE surgery was significantly lower than that in liver cancer tissue from HCC patients post TACE (Fig. 1 and Table II, P=0.013).

Figure 1

HIF-1α protein expression in cancer tissue from an HCC patient post TACE surgery was significantly higher than that of adjacent normal liver tissue and cancer tissue from an HCC patient without TACE surgery.

Table II

HIF-1α and COX-2 protein expression in cancer tissues from HCC patients after TACE surgery.

Table II

HIF-1α and COX-2 protein expression in cancer tissues from HCC patients after TACE surgery.

Positive rate of HIF-1αPositive rate of COX-2
Liver cancer tissue of HCC patient after TACE surgery49.0% (26/51)56.8% (29/51)
Adjacent normal liver tissue of HCC patient after TACE surgery21.6% (11/51)25.5% (13/51)
Liver cancer tissue in HCC patient without TACE surgery34.4% (21/61)47.5% (23/61)

In Fig. 1 and Table II, the immunohistochemistry results showed that COX-2 protein expression in liver cancer tissue of 51 cases of HCC patients post TACE was higher than that in corresponding adjacent noncancerous liver tissue (Fig. 2 and Table II, P=0.001). The positive rate of COX-2 protein expression in liver cancer tissue from HCC patients without TACE surgery was significantly lower than that in liver cancer tissue from HCC patients post TACE (Fig. 2 and Table II, P=0.034).

Figure 2

COX-2 protein expression in cancer tissue from an HCC patient post TACE surgery was significantly higher than that of adjacent normal liver tissue and cancer tissue from an HCC patient without TACE surgery.

The relationship between HIF-1α, COX-2 and clinicopathologic variables

After analysis by Fisher's exact test, our data showed that HIF-1α protein level was significantly higher in groups of BCLC stage A and ALT before surgery ≥40 U/l than groups of BCLC stage B+C and ALT before surgery <40 U/l, respectively (P=0.011 and 0.028, respectively). However, increased protein expression of HIF-1α had no significant difference in groups in terms of age, gender, Childs classification, AFP level, tumor size, tumor number and presence of cancer capsule (Table III). COX-2 protein expression significantly increased in HCC patient with vascular invasion and intrahepatic metastasis (P=0.021 and 0.048, respectively), while it had no significant difference in groups in terms of gender, age, Childs classification, AFP level, tumor size, tumor number and presence of cancer capsule (Table IV, P>0.05).

Table III

HIF-1α expression was statistically different between HCC patients in BCLC stage A and BCLC stage B+C, and patients with high and low level of ALT before surgery (P=0.011, P=0.028, respectively).

Table III

HIF-1α expression was statistically different between HCC patients in BCLC stage A and BCLC stage B+C, and patients with high and low level of ALT before surgery (P=0.011, P=0.028, respectively).

HIF-1α

Clinical characteristicsNo. of patientsPositiveNegativeP-value
Age51
 >60131120.103
 ≤60381424
Gender51
 Male4822260.110
 Female330
Tumor size51
 ≥50 mm2715120.239
 <50 mm241014
Vascular invasion51
 Yes191080.346
 No321518
Capsular infiltration51
 Yes8440.626
 No432122
AFP before surgery (ng/ml)51
 ≥2002914150.564
 <200221111
Tumor number51
 Single2713140.559
 Multiple241212
BCLC stage51
 A17413 0.011a
 B+C342113
GCT level before surgery51
 ≥543215170.457
 <5419109
ALT level before surgery51
 ≥40311912 0.028a
 <4020614
Intrahepatic metastasis51
 Yes3117140.228
 No20812

Table IV

COX-2 expression was statistically different between HCC patients with vascular invasion and without vascular invasion, and HCC patients with intrahepatic metastasis and without intrahepatic metastasis (P=0.021 and P=0.048, respectively).

Table IV

COX-2 expression was statistically different between HCC patients with vascular invasion and without vascular invasion, and HCC patients with intrahepatic metastasis and without intrahepatic metastasis (P=0.021 and P=0.048, respectively).

