Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
February-2017 Volume 50 Issue 2

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2017 Volume 50 Issue 2

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Integrated analysis of microRNA and transcription factor reveals important regulators and regulatory motifs in adult B-cell acute lymphoblastic leukemia

  • Authors:
    • Xiao-Cong Lin
    • Xin-Guang Liu
    • Yu-Ming Zhang
    • Ning Li
    • Zhi-Gang Yang
    • Wei-Yu Fu
    • Liu-Bo Lan
    • Hai-Tao Zhang
    • Yong Dai
  • View Affiliations / Copyright

    Affiliations: Guangdong Provincial Key Laboratory of Medical Molecular Diagnostics, Guangdong Medical University, Dongguan, Guangdong 523808, P.R. China, Clinical Medical Research Center, Shenzhen People's Hospital, Shenzhen, Guangdong 518020, P.R. China
  • Pages: 671-683
    |
    Published online on: December 30, 2016
       https://doi.org/10.3892/ijo.2016.3832
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

B-cell acute lymphoblastic leukemia (B‑ALL) is an aggressive hematological malignancy and a leading cause of cancer-related mortality in children and young adults. The molecular mechanisms involved in the regulation of its gene expression has yet to be fully elucidated. In the present study, we performed large scale expression profiling of microRNA (miRNA) and transcription factor (TF) by Illumina deep‑sequencing and TF array technology, respectively, and identified 291 differentially expressed miRNAs and 201 differentially expressed TFs in adult B‑ALL samples relative to their controls. After integrating expression profile data with computational prediction of miRNA and TF targets from different databases, we construct a comprehensive miRNA‑TF regulatory network specifically for adult B‑ALL. Network function analysis revealed 25 significantly enriched pathways, four pathways are well‑known to be involved in B‑ALL, such as PI3K‑Akt signaling pathway, Jak‑STAT signaling pathway, Ras signaling pathway and cell cycle pathway. By analyzing the network topology, we identified 28 hub miRNAs and 19 hub TFs in the network, and found nine potential B‑ALL regulators among these hub nodes. We also constructed a Jak‑STAT signaling sub‑network for B‑ALL. Based on the sub‑network analysis and literature survey, we proposed a cellular model to discuss MYC/miR‑15a‑5p/FLT3 feed-forward loop (FFL) with Jak‑STAT signaling pathway in B‑ALL. These findings enhance our understanding of this disease at the molecular level, as well as provide putative therapeutic targets for B-ALL.

Introduction

B-cell acute lymphoblastic leukemia (B-ALL) is an aggressive hematological malignancy characterized by uncontrolled and rapid proliferation of B-lymphoid precursor cells within the bone marrow (1,2). B-ALL represents the most common type of ALL and accounts for ~75 and 85% of adult and childhood ALL cases, respectively (3,4). It is estimated that nearly 4,000 de novo cases are diagnosed each year in the US (5). Although advances in risk-adapted intensive chemotherapy have dramatically improved the disease outcomes of childhood patients with B-ALL, this approach is less effective in adults, with a disease-related mortality of ~60% (6,7). Relapse occur frequently following remission induction chemotherapy, and the expected survival of relapsed patients was less than 6 months (8,9). Especially, the 5-year survival rate for adult patients is a dismal 7% at time of relapse (10). Chemotherapy-refractory and relapsed B-ALL remains the primary cause of cancer-related mortality in children and young adults (5,11,12). Therefore, there is an urgent need to discover new therapeutic targets for B-ALL. Understanding the critical factors and molecular mechanisms associated with B-ALL initiation and progression is essential for further advances in therapy. Currently, many cytogenetic and genomic lesions have been shown to play important roles in the pathogenesis of B-ALL, which include hyperdiploidy (11,13,14), hypodiploidy (6,13,14), rearrangements of TEL, TCF3, MLL, BCR/ABL and IgH@ gene (6,12,14,15), mutations of PAX5, CRLF2, IKZF1 and JAK gene (6,11,15), deletion of CDKN2A/B (12). These aberrations are strongly correlated with disease characteristics, patient prognosis and the response to chemotherapy, however, understanding of the molecular mechanisms of this disease remains limited. In particular, the regulatory networks of B-ALL genes expression are still unclear.

