Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
January-2017 Volume 50 Issue 1

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2017 Volume 50 Issue 1

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

CD44-shRNA recombinant adenovirus inhibits cell proliferation, invasion, and migration, and promotes apoptosis in HCT116 colon cancer cells

  • Authors:
    • Soo Young Lee
    • Kyung Ae Kim
    • Chang Hyun Kim
    • Young Jin Kim
    • Jae-Hyuk Lee
    • Hyeong Rok Kim
  • View Affiliations / Copyright

    Affiliations: Division of Colorectal Surgery, Department of Surgery, Chonnam National University Medical School and Hwasun Hospital, Hwasun-gun, Jeonnam 58128, Republic of Korea, Department of Pathology, Chonnam National University Medical School and Hwasun Hospital, Hwasun-gun, Jeonnam 58128, Republic of Korea
  • Pages: 329-336
    |
    Published online on: December 9, 2016
       https://doi.org/10.3892/ijo.2016.3801
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The cell-surface glycoprotein CD44 is closely associated with cell proliferation, tumor invasion, and metastasis. Previous studies have reported that knockdown of CD44 with short hairpin RNA (shRNA) reduced cell proliferation and migration, and induced apoptosis. However, more efficient means of delivering small interference RNA are still necessary. We developed an in vitro model of CD44-shRNA recombinant adenovirus (Ad-CD44-shRNA) and evaluated its ability to alter tumor invasion, migration, and apoptosis in human colon cancer cells. An shRNA against CD44 was used for knockdown of CD44 expression, and recombinant adenovirus was constructed using AD293 cells. The Ad-CD44-shRNA-treated HCT116 colon cancer cells showed a significant decrease in cell proliferation, migration, and invasion, while apoptosis was increased. The Ad-CD44-shRNA also decreased the phosphorylation of Akt and GSK-3β. The levels of Bcl-2 and Bcl-xL expression were downregulated, whereas the expression levels of Bax, cleaved caspase‑3 and -9, and PARP were increased in Ad-CD44-shRNA-treated colon cancer cells. These results support the feasibility of an adenovirus-mediated RNA interference therapy targeting human colon cancer via the CD44 as a potential future therapeutic intervention.

Introduction

Colorectal cancer is one of the most common malignancies causing mortality in the world (1). However, current knowledge of molecular carcinogenesis in the development of colorectal cancer is still limited. Although significant advances have been achieved, more effective therapeutic options for advanced colorectal cancer are still needed, and many efforts have been made to develop novel treatments for targeting tumor-specific genes.

Emerging evidence suggests that specific sub-populations of cancer cells with stem cell characteristics within the bulk of tumors are implicated in the pathogenesis of heterogeneous malignant tumors (2–4). To study the behavior of cancer stem cells (CSCs), markers for prospective isolation of CSCs are crucial. CD44 has been proposed as one of the CSC markers of colorectal cancer (2,4,5). CD44 is a transmembrane glycoprotein acting as a cell adhesion molecule through the binding to hyaluronic acid, and plays a key role in remodeling and degradation of hyaluronic acid (4). Furthermore, CD44 is involved in fundamental aspects of cancer cell biology such as tumor stem cell phenotype, cell adhesion, invasion, and metastasis (6). Several studies have shown that CD44 expression was associated with tumor progression, metastasis, and poor prognosis (7–10).

Recent studies have reported that knockdown of CD44 resulted in the inhibition of tumor growth and metastasis (11–13). In our previous studies, we have shown that CD44 enhanced the epithelial-mesenchymal transition, which is associated with colon cancer invasion (14), and that knockdown of CD44 expression using inducible short hairpin RNA (shRNA) significantly reduced cell proliferation, invasion, and migration (13). The therapeutic effect of RNA interference depends on the stability and tissue specificity of small interference RNA (siRNA) and the efficiency of siRNA transduction. We have previously used plasmids to suppress CD44 expression (13); however, the efficiency of plasmid delivery remains poor. Therefore, more efficient means of delivering therapeutic siRNA are necessary. One promising therapeutic modality is the use of oncolytic viruses, which have cancer specificity and also act as a vector for stable introduction of siRNA (15,16).

Here, we developed an in vitro model using CD44-shRNA recombinant adenovirus, and evaluated the impact of CD44 knockdown adenovirus on proliferation, invasion, migration, and apoptosis of colon cancer cells.

Materials and methods

Cell culture

The HCT116 human colon cancer cells were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). The cells were routinely maintained in complete medium (DMEM; Lonza, Walkersville, MN, USA) supplemented with 10% fetal bovine serum (FBS; Biowest, Nuaillé, France), 50 U/ml penicillin, and 50 µg/ml streptomycin (Lonza) at 37°C in a humidified incubator with 5% CO2.