COX-2

Clinical characteristicsNo. of patientsPositiveNegativeP-value
Age51
 >60131120.059
 ≤60381820
Gender51
 Male4827210.604
 Female321
Tumor size51
 ≥50 mm271890.112
 <50 mm241113
Vascular invasion51
 Yes19208 0.021a
 No32914
Capsular infiltration51
 Yes8620.233
 No432320
AFP before surgery (ng/ml)51
 ≥2002916130.503
 <20022139
Tumor number51
 Single2716110.467
 Multiple241311
BCLC stage51
 A177100.097
 B+C342212
GCT level before surgery51
 ≥543218140.572
 <5419118
ALT level before surgery51
 ≥403120110.139
 <4020911
Intrahepatic metastasis51
 Yes312110 0.048a
 No20812
Reduced survival time in HCC patients with positive expression of HIF-1α and COX-2 protein

Kaplan-Meier test showed that the median survival time of HCC patients with positive HIF-1α protein detection was 27.0 months, significantly shorter than that of 43.0 months in patients with negative HIF-1α protein detection (Fig. 3, P=0.043, log-rank test). In parallel, the median survival time in COX-2 positive patients was 26.0 months, which was significantly shorter than that of 46.0 months in COX-2 negative patients (Fig. 4, P=0.011, log-rank test).

Figure 3

Kaplan-Meier analysis. The median survival time of HCC patients with positive expression of HIF-1α protein was 28.0 months, which was significantly shorter than the median survival time of 45.0 months in HCC patients with negative expression of HIF-1α protein.

Figure 4

Kaplan-Meier analysis. The median survival time of HCC patients with positive expression of COX-2 protein was 26.0 months, which was significantly shorter than the median survival time of 46.0 months in HCC patients with negative expression of COX-2 protein.

Intrahepatic metastasis, tumor size and COX-2 protein expression was associated with prognosis of HCC patients

Univariate analysis showed that several parameters were associated with poor prognosis of HCC, including tumor size, intrahepatic metastasis, HIF-1α expression, COX-2 expression and HIF-1α/COX-2 double expression (Table V). Furthermore, multivariate Cox's proportional hazard regression analysis showed these parameters were independent prognostic factors for HCC patients (P=0.011), indicating that tumor size, intra-hepatic metastasis and COX-2 protein expression were closely associated with poor prognosis of HCC patients (Table VI).

Table V

Univariate analysis showed that tumor size, intrahepatic metastasis, vascular invasion, positive expression of HIF-1α and COX-2α and double-positive expression of HIF-1α plus COX-2 were correlated with prognosis of HCC patients.

Table V

Univariate analysis showed that tumor size, intrahepatic metastasis, vascular invasion, positive expression of HIF-1α and COX-2α and double-positive expression of HIF-1α plus COX-2 were correlated with prognosis of HCC patients.

Clinical characteristicsRR95% CIP-value
Gender0.21.910–2.7560.650
Age1.661.829–2.8360.204
Tumor size9.991.250–2.290 0.002a
Vascular invasion2.1681.210–2.2900.141
Capsular infiltration1.441.731–2.9360.230
AFP0.91.341–2.6590.342
BCLC stage1.5031.527–2.4730.220
Tumor number1.552.249–2.7500.213
GCT0.292.242–2.7580.588
ALT1.42.136–2.8630.228
Intrahepatic metastasis7.21.296–2.205 0.007a
HIF-1α4.351.675–2.325 0.037a
COX-26.41.271–2.729 0.011a
HIF-1α+COX-212.070.928–2.072 0.001a

Table VI

Multivariate analysis showed that tumor size, intrahepatic metastasis and COX-2 expression were the most important risk factors for prognosis of HCC patients.

Table VI

Multivariate analysis showed that tumor size, intrahepatic metastasis and COX-2 expression were the most important risk factors for prognosis of HCC patients.