miRNAs are small noncoding RNAs of ~18 to 25 nucleotides that inhibit gene expression at the post-transcriptional level through binding to the 3′-UTR of target mRNAs (16). A growing body of research evidence has confirmed the crucial roles of miRNA in various types of human cancers, including B-ALL (17). It has been reported that miR-125b-5p was upreg-ulated in patients with B-ALL carrying the t(11;14)(q24;q32) translocation. Ectopic expression of miR-125b-5p would induce hematopoietic fetal liver cells progresses to B-ALL, T-cell acute lymphoblastic leukemia (T-ALL) or a myeloproliferative neoplasm in xenograft mouse models (18). Furthermore, elevated levels of miR-125b-5p, miR-99a and miR-100 were correlated with resistance to daunorubicin and vincristine, while decreased expression of miR-708 was related to resistance to glucocorticoids in pediatric B-ALL (16,17). miR-17-92 was significantly downregulated in the BCR-ABL-positive human B-ALL samples and its overexpression induced apoptosis of B-ALL cells in a BCR-ABL-dependent manner by targeting Bcl-2 (19).

Transcription factors (TFs) are protein factors that regulate gene transcription by specifically binding to cis-regulatory elements located in the promoter regions of target genes, which we now call transcription factor binding site (TFBS) (20). As key regulators of gene expression in organisms, TFs and miRNAs are able to mutually regulate one another in forms of feedback loops (FBLs) or cooperatively regulate the same target genes in a combinatorial manner to form feed-forward loops (FFLs) hence ensuring the precise and accurate control of gene expression (20,21). Recent investigations concerning the gene expression regulation by miRNA and TF in leukemia have provided new insights into disease pathogenesis (21–23). miR-223 and two TFs (C/EBPα and NFI-A) formed a regulatory circuitry to control the differentiation of acute promyelocytic leukemia cells (21). miR-196b can exert its effects by targeting the TF MYC and induce cell apoptosis in B-ALL (22). miR-19 was overexpressed in T-ALL cell lines and patients. Ectopic expression of miR-19 sustained activation of NF-κB pathway in T-ALL involving a feed-forward circuitry in miR-19, CYLD and TF NF-κB (23). However, global regulation of miRNA- and TF-mediated control of gene expression in adult B-ALL is still poorly understood. Thus, an integrated analysis of miRNAs and TFs, as their cooperative interaction relates to B-ALL pathogenesis, requires examination.

In this study, we applied Illumina deep-sequencing and TF array technology to analyze the miRNA and TF expression profiles, respectively, in bone marrow samples of adult B-ALL patients and their controls. Based on a combined bioinformatics approach for prediction of miRNA and TF targets, we integrated differentially expressed miRNAs and TFs as well as B-ALL candidate genes to construct a B-ALL-related miRNA and TF regulatory network. After analyzing the network function and topology, we found some B-ALL-related pathways and hub regulators from the network, and further investigated their regulation properties in the subnetwork. This study will be helpful to decipher the complex molecular mechanisms underlying B-ALL, as well as to provide potential therapeutic targets for B-ALL in the future.

Materials and methods

Patient samples

A total of 25 bone marrow samples, including 15 patients derived from newly diagnosed and untreated adult B-ALL (7 males and 8 females; 18–71 years old; average age, 36.5 years) and 10 controls (6 males and 4 females; 10-73 years old; average age, 39.0 years), were used in this study. All samples were collected at the Affiliated Hospital of Guangdong Medical University (Zhanjiang, China). Diagnosis of B-ALL was determined according to the accepted WHO criteria (24–26). Control samples were obtained from 10 patients with unexplained fever or anemia whose bone marrow aspirates was demonstrated to be normal bone marrow morphology. All patients gave informed consent for participation in this study according to the Helsinki convention criteria, and the study was approved by the Ethics Committee of Affiliated Hospital of Guangdong Medical University.

Total RNA isolation

Total RNA was isolated using RNeasy kit (Qiagen, Hilden, Germany) and TRIzol reagent (Invitrogen, Carlsbad, CA, USA) including a DNase digestion step, in accordance with the manufacturer's instructions. RNA yield and purity was assessed by determining the absorbance at 230, 260 and 280 nm in a ND-1000 spectrophotometer (NanoDrop, Wilmington, DE, USA).