Construction of shRNA-CD44 plasmid

The shRNA with vector was purchased from OriGene (OriGene Technologies, Inc., Rockville, MD, USA). The shRNA-CD44 (sense: GACAGAAAGCCAAGTGGACTCAACGGAGA) and pGFP-V-RS vectors, the latter of which contained an ineffective shRNA cassette against GFP, were used for knockdown of CD44 expression.

Construction of recombinant adenovirus

The human shRNA targeting the CD44 sequence and a negative control scrambled sequence were each amplified by polymerase chain reaction (PCR) from plasmids containing the 29-mer shRNA construct using primers containing KpnI and XbaI restriction sites (Enzynomics, Daejeon, Korea). Purified (Qiagen, Valencia, CA, USA) PCR products and adenovirus shuttle plasmids (Agilent Technologies, Palo Alto, CA, USA) were digested with KpnI and XbaI, ligated with T4 DNA ligase (Promega, Madison, WI, USA), and then transformed into DH5a chemically competent E. coli. Miniprepped DNA of the different clones was analyzed on a 0.8% agarose gel and the correct clones were confirmed by DNA sequencing.

Clones carrying the correct target sequences were selected, linearized with PmeI, subcloned into the pAdEasy-1 backbone, and transformed into BJ5183 bacteria. Recombinant adenoviral plasmids were selected against kanamycin and screened by diagnostic digestions. These plasmids were then digested by PacI, and the larger fragments were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) into AD293 cells (Stratagene, La Jolla, CA, USA). After 11–13 days, the recombinant adenoviruses were collected after freeze-thaw lysis of the AD293 cells. The primary viral stock was used to infect new AD293 cells for 2–3 days to produce a bulk viral stock. Infected cells exhibiting cytopathic effects were lysed for collection of the virus.

Viral particles were purified and concentrated using the Vivapure AdenoPACK™20 RT (Sartorius Stedim Biotech, Göttingen, Germany) kit. The viral particle concentration was determined by measuring absorbance at 260 nm, and a standard TCID50 (50% tissue culture infective dose) assay was performed on AD293 cells to determine the infectious virus titer (17). Purified viral particles were stored at −70°C until use.

Adenoviral infection

The HCT116 colon cancer cells were seeded onto a 6-well plate at a density of 0.1×106 cells/ml, cultured overnight, and infected with serially diluted concentrations of recombinant adenovirus. After a 24-h incubation, the previous growth medium was removed and fresh complete growth medium was added, and treated with adenoviral aliquots with or without shRNA-CD44.

Reverse transcription PCR (RT-PCR) analysis

Total RNA was isolated from cells with TRIzol reagent (Invitrogen) according to the manufacturer's instructions. The quantity and purity of total RNA were determined by measuring absorbance at 260 and 280 nm using the Nanodrop ND-1000 spectrophotometer (BCM, Houston, TX, USA). Next, cDNA was synthesized from 3 µg total RNA using Oligo(dT) (Promega) and reverse transcriptase (Beams Biotech, Seongnam, Korea). PCR amplification of cDNA was performed using gene-specific primers (Table I) and nTaq DNA polymerase (Enzynomics, Daejeon, Korea). PCR products were separated on a 1% agarose gel, visualized and photographed under UV light.

Table I

Primers for RT-PCR.

Table I

Primers for RT-PCR.

ProteinPrimersSequences
CD44Forward5′-GAA TAT AAC CTG CCG CTT TG-3′
Reverse5′-CTG AAG TGC TGC TCC TTT CAC-3′
GAPDHForward5′-ACC ACA GTC CAT GCC ATC AC-3′
Reverse5′-TCC ACC ACC CTG TTG CTG TA-3′
Western blotting

Total cell extracts were lysed in cell lysis buffer (Cell Signaling Technology, Inc., Danvers, MA, USA) with a protease inhibitor cocktail (Roche, Basel, Switzerland). Protein concentrations were determined by a BCA protein assay (Thermo Fisher Scientific, Rockford, IL, USA). The protein was separated by 10% SDS-PAGE and transferred onto a PVDF (polyvinylidene fluoride) membrane (Millipore, Billerica, MA, USA). The membranes were incubated for 1 h in blocking solution [5% skim milk in TBS with 0.1% Tween-20 (TBST)] and sequentially blotted with the following primary antibodies: anti-CD44 (R&D Systems, Minneapolis, MN, USA), anti-GAPDH (Aviva Systems Biology, San Diego, CA, USA), anti-AKT, anti-phospho-AKT (Ser/Thr), anti-phospho-GSK-3β, anti-β-catenin, anti-Bax, anti-Bcl-2, anti-Bcl-xL, anti-caspase-3, anti-phospho-caspase-3, anti-cleaved-caspase-3, anti-caspase-9, anti-phospho-caspase-9, anti-cleaved-caspase-9, anti-PARP poly(ADP-ribose) polymerase, and anti-cleaved-PARP (Cell Signaling Technology) at 4°C overnight. After rinsing in TBST (0.1%), membranes were incubated with horseradish peroxidase-labeled anti-rabbit (Thermo Fisher Scientific) or anti-mouse IgG secondary antibodies (Cell Signaling Technology) at room temperature for 1 h. The blot was detected by ECL (enhanced chemiluminescence) of an HRP substrate (Millipore) on an image reader (Ras4000, Fujifilm, Tokyo, Japan).