Clinical characteristicsRR95% CIP-value
Tumor size0.3850.165–0.899 0.027a
Intrahepatic metastasis0.3000.094–0.954 0.041a
Vascular invasion2.2640.816–6.2790.116
HIF-1α0.2840.057–1.4190.125
COX-20.2420.070–0.839 0.025a
HIF-1α+ COX-23.1570.515–24.6950.198
The positive correlation between HIF-1α and COX-2 protein expression

The positive rate of COX-2 protein expression in HCC patients with HIF-1α positive expression was 72.7% (18/25), which was higher than that of 42.3% (11/26) in HIF-1α negative HCC patients. Whereas, the positive rate of HIF-1α protein expression in HCC patients with COX-2 positive expression was higher than that of HCC patients without detectable COX-2 expression [62.1% (18/29) and 31.8% (7/22), respectively]. Spearman rank correlation analysis showed that there was a positive correlation between HIF-1α and COX-2 protein expression (Table VII, P=0.033).

Table VII

HIF-1α protein expression was positively correlated with COX-2 protein expression (P=0.033).

Table VII

HIF-1α protein expression was positively correlated with COX-2 protein expression (P=0.033).

HIF-1α

COX-2PositiveNegativeP-value
Positive18110.033
Negative715
HIF-1α is positively correlated with Snail protein positive expression, while it is negatively correlated with Vimentin protein positive expression

The positive rates of Snail, Vimentin and E-cadherin protein expression in HCC patients with HIF-1α positive expression were 68% (17/25), 72% (18/25) and 16% (4/25), respectively. In contrast, the positive rate of these 3 proteins was 30.8% (8/26), 34.6% (9/26) and 80.7% (21/26), respectively, in patients without detectable HIF-1α expression. Spearman rank correlation analysis showed that HIF-1α expression was positively correlated with Snail and Vimentin protein expression (Table VIII, P=0.007), while it was negatively correlated with E-cadherin expression (Table VIII, P=0.001).

Table VIII

HIF-1α protein expression was positively correlated with Snail and Vimentin protein expression (P=0.001 and 0.007, respectively), while it was negatively correlated with E-cadherin protein expression (P=0.001).

Table VIII

HIF-1α protein expression was positively correlated with Snail and Vimentin protein expression (P=0.001 and 0.007, respectively), while it was negatively correlated with E-cadherin protein expression (P=0.001).

HIF-1α

SnailPositiveNegativeR valueP-value
Positive1780.4510.001
Negative818

HIF-1α

VimentinPositiveNegativeR valueP-value

Positive1890.3470.007
Negative717

HIF-1α

E-cadherinPositiveNegativeR valueP-value

Positive421−0.4910.001
Negative215
CoCl2 decreases HepG2 cell viability

After treated with CoCl2 at concentration of 100 and 200 μM for 24 h, HepG2 cell viability had no significant difference compared with control group (treated with 0 μM CoCl2, Fig. 5, P>0.05). After treated with 300 μM CoCl2 for 24 h, cell viability significantly decreased, compared with control group (Fig. 5, P=0.001).

Figure 5

HepG2 cell viability significantly decreased after treatment with CoCl2 at high concentration for 24 h.

CoCl2 treatments promote HepG2 cell invasion and migration in vitro

After treated with CoCl2 for 24 h, the mean number of HepG2 cells migrated through Matrigel was significantly higher than that of control group (Fig. 6, P<0.001). Moreover, after treated with CoCl2 for 24 and 48 h, HepG2 cell migration was significantly enhanced in a time-dependent manner (Fig. 7, P<0.001).

Figure 6

The ability of invasion of HepG2 cells was enhanced after treatment with 200 μM CoCl2.

Figure 7

Wound healing assay showing that CoCl2 treatment promoted HepG2 cell migration.

Effects of CoCl2 treatment on HIF-1α, COX-2 and EMT protein expression in HepG2 cells

After treated with CoCl2 at different concentrations for 12 h and 24 h, both mRNA and protein expression of HIF-1α and COX-2 significantly increased in the 200 μM CoCl2 treatment group (Figs. 8 and 9, P<0.05 versus control group). Furthermore, after treated with 200 μM CoCl2 for 24 h, we found that E-cadherin protein expression significantly increased compared with control group (Fig. 10, P<0.05), while Vimentin and Snail protein expression decreased compared with control group (Fig. 10, P<0.05).