Illumina deep-sequencing and analysis of miRNAs

Small RNA libraries were generated as follows: i) 3′-RNA adapters were ligated to total RNA; ii) 5′-RNA adapters were ligated to total RNA; iii) ligation products were reverse transcribed to cDNA and amplified by PCR; iv) 130-155 bp PCR amplified products (correspond to small RNA fragments ranging from 15-35 nucleotides) were isolated and purified from polyacryl-amide gels. After quantified with 2100 Bioanalyzer (Agilent, Palo Alto, CA, USA), the entire libraries were denatured with 0.1 M NaOH and subsequently loaded on the cBot instrument for amplification in situ using TruSeq Rapid SR cluster kit (both from Illumina, San Diego, CA, USA), as recommended by the manufacturer. Finally, small RNA libraries were quantified and sequenced for 36 cycles on Illumina HiSeq 2000 analyzer using TruSeq Rapid SBS kit (Illumina) following the manufacturer's standard workflow.

After sequencing was complete, image analysis and base calling were performed by utilizing Off-Line Basecaller software (version 1.8.0; Illumina). Clean reads which passed Solexa Chastity quality filter, were trimmed to remove the 3′-adapter sequence, and the reads shorter than 15 nucleotides were discarded. To identify known miRNAs, trimmed reads were compared with the human miRNA precursors in miRBase database (version 19.0, http://www.mirbase.org/) by using Novoalign software (release v2.07.11, http://www.novocraft.com/). Subsequently, raw counts of miRNA reads were normalized to transcripts per million (TPM) values. Differentially expressed miRNAs between samples may be identified by the fold-change filtering using a threshold of at least 2-fold-changes according to the normalized most abundant tag counts.

Transcription factor array and data analysis

Transcription factor array analysis was performed using TranSignal Combo Protein/DNA arrays (Panomics, Redwood City, CA, USA) according to the manufacturer's directions, which enables simultaneous detection of 345 major transcription factors. In general, nuclear extracts were prepared using the nuclear extract kit (Panomics) and the protein concentrations were measured with BCA protein assay kit (KangChen, Shanghai, China) as per the manufacturer's instructions. Ten micrograms of nuclear proteins were incubated for 30 min at 15°C with 10 µl of probe mixture containing 345 biotin-labeled TF-specific DNA oligonucleotides (Panomics) to allow the formation of TF/DNA complexes. Such complexes were separated from the free probes using spin column separation system (Panomics). The TF-specific probes were then extracted from the TF/DNA complexes and hybridized to the TranSignal array membrane at 42°C overnight. After three washings and addition of horseradish peroxidase (HRP)-conjugated streptavidin, hybridization signals were generated by standard chemiluminescence procedures with ECL-Hyperfilm (Amersham Pharmacia Biotech, Uppsala, Sweden). The signals were detected with a GBox Imaging system (Syngene, Cambridge, UK) and spot intensities were analyzed using ScanAlyze software (version 1.0.3, http://graphics.stanford.edu/software/scanalyze/). The data points showing at least 2-fold signal difference between B-ALL samples and their controls are considered significant.

Quantitative PCR of miRNA and TF

Total RNA samples were reverse transcribed (RT) to generate cDNA with Stem-loop RT primer (for miRNAs) and oligo(dT) primer (for TFs) using the SuperScript III Reverse Transcriptase kit (Invitrogen) following the instructions of the manufacturer. QPCR was carried out in triplicate on a Prism 7500 Real-time PCR system (Applied Biosystems, Foster City, CA, USA). The reaction mixtures consisted of 5 µl of 2X SYBR-Green PCR master mix (Applied Biosystems), 2 µl of template cDNA, 0.5 µl of 10 µM PCR forward primer, 0.5 µl of 10 µM PCR reverse primer and 2 µl of double-distilled water. The PCR reaction was conducted at 95°C for 10 min, followed by 40 cycles of 95°C for 10 sec and 60°C for 60 sec. To evaluate the reaction specificity, a melting curve analysis was performed immediately after PCR amplification. The expression levels of miRNAs and IFs were normalized to those of the human U6 snRNA and 18S rRNA, respectively. Relative expression was analyzed using the comparative 2−ΔΔCt method (27). Differences between the two groups were compared using the Student's t-test and considered significant at P<0.05. All primers used in this study are listed in Tables ITable II–III.

Table I

Primers used for cDNA synthesis of miRNAs.