Cell viability assay

The viability of treated cells was measured using a Cell Counting Kit-8 (CCK-8; Dojindo, Kumamoto, Japan). Cells were plated into 96-well plate at 5,000 cells/well one day prior to the viral transduction. Then, cells were infected with the recombinant adenoviruses for 1 day, followed by medium replacement. Cell growth and viability were assayed 4–5 days post-infection. For cell viability assay, the cells are incubated with reagents from the CCK-8 kit for 1 h and the absorbance was measured at 450 nm in a microplate reader (BioTek, Winooski, VT, USA). Each sample was assayed in triplicate, and each experiment was repeated at least twice.

Flow cytometry analysis

Apoptosis was quantified using flow cytometry after being stained with APC (allophycocyanin)-labeled Annexin V and 7-amino-dactinomycin (BD Biosciences, San Diego, CA, USA). We analyzed for intact cells (Annexin V/7AAD-double-negative), early apoptotic cells (Annexin V-positive), and late apoptotic cells or necrotic cells (Annexin V/7AAD-double-positive). The cells were plated in 6-well plates at of 200,000 cells/well prior to infected with the recombinant adenoviruses for 4–5 days. Both uninfected and infected HCT116 cells were trypsinized, washed twice with cold PBS, and resuspended in 1X binding buffer (BD Biosciences). Analysis of 400 µl of this cell resuspension was performed on a fluorescence active cell sorting (FACS)Calibur flow cytometer (Becton-Dickinson, San Jose, CA, USA) using the CellQuest version 3.3 software (Becton-Dickinson).

Cell migration assay

Cells were cultured in 6-well plates and infected with the recombinant adenoviruses for 24–48 h. The infected HCT116 cells were then seeded in culture-inserts (2×0.22 cm2; IBIDI GmbH, Martinsried, Germany) at 5×104 cells/well. To create a cell-free gap, Culture-Inserts were gently removed using sterile tweezers after a 24-h incubation. The progress of cell migration into the cell-free gap was photographed at 0, 20, and 40 h using an inverted microscope. The distance between gaps was measured using the Focus Lite Ver 2.90 (Focus, Daejeon, Korea) software after three random sites were photographed.

Cell invasion assay

Cell invasion assays were carried out using 24-well Transwell filters with 8-µM pores (Coring Inc., NY, USA). Transwell filters were coated with 500 µg Matrigel/DMEM for 3–4 h and unbound material was aspirated at room temperature. Cells infected with the recombinant adenoviruses were resuspended at a density of 2.5×105 cells in 120 µl 0.2% BSA medium and then seeded into the upper chamber. Then 400 µl of 0.2% BSA medium containing 50 µg/ml human plasma fibronectin (Calbiochem, La Jolla, CA, USA) as a chemoattractant was loaded into the lower chamber. After a 24-h incubation, invaded cells on the bottom surface of the Transwell were stained with Diff-Quick solution (Sysmex, Kobe, Japan) and quantified in five selected fields (1 mm2 each) using a hematocytometer under a light microscope.

Soft-agar colony formation assay

Soft agar assays were constructed in 6-well plates. The foundation layer of each well consisted of 1.5 ml of 0.6% agar solution in 1X media. The HCT116 cells were transduced (1.5×104 cells/well) for 1 day, and then mixed with 0.6% soft agar (1:1) and seeded onto the bottom. An additional 3 ml of 1X media without agarose was poured on top of the growth layer. After a 2-week incubation, the colonies were stained with 0.05% crystal violet and photographed using an inverted microscope camera. The number of colonies was counted at ×40 magnification.

Statistical analysis

All statistical analyses were performed using a t-test with SPSS 21.0 (IBM Inc., Armonk, NY, USA) software.

Results

Expression of CD44

The level of expression of CD44 mRNA was evaluated by RT-PCR; GAPDH served as an internal control. As shown in Fig. 1A, the level of expression of CD44 mRNA in cells infected with Ad-CD44-shRNA was significantly downregulated compared with parental (HCT116) and scramble-Ad-infected cells (p<0.01). A significant reduction in CD44 protein was also detected in Ad-CD44-shRNA-infected cells compared with scramble-Ad-infected cells (p<0.01).