Figure 8

The results of qRT-PCR show that expression of HIF-1α mRNA increased after treated with CoCl2 in a concentration-dependent manner and reached a peak value when treated with 200 μM CoCl2 for 24 h (A). Consistent with mRNA expression results, HIF-1α protein expression induced by CoCl2 also increased in a concentration-dependent manner (B).

Figure 9

The results of qRT-PCR show that expression of COX-2 mRNA increased after treated with CoCl2 in a concentration-dependent manner and reached a peak value when treated with 200 μM CoCl2 for 24 h (A). Consistent with mRNA expression results, COX-2 protein expression induced by CoCl2 also increased in a concentration-dependent manner (B).

Figure 10

The results of western blot analysis show that hypoxia induced by CoCl2 treatment significantly enhanced HIF-1α, COX-2, Snail and Vimentin protein expression, while it reduced EMT-relevant E-cadherin protein expression.

Discussion

The clinical significance of HIF-1α, COX-2 and EMT in HCC patients after TACE surgery

TACE is considered as an important interventional therapeutic approach to treat patients with hepatocellular carcinoma (HCC). It has several advantages, e.g., it is a minimal invasive procedure rendering short recovery time for patients, and it is tumor-targeted causing fewer side effects. However, in many cases tumor cells can adapt to the highly anaerobic microenvironment resulted from TACE through the negative feed-back response (32). HIF-1α, induced by hypoxia and found to be expressed in many solid tumors, regulates an array of genes to adapt to hypoxic environment, which promotes tumor growth and metastasis. Increased HIF-1α protein expression has been found in prostate cancer, head and neck cancer, ovarian cancer, breast cancer and hepatocellular carcinoma (16,33,34). COX-2 gene whose expression can be induced by HIF-1α has been shown to be upregulated in a variety of malignant tumors and associated with tumor growth and development (20). In this study, we found that the protein levels of HIF-1α and COX-2 in HCC tissue from patients after TACE surgery was significantly higher than that of adjacent normal liver tissue and cancer tissue from HCC patients without TACE surgery. Moreover, after TACE surgery HCC patients with HIF-1α and COX-2 expression had shorter survival time than HCC patients who were HIF-1α and COX-2 negative, indicating that both protein detections might be helpful for the evaluation of prognosis of HCC patients who had TACE. Further analysis also suggested that the prognosis of HCC patients post TACE was related to tumor size, intrahepatic metastasis and COX-2 expression, which were found to be independent prognostic factors for HCC patients. We were unable to conclude that HIF-1α was the most important prognostic factor for HCC patients, which might be due to the small sample size of this study. It is known that TACE triggers inflammatory reactions that we speculated might be the most important prognostic factor, which merits further studies.

In recent years, studies have found that COX-2 is probably a downstream gene in HIF-1α signaling pathway, and its expression is modulated by HIF-1α through the regulation of the specific HRE sequence in the COX-2 promoter (35,36). Both HIF-1α and COX-2 play a key role in the adaptation of hypoxic environment for cancer cells. Our study also showed that HIF-1α expression was positively correlated to COX-2 expression, suggesting that HIF-1α might regulate COX-2 expression and subsequently affect the prognosis of HCC patients after TACE. The details of the regulatory mechanism remains to be explored.

EMT is considered as a key mechanism for tumor recurrence and metastasis. Decreased expression of E-cadherin in the EMT process leads to reduced cell adhesion and thus enhanced tumor cell migration (37). Snail, a key inducing factor of EMT, enhances tumor cell invasion through downregulation of E-cadherin and upregulation of some other related-proteins (38,39). Vimentin, a biomarker of EMT, also is involved in tumor invasion and metastasis and its increased expression is associated with poor prognosis of tumor patients (40). In this study, we found that HIF-1α was positively correlated to Snail and Vimentin expression while negatively correlated to E-cadherin expression. Our data suggested that HIF-1α expression might promote cancer cell EMT, regulate cell motility and migration, and thus affect prognosis of HCC patients after TACE surgery.