Table I

Primers used for cDNA synthesis of miRNAs.

miRNAsPrimer for cDNA synthesis (5′-3′)
miR-200c-3p CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCCAT
miR-200b-3p CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCATCATT
miR-194-5p CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCCACATG
miR-26b-5p GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACACCTAT
miR-16-5p GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCGCCAAT
miR-424-5p GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTTCAAA
U6 snRNA CGCTTCACGAATTTGCGTGTCAT

Table II

Primers used for quantitative PCR of miRNAs.

Table II

Primers used for quantitative PCR of miRNAs.

miRNAsSense primer (5′-3′)Antisense primer (5′-3′)Product (bp)
miR-200c-3p ACACTCCAGCTGGGTAATACTGCCGGGTAATG CTCAACTGGTGTCGTGGA73
miR-200b-3p ACACTCCAGCTGGGTAATACTGCCTGGTAATG CTCAACTGGTGTCGTGGA73
miR-194-5p ACACTCCAGCTGGGTGTAACAGCAACTCCATG CTCAACTGGTGTCGTGGA73
miR-26b-5p GGGGTTCAAGTAATTCAGG TGCGTGTCGTGGAGTC65
miR-16-5p GGGTAGCAGCACGTAAATA CAGTGCGTGTCGTGGAGT65
miR-424-5p GGGCAGCAGCAATTCATGT GTGCGTGTCGTGGAGTCG63
U6 snRNA GCTTCGGCAGCACATATACTAAAAT CGCTTCACGAATTTGCGTGTCAT89

Table III

Primers used for quantitative PCR of TFs.

Table III

Primers used for quantitative PCR of TFs.

TFsSense primer (5′-3′)Antisense primer (5′-3′)Product (bp)
STAT5A GGCCATCCTAGGTTTTGTG CCCGATTTCTGAGTCACTAAAG100
FOXD1 CTTTTCTCGTCTTGGTGGTT CAGTTTTGTCCGAGAATTCG104
MEF2A AGTTTCCAACAGCTGTCCTT GATTGGGACCACCTGTGTAC  90
FOXF2 CACTCCAGCATGTCCTCCTA CTAGCTGAGGGATGGAAAGA170
HLF CGATCACCTTCTGCTCCTA GATTCGGATAAGGCTTTGC110
FOXO4 ATAGCACCACCTCCAGTCA CATGTCACACTCCAGGTTCTC150
18S rRNA CCTGGATACCGCAGCTAGGA GCGGCGCAATACGAATGCCCC112
Association analysis of miRNA and TF expression profiles
Identification of miRNA-gene/TF regulatory relation- ships

To acquire regulatory relationships of miRNA-gene and miRNA-TF, target prediction for differentially expressed miRNAs (fold-change, ≥2.0) was carried out using three different online databases, including PicTar (release 2007, http://pictar.mdc-berlin.de/cgi-bin/PicTar_vertebrate.cgi), TargetScan (release 6.2, http://www.targetscan.org/) and miRanda (version v5, http://www.ebi.ac.uk/enright-srv/microcosm/htdocs/targets/v5/) (28,29). To reduce false-positive results, only the targets predicted by at least two of the aforementioned databases were retained in this study (28,29). The identified targets were then incorporated into the experimentally verified targets which were obtained from miRTarBase (release 4.5, http://mirtarbase.mbc.nctu.edu.tw/) (30). After compiling B-ALL candidate genes/TFs from the MalaCards database (version 1.08.564, http://www.malacards.org/) (31), these results were overlapped with B-ALL candidate genes/TFs to avoid the redundancy and form miRNA→gene and miRNA→TF regulatory relationships. The extracted miRNA and target gene/TF pairs were subsequently subjected to TFBS analysis.