Figure 1

CD44 expression detected by (A) RT-PCR and (B) western blotting, with GAPDH as an internal control. Lane 1, non-treated WT cells (HCT116). Lane 2, cells infected with scramble Ad. Lane 3, cells infected with Ad-CD44-shRNA. Bands were analyzed and quantified by densitometry and the CD44/GAPDH ratio was evaluated.

Cell viability

The results of the cell viability assay are shown in Fig. 2. Whereas the scramble-Ad showed little cytotoxicity, Ad-CD44-shRNA suppressed cell viability (p<0.05) 4–5 days post-infection.

Figure 2

Cell viability was determined using CCK-8 in 4–5 days after infection with scramble Ad or Ad-CD44-shRNA.

Flow cytometry analysis

The early (7.80%) and late (14.65%) apoptotic rate of Ad-CD44-shRNA-infected cells was increased compared with parental (2.58 and 6.25%) and scramble Ad-infected (3.15 and 7.83%) cells (p<0.01) (Fig. 3).

Figure 3

Apoptosis was investigated using flow cytometric analysis at 72 h after infection with scramble Ad or Ad-CD44-shRNA.

Cell migration assay

The Ad-CD44-shRNA-infected cells showed much lower migratory capacity than scramble-Ad-infected cells at 40 h after plating (p<0.01) (Fig. 4).

Figure 4

The effect of CD44-shRNA recombinant adenovirus treatment on cell migration. (A) Cells were photographed at 0, 20, and 40 h after detachment of insert from the plate. (B) Graphs of cell migration are displayed as relative healing distance.

Cell invasion assay

The invasion activity of Ad-CD44-shRNA-infected cells was significantly decreased compared with scramble-Ad-infected cells (51.8 vs. 94.3, p<0.01) (Fig. 5).

Figure 5

Effects of CD44-shRNA adenoviral vector on invasion of HCT116 cells in vitro. (A) The invasiveness of colon cancer cells were assessed using a Transwell invasion assay. The transmembrane cells were stained with Diff-Quick solution. (B) Number of invaded cells was counted at 24 h.

PI3-Akt signaling and apoptosis

Western blot analysis for expression of PI3-Akt signaling and apoptotic molecules is shown in Fig. 6. The Ad-CD44-shRNA resulted in a decrease in the expression of phospho-Akt and phospho-GSK-3β (Fig. 6B). In contrast, there was minimal change of β-catenin expression (Fig. 6B). The Ad-CD44-shRNA also resulted in a decrease in the expression of Bcl-2 and Bcl-xL, but an increase in the expression of Bax, and promoted the cleavage of caspase-3, -9 and PARP (Fig. 6C).

Figure 6

Western blot analysis of (A) CD44 and GAPDH, (B) PI3-Akt signaling, and (C) apoptosis. Apoptosis and survival-related proteins were detected at 72 h after infection with recombinant adenoviral vectors. Lane 1, non-treated WT cells (HCT116). Lane 2, cells infected with scramble Ad. Lane 3, cells infected with Ad-CD44-shRNA.

Soft-agar colony formation assay

The Ad-CD44-shRNA-infected cells showed a marked decrease in colony formation (Fig. 7). When quantified, there was a 50.2% decrease in colony formation units in the presence of Ad-CD44-shRNA compared with scramble-Ad (Fig. 7B), suggesting a significant tumorigenic inhibition of HCT116 colon cancer cells by Ad-CD44-shRNA.

Figure 7

Soft agar colony formation assay of CD44 knockdown. (A) HCT116 cells infected with scramble Ad and Ad-CD44-shRNA was used for the soft agar colony formation assay. Cells were cultured in 3D-agar for 2 weeks, and colonies were stained with crystal violet reagent and photographed. (B) Quantitative analysis of colony numbers is shown in the lower panel.

Discussion

In this study, we have constructed a recombinant adenoviral model to reduce the expression of CD44. We showed that Ad-CD44-shRNA inhibited cell proliferation, migration, and invasion in HCT116 colon cancer cells, which supports the feasibility of an adenovirus-mediated RNA interference therapy targeting colon cancer via the CD44 antigen.

Colorectal cancer is the result of genetic alterations that lead to a transformation of normal colonic epithelial cells into cancer cells. Currently, radical surgery followed by adjuvant chemotherapy is recommended to high risk patients for management of colon cancer (18). However, this standard treatment is not ideally effective because of the recurrence of the cancer and toxicity of the chemotherapeutic agents. CSCs are believed to be the reason of resistance to the conventional chemotherapy and radiotherapy that targets the bulk of cancer, leaving the stem cells unaffected (2–4). In the traditional stochastic model, every cancer cell from the bulk tumor has a carcinogenic potential. According to the hierarchical model, however, only a small proportion of tumor cells are actually cancer stem cells (4). In contrast with the stochastic model, slowly proliferating CSCs displaying multipotency and self-renewal are only responsible for tumor initiation, maintenance, and metastasis (4). These CSCs are hypothesized to be spared from the chemotherapy that interferes with the ability of rapidly growing cells to divide (2).