Effects of hypoxia on HIF-1α, COX-2 expression and EMT alteration in HepG2 cells

We found that HIF-1α and COX-2 expression increased in tumor tissues from HCC patients after TACE surgery. We further established a hypoxic cell model in vitro induced by CoCl2 treatment. The results showed that both mRNA and protein expression of HIF-1α and COX-2 in HepG2 cell increased after CoCl2 treatment. EMT plays an important role in tumor development and metastasis (27). Studies have shown that both cancer invasion and migration were related to the EMT process (30,41). Consistent with our clinical study results, in vitro study showed that deceased E-cadherin expression and increased expression of Vimentin and Snail were accompanied by enhanced HIF-1α and COX-2 expression induced by hypoxia. Moreover, hypoxia induced by CoCl2 increased the ability of tumor invasion and migration. Our data indicated that increased expression of HIF-1α and COX-2 resulted from hypoxia promoted cancer cell EMT alteration and thus its ability of invasion and migration, which probably is an important factor contributing to the recurrence of HCC after TACE surgery.

In conclusion, taken together, our clinical and in vitro data suggest that TACE produced-hypoxic environment induces HIF-1α expression upregulating COX-2 to promote cancer angiogenesis, inhibiting cancer cell apoptosis and enhancing cancer invasion and migration (20). In addition, increased HIF-1α expression induces EMT alteration, which enhances cancer cell migration and invasion. All these factors might contribute to the poor prognosis of HCC patients post TACE.

Acknowledgements

We thank Professor Zhao-Xing Pan for his kindly statistical advice to this manuscript. This study has received funding by the National Natural Science Foundation of China (81172193 and 81430041).

References

1 

Bruix J and Sherman M; American Association for the Study of Liver Diseases. Management of hepatocellular carcinoma: An update. Hepatology. 53:1020–1022. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Curado M, Edwards B and Shin H: Cancer Incidence in Five Continents. IARC Sci Publ; Lyon: 2007

3 

Ferlay J, Shin HR, Bray F, Forman D, Mathers C and Parkin DM: Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J Cancer. 127:2893–2917. 2010. View Article : Google Scholar

4 

Okuda K: Hepatocellular carcinoma. J Hepatol. 32(Suppl): 225–237. 2000. View Article : Google Scholar : PubMed/NCBI

5 

Cammà C, Schepis F, Orlando A, Albanese M, Shahied L, Trevisani F, Andreone P, Craxì A and Cottone M: Transarterial chemoembolization for unresectable hepatocellular carcinoma: Meta-analysis of randomized controlled trials. Radiology. 224:47–54. 2002. View Article : Google Scholar : PubMed/NCBI

6 

Llovet JM, Real MI, Montaña X, Planas R, Coll S, Aponte J, Ayuso C, Sala M, Muchart J, Solà R, et al; Barcelona Liver Cancer Group. Arterial embolisation or chemoembolisation versus symptomatic treatment in patients with unresectable hepatocellular carcinoma: A randomised controlled trial. Lancet. 359:1734–1739. 2002. View Article : Google Scholar : PubMed/NCBI

7 

Maluccio MA, Covey AM, Porat LB, Schubert J, Brody LA, Sofocleous CT, Getrajdman GI, Jarnagin W, Dematteo R, Blumgart LH, et al: Transcatheter arterial embolization with only particles for the treatment of unresectable hepatocellular carcinoma. J Vasc Interv Radiol. 19:862–869. 2008. View Article : Google Scholar : PubMed/NCBI

8 

Saharinen P, Eklund L, Pulkki K, Bono P and Alitalo K: VEGF and angiopoietin signaling in tumor angiogenesis and metastasis. Trends Mol Med. 17:347–362. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Xu W, Kwon JH, Moon YH, Kim YB, Yu YS, Lee N, Choi KY, Kim YS, Park YK, Kim BW, et al: Influence of preoperative transcatheter arterial chemoembolization on gene expression in the HIF-1α pathway in patients with hepatocellular carcinoma. J Cancer Res Clin Oncol. 140:1507–1515. 2014. View Article : Google Scholar : PubMed/NCBI

10 

Dai CX, Gao Q, Qiu SJ, Ju MJ, Cai MY, Xu YF, Zhou J, Zhang BH and Fan J: Hypoxia-inducible factor-1 alpha, in association with inflammation, angiogenesis and MYC, is a critical prognostic factor in patients with HCC after surgery. BMC Cancer. 9:4182009. View Article : Google Scholar : PubMed/NCBI