Identification of TF-gene/miRNA regulatory relationships

TF-gene and TF-miRNA regulatory relations were analyzed using the predicted TFBS information obtained from the TFBS Conserved Track (http://genome.ucsc.edu/cgi-bin/hgTables?hgsid=350051003&hgta_doSchemaDb=hg19&hgta_doSchemaTable=tfbsConsFactors) at UCSC Genome Browser database (32), and TFBSs were required to be conserved among human/mouse/rat. To reduce false-positive predictions, a P-value of 0.05 was selected as a cut-off. Next, the 5,000 bp upstream to 1,000 bp downstream of the transcription start site (TSS) was defined as putative promoter region for each gene (33,34). A gene is considered to be the target of a TF when at least one TFBS is located within the gene's promoter region and its P<0.05. As a part of the common transcription unit, miRNAs usually co-expressed with known host genes (protein coding genes/lncRNAs). Therefore, the putative promoter region (spans from 5,000 bp upstream to 1,000 bp downstream of the TSS) for host genes is used as the miRNA promoter (34,35). miRNAs having a TFBS that completely falls within the promoter region of their host gene and its P<0.05 were considered as TF targets. To further increase the prediction accuracy, the predicted TFs were then overlapped with differentially expressed TFs (fold-change, ≥2.0) obtained from the TF profiling data. After extraction of the TF-miRNA pairs and TF-miRNA target gene pairs, the predicted TF→miRNA and TF→gene relations were retrieved, respectively.

miRNA-TF regulatory network generation and network node analysis

By merging the regulatory relationships between TFs, miRNAs and target genes (TF→miRNA, TF→gene, miRNA→gene and miRNA→TF), we constructed a comprehensive miRNA-TF regulatory network for B-ALL using Gephi software (release 0.8.1-β, http://gephi.github.io/). GO database (www.geneontology.org) (36) and Kyoto Encydopedia of Gene and Genomes (KEGG) database (http://www.genome.jp/kegg/) (37) were then used to analyze the functional categories and pathways of the network nodes, which were considered to be significant when P<0.05. For further evaluation of network characteristics, the node degree is determined by calculating the number of direct links between nodes within the network. To identify network hubs, we classified the nodes by descending based on their degrees. The nodes having a total degree (sum of the in-degree and out-degree) ≥10 were considered as the hub components. Any neighboring node connected to hubs was extracted from the network to construct the sub-network.

Results

Alterations in miRNA and TF expression in adult B-ALL

To acquire B-ALL-related miRNAs and TFs, we analyzed the global expression change of miRNAs and TFs in adult B-ALL samples compared with their controls, using Illumina deep-sequencing and TF array technology, respectively. The miRNA expression profiling data showed 291 miRNAs were differentially expressed (fold-change, ≥2.0) among groups (Fig. 1A), including 168 that were upregulated and 123 that were downregulated. miR-1246 (fold-change, 6516.2) was the most upregulated miRNA, while miR-106b-5p (fold-change, 1509.5) was the most downregulated miRNA.

Figure 1

miRNA and TF profile contrasting between the bone marrow samples of B-ALL patients and control groups. The scatter-plot is used for assessing the miRNA (A) and TF (B) expression change in B-ALL samples relative to their control. The values of x-axis and y-axis in the scatter-plot represent averaged normalized values for each group (log2 scaled). The oblique lines are fold-change lines (fold-change cutoff value was set to 2.0).

Analysis of the TF array results revealed 201 TFs (57 upregulated and 144 downregulated) that were differentially expressed (fold-change ≥2.0) between the control and adult B-ALL samples (Fig. 1B). Among these TFs, MYC (fold-change, 36.0) exhibited the highest degree of upregulation, while MYOG (fold-change, 91.4) was the most downregulated TF.

Verification of Illumina sequencing and TF array results by qPCR

To demonstrate the reliability of the Illumina sequencing and TF array data, 6 miRNAs and 6 TFs that are differentially expressed were chosen for further verification by qPCR. As shown in Fig. 2A, miR-200c-3p, miR-200b-3p and miR-194-5p were upregulated and that miR-26b-5p, miR-16-5p and miR-424-5p were downregulated in adult B-ALL samples relative to their controls (all P<0.05). Furthermore, qPCR analysis also confirmed statistically significant differences between groups in signal transducer and activator of transcription 5A (STAT5A), FOXD1, MEF2A, FOXF2, HLF and FOXO4 (P<0.05 for each TFs) (Fig. 2B). These results were consistent with the Illumina sequencing and TF array data.