To identify and isolate CSCs, there have been many efforts to identify specific CSC markers. Well-known CSC markers for colorectal cancer include CD44, CD133, EpCAM, CD24, and CD29 (4). Above all, CD44, a transmembrane glycoprotein functioning as a cell adhesion protein and a signaling receptor (6), is one of the most well-studied CSC surface markers. CD44 enhances the epithelial-mesenchymal transition, which is related to cancer cell migration and invasion (14), and therefore is associated with tumor progression, metastasis, and poor prognosis in colon cancer (9,10,19,20). Importantly, inhibition of these CSC surface markers may result in the inhibition of tumor cell proliferation, invasion, and metastasis (3). We have previously developed a CD44 knockdown model using plasmids for RNA interference and reported that shRNA against CD44 inhibited cell proliferation, invasion, and migration (13). However, as mentioned above, more efficient means of delivering therapeutic siRNA are still needed because of the limited efficiency of delivery via plasmid.

In this study, we successfully constructed a recombinant adenoviral model to knock down CD44 using adenoviruses, which are among the most widely used vectors for gene therapy (21). Oncolytic virotherapy using recombinant adenoviruses has a number of potential advantages. It can be used to specifically target cancer cells while leaving normal tissue stem cells unharmed, thus minimizing systemic toxicity (15,22). There is also a low possibility of resistance because of the diverse ways it induces oncolysis (22). Above all, therapeutic genes, such as inhibitory RNA against specific oncogenes, can be delivered using recombinant adenoviral vectors (22). Because of the high efficiency of transduction in vivo, the adenoviral system has been used for virus-based therapies (15,23).

The result of this study demonstrated that reduced cell proliferation, migration, and invasion, and enhanced apoptosis were likely to be a result of the Ad-CD44-shRNA infection. Also, we showed differential expression of PI3-Akt signaling and apoptotic molecules in colon cancer cells treated with Ad-CD44-shRNA. Tumor proliferation, differentiation, and apoptosis are known to be under the control of several signaling pathways such as the Wnt signaling pathway (24,25). We demonstrated that Ad-CD44-shRNA infection inhibited Akt phosphorylation (Fig. 6B), which is one of the most important Wnt-target genes for the survival of cancer cells (26,27). We also showed the downregulation of GSK-3β (Fig. 6B), the target of PDK1/Akt signal transduction, inactivates various proteins involved in cell proliferation and survival such as β-catenin, cyclin D1, c-jun, and c-myc (28). β-catenin is a downstream molecule in the Wnt signaling pathway and plays an important role in cell-to-cell adhesion, tumor invasion, and metastasis (25). In addition, we showed decreased expression of Bcl-2 and Bcl-xL; increased expression of Bax; and cleavage of caspase-3, -9, and PARP (Fig. 6C). The Bcl-2 family proteins are key regulators of apoptosis, with a pro-survival subfamily including Bcl-2, Bcl-xL, Bcl-w, Mcl-1, and A1; and a pro-apoptotic subfamily including Bax, Bak, and Bok (29–31). Apoptosis is precipitated by the activation of cysteine proteases of the caspase family, including caspase-3, -8 and -9, and their cleavage is considered the primary hallmark of apoptosis (32,33). The results of our study also demonstrated that Ad-CD44-shRNA infection induces apoptosis in HCT116 colon cancer cells, suggesting reduced clonogenic ability.

We also utilized the soft agar colony formation assay, or 3D culture, as a novel modality to identify the inhibition of tumorigenesis by Ad-CD44-shRNA. Because of the intrinsic difficulties in investigating the tumor progression in vivo, the soft agar colony formation assay, which is a close mimicry of the 3D cellular environment in vivo, has recently been used (34). With this assay, we assessed the effects of Ad-CD44-shRNA on cell proliferation and migration. The result of the assay provided us with a straightforward and intuitive result, as well as a quantitative assessment of the inhibitory potential of Ad-CD44-shRNA.