11 

Semenza GL: Hypoxia-inducible factor 1: Oxygen homeostasis and disease pathophysiology. Trends Mol Med. 7:345–350. 2001. View Article : Google Scholar : PubMed/NCBI

12 

Valencak J, Kittler H, Schmid K, Schreiber M, Raderer M, Gonzalez-Inchaurraga M, Birner P and Pehamberger H: Prognostic relevance of hypoxia inducible factor-1 alpha expression in patients with melanoma. Clin Exp Dermatol. 34:e962–e964. 2009. View Article : Google Scholar

13 

Hirota K: Hypoxia-inducible factor 1, a master transcription factor of cellular hypoxic gene expression. J Anesth. 16:150–159. 2002. View Article : Google Scholar

14 

Klatte T, Seligson DB, Riggs SB, Leppert JT, Berkman MK, Kleid MD, Yu H, Kabbinavar FF, Pantuck AJ and Belldegrun AS: Hypoxia-inducible factor 1 alpha in clear cell renal cell carcinoma. Clin Cancer Res. 13:7388–7393. 2007. View Article : Google Scholar : PubMed/NCBI

15 

Miyoshi A, Kitajima Y, Ide T, Ohtaka K, Nagasawa H, Uto Y, Hori H and Miyazaki K: Hypoxia accelerates cancer invasion of hepatoma cells by upregulating MMP expression in an HIF-1 alpha-independent manner. Int J Oncol. 29:1533–1539. 2006.PubMed/NCBI

16 

Wu XZ, Xie GR and Chen D: Hypoxia and hepatocellular carcinoma: The therapeutic target for hepatocellular carcinoma. J Gastroenterol Hepatol. 22:1178–1182. 2007. View Article : Google Scholar : PubMed/NCBI

17 

Marnett LJ: Cyclooxygenase mechanisms. Curr Opin Chem Biol. 4:545–552. 2000. View Article : Google Scholar : PubMed/NCBI

18 

Smith WL, DeWitt DL and Garavito RM: Cyclooxygenases: Structural, cellular, and molecular biology. Annu Rev Biochem. 69:145–182. 2000. View Article : Google Scholar : PubMed/NCBI

19 

Wang D and Dubois RN: Prostaglandins and cancer. Gut. 55:115–122. 2006. View Article : Google Scholar

20 

Yang Y, Zhu J, Gou H, Cao D, Jiang M and Hou M: Clinical significance of Cox-2, Survivin and Bcl-2 expression in hepatocellular carcinoma (HCC). Med Oncol. 28:796–803. 2011. View Article : Google Scholar

21 

Erdem H, Gündogdu C and Sipal S: Correlation of E-cadherin, VEGF, COX-2 expression to prognostic parameters in papillary thyroid carcinoma. Exp Mol Pathol. 90:312–317. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Raspollini MR, Amunni G, Villanucci A, Boddi V, Baroni G, Taddei A and Taddei GL: Expression of inducible nitric oxide synthase and cyclooxygenase-2 in ovarian cancer: Correlation with clinical outcome. Gynecol Oncol. 92:806–812. 2004. View Article : Google Scholar : PubMed/NCBI

23 

Shi H, Xu JM, Hu NZ and Xie HJ: Prognostic significance of expression of cyclooxygenase-2 and vascular endothelial growth factor in human gastric carcinoma. World J Gastroenterol. 9:1421–1426. 2003. View Article : Google Scholar : PubMed/NCBI

24 

Karray-Chouayekh S, Trifa F, Khabir A, Boujelbene N, Sellami-Boudawara T, Daoud J, Frikha M, Gargouri A and Mokdad-Gargouri R: Methylation status and overexpression of COX-2 in Tunisian patients with ductal invasive breast carcinoma. Tumour Biol. 32:461–468. 2011. View Article : Google Scholar