Figure 2

Validation of Illumina sequencing and TF array data by qPCR. The relative expression level of miRNAs (A) and IFs (B) were normalized to those of the human U6 snRNA and 18S rRNA, respectively. Data displayed in histograms are means ± SD, *P<0.05 and **P<0.01 comparing B-ALL samples with control samples (Student's t-test).

miRNA and TF regulatory network in adult B-ALL

After merging the four types of regulatory interactions (miRNA→gene, miRNA→TF, TF→gene and TF→miRNA) identified in the Materials and methods section, we constructed a miRNA-TF regulatory network specific for adult B-ALL (Fig. 3). A total of 41 miRNA-regulated TFs and 19 TFs regulated miRNAs in the network. On average, each miRNA was regulated by 0.24 TFs, whereas each TF was regulated by 10.25 miRNAs. The numbers of nodes and regulatory relationships of the resultant network are listed in Table IV. FFLs and FBLs are motifs known to play key roles in gene regulatory networks (21). Typically, FFLs can be categorized into three different types based on the master regulators: miRNA-FFL, TF-FFL and composite FFL (21,38). In Table V, we summarized the FFLs and FBLs in the B-ALL network and found ~98% of motifs were FFL. Among the 526 merged FFLs, 492 (93.5%) were TF-FFLs, in which TF was the master regulator, 30 (5.7%) belonged to miRNA-FFLs, and 4 (0.8%) belonged to composite-FFLs. These results indicate that TF-FFL was the dominant motif in the network.

Figure 3

miRNA-TF regulatory network in B-ALL. Pink nodes, upregulated B-ALL-related miRNAs; red nodes, downregulated B-ALL-related miRNAs; green nodes, B-ALL candidate genes; blue nodes, TFs. Pink arrows, regulatory relationships for upregulated miRNA and target gene; red arrows, regulatory relationships for downregulated miRNA and target gene; blue arrows, regulatory relationships for TF-miRNA or TF-gene.

Table IV

Summary of relationships in the B-ALL-related miRNA and transcription factor (TF) regulatory network.

Table IV

Summary of relationships in the B-ALL-related miRNA and transcription factor (TF) regulatory network.

RelationshipNo. of pairsNo. of miRNAsNo. of genesNo. of TFs
miRNA-genea43113127-
miRNA-TFb  47  41-  4
TF-genec176-3519
TF-miRNAd42980-19

a miRNA repression of gene expression;

b miRNA repression of TF expression;

c TF regulation of gene expression;

d TF regulation of miRNA expression.

Table V

Summary of feed-forward loops (FFLs) and feedback loops (FBLs) based on B-ALL-related network data.

Table V

Summary of feed-forward loops (FFLs) and feedback loops (FBLs) based on B-ALL-related network data.

Motif typesNo. of motifsNo. of nodes
No. of links
GenesmiRNAsTFsmiRNA-genemiRNA-TFTF-geneTF-miRNA
miRNA-FFL30  915  4271916-
TF-FFL 492  207019 189  - 104   280  
Composite-FFL  4  4  2  2  4  2  4  2
FBL  9-  9  3-  9-  9
Functional analysis of the miRNA and TF mediated regulatory network

Enrichment analysis is an effective method to understand functional nodes and network motifs. To investigate the functional categories of the B-ALL miRNA-TF regulatory network, we performed the GO enrichment analysis for all network nodes and identified 10 highly-enriched biological process terms (Fig. 4). Among these GO terms, 5 terms were related to the initiation and progression of B-ALL, such as positive regulation of gene expression, hemopoietic or lymphoid organ development, hemopoiesis, positive regulation of transcription (DNA-dependent) and positive regulation of macromolecule biosynthetic process (6,7,11,39). Moreover, significantly-enriched biological pathways for the network nodes were also examined by applying KEGG pathway enrichment analysis. The nodes were significantly enriched in 25 different pathways, of which 13 pathways were directly related to leukemia or hematopoiesis (Table VI). Among these pathways, PI3K-Akt signaling pathway, Jak-STAT signaling pathway, Ras signaling pathway and cell cycle pathway were well-known to be involved in B-ALL (6,9,11,13,39).

Figure 4

Highly-enriched biological process terms for nodes in the B-ALL miRNA-TF regulatory network. Gene ontology (GO) analysis was carried out to examine the enrichment of network nodes in biological processes. P<0.05 was considered to be significant, and the asterisk (*) indicates the terms related to B-ALL in GO.

Table VI

Pathway analysis for nodes in B-ALL-related miRNA and transcription factor regulatory network.

Table VI

Pathway analysis for nodes in B-ALL-related miRNA and transcription factor regulatory network.