Until now, there have been several clinical trials using oncolytic adenoviruses (22); however, regarding colorectal cancer, it is rarely reported (35–38). Although there is an increasing demand for novel therapeutic modalities, such as non-pathogenic viruses in the treatment of colorectal cancer, clinical evidence of oncolytic virotherapy is still lacking (22). Our results support the feasibility of an adenovirus-mediated RNA interference therapy targeting colon cancer via the CD44 antigen, which can be used as a therapeutic intervention with the anti-survival/pro-apoptotic machinery in human colon cancer. This study is also meaningful as a cornerstone to potential future gene therapies using oncolytic adenoviruses against colorectal cancer. Oncolytic adenoviral therapy, despite its limited efficacy as a single agent, has a potential role in combination therapy with conventional chemotherapy (22). Further translational studies and clinical trials focusing on the administration of cancer virotherapy in combination with conventional chemotherapy are needed.

Acknowledgments

This study was supported by a grant from Chonnam National University 2010, Research Institute of Medical Sciences, Chonnam National University (2011-CURIMS-DR007) and a Research Grant 0720570 from the National Cancer Center, Korea.

References

1 

Siegel RL, Miller KD and Jemal A: Cancer statistics, 2016. CA Cancer J Clin. 66:7–30. 2016. View Article : Google Scholar : PubMed/NCBI

2 

Todaro M, Francipane MG, Medema JP and Stassi G: Colon cancer stem cells: Promise of targeted therapy. Gastroenterology. 138:2151–2162. 2010. View Article : Google Scholar : PubMed/NCBI

3 

Puglisi MA, Tesori V, Lattanzi W, Gasbarrini GB and Gasbarrini A: Colon cancer stem cells: Controversies and perspectives. World J Gastroenterol. 19:2997–3006. 2013. View Article : Google Scholar : PubMed/NCBI

4 

Fanali C, Lucchetti D, Farina M, Corbi M, Cufino V, Cittadini A and Sgambato A: Cancer stem cells in colorectal cancer from pathogenesis to therapy: Controversies and perspectives. World J Gastroenterol. 20:923–942. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Dalerba P, Dylla SJ, Park IK, Liu R, Wang X, Cho RW, Hoey T, Gurney A, Huang EH, Simeone DM, et al: Phenotypic characterization of human colorectal cancer stem cells. Proc Natl Acad Sci USA. 104:10158–10163. 2007. View Article : Google Scholar : PubMed/NCBI

6 

Ponta H, Sherman L and Herrlich PA: CD44: From adhesion molecules to signalling regulators. Nat Rev Mol Cell Biol. 4:33–45. 2003. View Article : Google Scholar : PubMed/NCBI

7 

Ropponen KM, Eskelinen MJ, Lipponen PK, Alhava E and Kosma VM: Expression of CD44 and variant proteins in human colorectal cancer and its relevance for prognosis. Scand J Gastroenterol. 33:301–309. 1998. View Article : Google Scholar : PubMed/NCBI

8 

Fernández JC, Vizoso FJ, Corte MD, Gava RR, Corte MG, Suárez JP, García-Muñíz JL and García-Morán M: CD44s expression in resectable colorectal carcinomas and surrounding mucosa. Cancer Invest. 22:878–885. 2004. View Article : Google Scholar

9 

Huh JW, Kim HR, Kim YJ, Lee JH, Park YS, Cho SH and Joo JK: Expression of standard CD44 in human colorectal carcinoma: Association with prognosis. Pathol Int. 59:241–246. 2009. View Article : Google Scholar : PubMed/NCBI

10 

Lugli A, Iezzi G, Hostettler I, Muraro MG, Mele V, Tornillo L, Carafa V, Spagnoli G, Terracciano L and Zlobec I: Prognostic impact of the expression of putative cancer stem cell markers CD133, CD166, CD44s, EpCAM, and ALDH1 in colorectal cancer. Br J Cancer. 103:382–390. 2010. View Article : Google Scholar : PubMed/NCBI

11 

Harada N, Mizoi T, Kinouchi M, Hoshi K, Ishii S, Shiiba K, Sasaki I and Matsuno S: Introduction of antisense CD44S CDNA down-regulates expression of overall CD44 isoforms and inhibits tumor growth and metastasis in highly metastatic colon carcinoma cells. Int J Cancer. 91:67–75. 2001. View Article : Google Scholar : PubMed/NCBI

12 

Du L, Wang H, He L, Zhang J, Ni B, Wang X, Jin H, Cahuzac N, Mehrpour M, Lu Y, et al: CD44 is of functional importance for colorectal cancer stem cells. Clin Cancer Res. 14:6751–6760. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Park YS, Huh JW, Lee JH and Kim HR: shRNA against CD44 inhibits cell proliferation, invasion and migration, and promotes apoptosis of colon carcinoma cells. Oncol Rep. 27:339–346. 2012.