25 

Lim SC, Lee TB, Choi CH, Ryu SY, Min YD and Kim KJ: Prognostic significance of cyclooxygenase-2 expression and nuclear p53 accumulation in patients with colorectal cancer. J Surg Oncol. 97:51–56. 2008. View Article : Google Scholar

26 

Shamma A, Yamamoto H, Doki Y, Okami J, Kondo M, Fujiwara Y, Yano M, Inoue M, Matsuura N, Shiozaki H, et al: Up-regulation of cyclooxygenase-2 in squamous carcinogenesis of the esophagus. Clin Cancer Res. 6:1229–1238. 2000.PubMed/NCBI

27 

Kalluri R and Weinberg RA: The basics of epithelial-mesenchymal transition. J Clin Invest. 119:1420–1428. 2009. View Article : Google Scholar : PubMed/NCBI

28 

Thiery JP and Sleeman JP: Complex networks orchestrate epithelial-mesenchymal transitions. Nat Rev Mol Cell Biol. 7:131–142. 2006. View Article : Google Scholar : PubMed/NCBI

29 

Copple BL: Hypoxia stimulates hepatocyte epithelial to mesenchymal transition by hypoxia-inducible factor and transforming growth factor-beta-dependent mechanisms. Liver Int. 30:669–682. 2010. View Article : Google Scholar : PubMed/NCBI

30 

Miladi-Abdennadher I, Abdelmaksoud-Dammak R, Ayed-Guerfali DB, Ayadi L, Khabir A, Amouri A, Frikha F, Tahri N, Ellouz S, Frikha M, et al: Expression of COX-2 and E-cadherin in Tunisian patients with colorectal adenocarcinoma. Acta Histochem. 114:577–581. 2012. View Article : Google Scholar

31 

Zhang YB, Wang X, Meister EA, Gong KR, Yan SC, Lu GW, Ji XM and Shao G: The effects of CoCl2 on HIF-1α protein under experimental conditions of autoprogressive hypoxia using mouse models. Int J Mol Sci. 15:10999–11012. 2014. View Article : Google Scholar : PubMed/NCBI

32 

Wang B, Xu H, Gao ZQ, Ning HF, Sun YQ and Cao GW: Increased expression of vascular endothelial growth factor in hepatocellular carcinoma after transcatheter arterial chemoembolization. Acta Radiol. 49:523–529. 2008. View Article : Google Scholar : PubMed/NCBI

33 

Semenza GL: Hypoxia-inducible factors: Mediators of cancer progression and targets for cancer therapy. Trends Pharmacol Sci. 33:207–214. 2012. View Article : Google Scholar : PubMed/NCBI

34 

Yang MH, Wu MZ, Chiou SH, Chen PM, Chang SY, Liu CJ, Teng SC and Wu KJ: Direct regulation of TWIST by HIF-1 alpha promotes metastasis. Nat Cell Biol. 10:295–305. 2008. View Article : Google Scholar : PubMed/NCBI

35 

Kaidi A, Qualtrough D, Williams AC and Paraskeva C: Direct transcriptional up-regulation of cyclooxygenase-2 by hypoxiainducible factor (HIF)-1 promotes colorectal tumor cell survival and enhances HIF-1 transcriptional activity during hypoxia. Cancer Res. 66:6683–6691. 2006. View Article : Google Scholar : PubMed/NCBI

36 

Schmedtje JF Jr, Ji YS, Liu WL, DuBois RN and Runge MS: Hypoxia induces cyclooxygenase-2 via the NF-kappaB p65 transcription factor in human vascular endothelial cells. J Biol Chem. 272:601–608. 1997. View Article : Google Scholar : PubMed/NCBI

37 

Hashiguchi M, Ueno S, Sakoda M, Iino S, Hiwatashi K, Minami K, Ando K, Mataki Y, Maemura K, Shinchi H, et al: Clinical implication of ZEB-1 and E-cadherin expression in hepatocellular carcinoma (HCC). BMC Cancer. 13:5722013. View Article : Google Scholar : PubMed/NCBI

38 

Liu S, Kumar SM, Martin JS, Yang R and Xu X: Snail1 mediates hypoxia-induced melanoma progression. Am J Pathol. 179:3020–3031. 2011. View Article : Google Scholar : PubMed/NCBI