14 

Cho SH, Park YS, Kim HJ, Kim CH, Lim SW, Huh JW, Lee JH and Kim HR: CD44 enhances the epithelial-mesenchymal transition in association with colon cancer invasion. Int J Oncol. 41:211–218. 2012.PubMed/NCBI

15 

Short JJ and Curiel DT: Oncolytic adenoviruses targeted to cancer stem cells. Mol Cancer Ther. 8:2096–2102. 2009. View Article : Google Scholar : PubMed/NCBI

16 

St George JA: Gene therapy progress and prospects: Adenoviral vectors. Gene Ther. 10:1135–1141. 2003. View Article : Google Scholar : PubMed/NCBI

17 

McDougal JS, Cort SP, Kennedy MS, Cabridilla CD, Feorino PM, Francis DP, Hicks D, Kalyanaraman VS and Martin LS: Immunoassay for the detection and quantitation of infectious human retrovirus, lymphadenopathy-associated virus (LAV). J Immunol Methods. 76:171–183. 1985. View Article : Google Scholar : PubMed/NCBI

18 

Chang GJ, Kaiser AM, Mills S, Rafferty JF and Buie WD; Standards Practice Task Force of the American Society of Colon and Rectal Surgeons: Practice parameters for the management of colon cancer. Dis Colon Rectum. 55:831–843. 2012. View Article : Google Scholar : PubMed/NCBI

19 

Jing F, Kim HJ, Kim CH, Kim YJ, Lee JH and Kim HR: Colon cancer stem cell markers CD44 and CD133 in patients with colorectal cancer and synchronous hepatic metastases. Int J Oncol. 46:1582–1588. 2015.PubMed/NCBI

20 

Bendardaf R, Algars A, Elzagheid A, Korkeila E, Ristamäki R, Lamlum H, Collan Y, Syrjänen K and Pyrhönen S: Comparison of CD44 expression in primary tumours and metastases of colorectal cancer. Oncol Rep. 16:741–746. 2006.PubMed/NCBI

21 

Cerullo V, Koski A, Vähä-Koskela M and Hemminki A: Chapter eight - Oncolytic adenoviruses for cancer immunotherapy: Data from mice, hamsters, and humans. Adv Cancer Res. 115:265–318. 2012. View Article : Google Scholar

22 

Bourke MG, Salwa S, Harrington KJ, Kucharczyk MJ, Forde PF, de Kruijf M, Soden D, Tangney M, Collins JK and O'Sullivan GC: The emerging role of viruses in the treatment of solid tumours. Cancer Treat Rev. 37:618–632. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Hawkins LK, Lemoine NR and Kirn D: Oncolytic biotherapy: A novel therapeutic plafform. Lancet Oncol. 3:17–26. 2002. View Article : Google Scholar : PubMed/NCBI

24 

Logan CY and Nusse R: The Wnt signaling pathway in development and disease. Annu Rev Cell Dev Biol. 20:781–810. 2004. View Article : Google Scholar : PubMed/NCBI

25 

Clevers H: Wnt/beta-catenin signaling in development and disease. Cell. 127:469–480. 2006. View Article : Google Scholar : PubMed/NCBI

26 

Medema RH, Kops GJ, Bos JL and Burgering BM: AFX-like Forkhead transcription factors mediate cell-cycle regulation by Ras and PKB through p27kip1. Nature. 404:782–787. 2000. View Article : Google Scholar : PubMed/NCBI

27 

Zhao X, Gan L, Pan H, Kan D, Majeski M, Adam SA and Unterman TG: Multiple elements regulate nuclear/cytoplasmic shuttling of FOXO1: Characterization of phosphorylation- and 14-3-3-dependent and -independent mechanisms. Biochem J. 378:839–849. 2004. View Article : Google Scholar

28 

Downward J: PI 3-kinase, Akt and cell survival. Semin Cell Dev Biol. 15:177–182. 2004. View Article : Google Scholar : PubMed/NCBI

29 

Czabotar PE, Lessene G, Strasser A and Adams JM: Control of apoptosis by the BCL-2 protein family: Implications for physiology and therapy. Nat Rev Mol Cell Biol. 15:49–63. 2014. View Article : Google Scholar

30 

Zheng JH, Viacava Follis A, Kriwacki RW and Moldoveanu T: Discoveries and controversies in BCL-2 protein-mediated apoptosis. FEBS J. 283:2690–2700. 2016. View Article : Google Scholar

31 

Um HD: Bcl-2 family proteins as regulators of cancer cell invasion and metastasis: A review focusing on mitochondrial respiration and reactive oxygen species. Oncotarget. 7:5193–5203. 2016.

32 

Galluzzi L, López-Soto A, Kumar S and Kroemer G: Caspases connect cell-death signaling to organismal homeostasis. Immunity. 44:221–231. 2016. View Article : Google Scholar : PubMed/NCBI

33 

Man SM and Kanneganti TD: Converging roles of caspases in inflammasome activation, cell death and innate immunity. Nat Rev Immunol. 16:7–21. 2016. View Article : Google Scholar :

34 

Horibata S, Vo TV, Subramanian V, Thompson PR and Coonrod SA: Utilization of the soft agar colony formation assay to identify inhibitors of tumorigenicity in breast cancer cells. J Vis Exp. e527272015.PubMed/NCBI

35 

Nemunaitis J, Cunningham C, Buchanan A, Blackburn A, Edelman G, Maples P, Netto G, Tong A, Randlev B, Olson S, et al: Intravenous infusion of a replication-selective adenovirus (ONYX-015) in cancer patients: Safety, feasibility and biological activity. Gene Ther. 8:746–759. 2001. View Article : Google Scholar : PubMed/NCBI

36 

Reid TR, Freeman S, Post L, McCormick F and Sze DY: Effects of Onyx-015 among metastatic colorectal cancer patients that have failed prior treatment with 5-FU/leucovorin. Cancer Gene Ther. 12:673–681. 2005. View Article : Google Scholar : PubMed/NCBI

37 

Kemeny N, Brown K, Covey A, Kim T, Bhargava A, Brody L, Guilfoyle B, Haag NP, Karrasch M, Glasschroeder B, et al: Phase I, open-label, dose-escalating study of a genetically engineered herpes simplex virus, NV1020, in subjects with metastatic colorectal carcinoma to the liver. Hum Gene Ther. 17:1214–1224. 2006. View Article : Google Scholar : PubMed/NCBI

38 

Fong Y, Kim T, Bhargava A, Schwartz L, Brown K, Brody L, Covey A, Karrasch M, Getrajdman G, Mescheder A, et al: A herpes oncolytic virus can be delivered via the vasculature to produce biologic changes in human colorectal cancer. Mol Ther. 17:389–394. 2009. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Lee SY, Kim KA, Kim CH, Kim YJ, Lee J and Kim HR: CD44-shRNA recombinant adenovirus inhibits cell proliferation, invasion, and migration, and promotes apoptosis in HCT116 colon cancer cells. Int J Oncol 50: 329-336, 2017.
APA
Lee, S.Y., Kim, K.A., Kim, C.H., Kim, Y.J., Lee, J., & Kim, H.R. (2017). CD44-shRNA recombinant adenovirus inhibits cell proliferation, invasion, and migration, and promotes apoptosis in HCT116 colon cancer cells. International Journal of Oncology, 50, 329-336. https://doi.org/10.3892/ijo.2016.3801
MLA
Lee, S. Y., Kim, K. A., Kim, C. H., Kim, Y. J., Lee, J., Kim, H. R."CD44-shRNA recombinant adenovirus inhibits cell proliferation, invasion, and migration, and promotes apoptosis in HCT116 colon cancer cells". International Journal of Oncology 50.1 (2017): 329-336.
Chicago
Lee, S. Y., Kim, K. A., Kim, C. H., Kim, Y. J., Lee, J., Kim, H. R."CD44-shRNA recombinant adenovirus inhibits cell proliferation, invasion, and migration, and promotes apoptosis in HCT116 colon cancer cells". International Journal of Oncology 50, no. 1 (2017): 329-336. https://doi.org/10.3892/ijo.2016.3801
Copy and paste a formatted citation
x
Spandidos Publications style
Lee SY, Kim KA, Kim CH, Kim YJ, Lee J and Kim HR: CD44-shRNA recombinant adenovirus inhibits cell proliferation, invasion, and migration, and promotes apoptosis in HCT116 colon cancer cells. Int J Oncol 50: 329-336, 2017.
APA
Lee, S.Y., Kim, K.A., Kim, C.H., Kim, Y.J., Lee, J., & Kim, H.R. (2017). CD44-shRNA recombinant adenovirus inhibits cell proliferation, invasion, and migration, and promotes apoptosis in HCT116 colon cancer cells. International Journal of Oncology, 50, 329-336. https://doi.org/10.3892/ijo.2016.3801
MLA
Lee, S. Y., Kim, K. A., Kim, C. H., Kim, Y. J., Lee, J., Kim, H. R."CD44-shRNA recombinant adenovirus inhibits cell proliferation, invasion, and migration, and promotes apoptosis in HCT116 colon cancer cells". International Journal of Oncology 50.1 (2017): 329-336.
Chicago
Lee, S. Y., Kim, K. A., Kim, C. H., Kim, Y. J., Lee, J., Kim, H. R."CD44-shRNA recombinant adenovirus inhibits cell proliferation, invasion, and migration, and promotes apoptosis in HCT116 colon cancer cells". International Journal of Oncology 50, no. 1 (2017): 329-336. https://doi.org/10.3892/ijo.2016.3801
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team