39 

Woo HY, Min AL, Choi JY, Bae SH, Yoon SK and Jung CK: Clinicopathologic significance of the expression of Snail in hepatocellular carcinoma. Korean J Hepatol. 17:12–18. 2011. View Article : Google Scholar : PubMed/NCBI

40 

Shirahata A, Sakata M, Sakuraba K, Goto T, Mizukami H, Saito M, Ishibashi K, Kigawa G, Nemoto H, Sanada Y, et al: Vimentin methylation as a marker for advanced colorectal carcinoma. Anticancer Res. 29:279–281. 2009.PubMed/NCBI

41 

Shi Y, Wu H, Zhang M, Ding L, Meng F and Fan X: Expression of the epithelial-mesenchymal transition-related proteins and their clinical significance in lung adenocarcinoma. Diagn Pathol. 8:892013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Huang M, Wang L, Chen J, Bai M, Zhou C, Liu S and Lin Q: Regulation of COX-2 expression and epithelial-to-mesenchymal transition by hypoxia-inducible factor-1α is associated with poor prognosis in hepatocellular carcinoma patients post TACE surgery. Int J Oncol 48: 2144-2154, 2016.
APA
Huang, M., Wang, L., Chen, J., Bai, M., Zhou, C., Liu, S., & Lin, Q. (2016). Regulation of COX-2 expression and epithelial-to-mesenchymal transition by hypoxia-inducible factor-1α is associated with poor prognosis in hepatocellular carcinoma patients post TACE surgery. International Journal of Oncology, 48, 2144-2154. https://doi.org/10.3892/ijo.2016.3421
MLA
Huang, M., Wang, L., Chen, J., Bai, M., Zhou, C., Liu, S., Lin, Q."Regulation of COX-2 expression and epithelial-to-mesenchymal transition by hypoxia-inducible factor-1α is associated with poor prognosis in hepatocellular carcinoma patients post TACE surgery". International Journal of Oncology 48.5 (2016): 2144-2154.
Chicago
Huang, M., Wang, L., Chen, J., Bai, M., Zhou, C., Liu, S., Lin, Q."Regulation of COX-2 expression and epithelial-to-mesenchymal transition by hypoxia-inducible factor-1α is associated with poor prognosis in hepatocellular carcinoma patients post TACE surgery". International Journal of Oncology 48, no. 5 (2016): 2144-2154. https://doi.org/10.3892/ijo.2016.3421
Copy and paste a formatted citation
x
Spandidos Publications style
Huang M, Wang L, Chen J, Bai M, Zhou C, Liu S and Lin Q: Regulation of COX-2 expression and epithelial-to-mesenchymal transition by hypoxia-inducible factor-1α is associated with poor prognosis in hepatocellular carcinoma patients post TACE surgery. Int J Oncol 48: 2144-2154, 2016.
APA
Huang, M., Wang, L., Chen, J., Bai, M., Zhou, C., Liu, S., & Lin, Q. (2016). Regulation of COX-2 expression and epithelial-to-mesenchymal transition by hypoxia-inducible factor-1α is associated with poor prognosis in hepatocellular carcinoma patients post TACE surgery. International Journal of Oncology, 48, 2144-2154. https://doi.org/10.3892/ijo.2016.3421
MLA
Huang, M., Wang, L., Chen, J., Bai, M., Zhou, C., Liu, S., Lin, Q."Regulation of COX-2 expression and epithelial-to-mesenchymal transition by hypoxia-inducible factor-1α is associated with poor prognosis in hepatocellular carcinoma patients post TACE surgery". International Journal of Oncology 48.5 (2016): 2144-2154.
Chicago
Huang, M., Wang, L., Chen, J., Bai, M., Zhou, C., Liu, S., Lin, Q."Regulation of COX-2 expression and epithelial-to-mesenchymal transition by hypoxia-inducible factor-1α is associated with poor prognosis in hepatocellular carcinoma patients post TACE surgery". International Journal of Oncology 48, no. 5 (2016): 2144-2154. https://doi.org/10.3892/ijo.2016.3421
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team