Pathway IDDefinitionGene count%Fisher-P-value
hsa05200Pathways in cancera15  9.437.67E-11
hsa05202Transcriptional misregulation in cancera12  7.551.23E-10
hsa05220Chronic myeloid leukemiaa95.661.54E-10
hsa05166HTLV-I infectiona11  6.921.10E-07
hsa05221Acute myeloid leukemiaa63.776.18E-07
hsa05161Hepatitis B74.401.37E-05
hsa04151PI3K-Akt signaling pathwaya10  6.291.42E-05
hsa05219Bladder cancer42.525.48E-05
hsa04640Hematopoietic cell lineagea53.140.000120
hsa05203Viral carcinogenesisa74.400.000125
hsa05215Prostate cancer53.140.000126
hsa05206MicroRNAs in cancer85.030.000191
hsa04630Jak-STAT signaling pathwaya63.770.000206
hsa05212Pancreatic cancer42.520.000478
hsa04612Antigen processing and presentation42.520.000945
hsa05222Small cell lung cancer42.520.001299
hsa04012ErbB signaling pathway42.520.001356
hsa04014Ras signaling pathwaya63.770.001509
hsa05152Tuberculosis53.140.003049
hsa04060Cytokine-cytokine receptor interaction63.770.003687
hsa04110Cell cyclea42.520.004927
hsa05162Measles42.520.006479
hsa04010MAPK signaling pathwaya53.140.013771
hsa05169Epstein-Barr virus infectiona42.520.026308
hsa04510Focal adhesion42.520.027579

a The pathways related to leukemia or hematopoiesis in KEGG.

Network topological analysis and sub-network construction

To assess the global properties of this network, we calculated degrees and analyzed degree distributions for all nodes, which are primary topological network measures. In the network, the average node degree of miRNAs, TFs and genes was 7.6 (range from 1 to 23), 35 (range from 13 to 71) and 15.7 (range from 2 to 48), respectively. These results indicate that TFs are located at higher degrees within the network. Only a few nodes displayed a high node degree (hubs) while most nodes had a low degree, which reflected a scale-free feature of this network and further demonstrate that hub nodes may play vital roles in the network stability and robustness (Fig. 5). We categorized the nodes in descending order according to their total degrees and identified hub nodes (total degrees ≥10) inside the network. Twenty-eight hub miRNAs and 19 hub TFs were obtained from the network, respectively (Tables VII and VIII). Notably, 6 of the 28 hub miRNAs belonged to members of the miR-15 family, namely miR-15a-5p/15b-5p/16-5p/424-5p/497-5p/503-5p (Table VII), indicating an important role of miR-15 family in B-ALL-related regulatory network. Moreover, more than half of the 19 hub TFs were either well-known leukemia regulators, such as MYC (40), STAT5A (41,42) and STAT5B (41,42), or associated with leukemia development and progression, such as CREB1 (43), FOXO1 (44), FOXO4 (45), NFKB1 (46), NFKB2 (47), STAT6 (48) and HLF (11,49), which preliminarily reflected the robustness of our network. Among the 47 hub regulators, 4 hub miRNAs [miR-17-5p (19), miR-125b-5p (50), miR-18a-5p (19) and miR-34a-5p (4)] and 5 hub TFs [MYC (43,51,52), STAT5A (41,53), STAT5B (41,54), FOXO1 (44) and HLF (11)] have been previously implicated in B-ALL. Of these regulators, 3 hub TFs (MYC, STAT5A and STAT5B) participated in Jak-STAT signaling pathway which was directly related to B-ALL pathogenesis. Therefore, we constructed a sub-network from these 3 TFs and all their direct linked nodes in the network, and defined it as the B-ALL-related Jak-STAT signaling sub-network, which included 436 edges, 12 genes, 61 miRNAs and 11 TFs (Fig. 6).

Figure 5

Degree distribution of all nodes in the B-ALL miRNA-TF regulatory network. The x-axis represents the degree of the nodes, and the y-axis represents the number of nodes for each degree.

Figure 6

B-ALL-related Jak-STAT signaling sub-network. The symbols of different nodes and arrows are the same as Fig. 3.

Table VII

Hub miRNAs in B-ALL-related miRNA and transcription factor regulatory network.

Table VII

Hub miRNAs in B-ALL-related miRNA and transcription factor regulatory network.

TopmiRNAIn-degreeOut-degreeTotal degree
  1miR-17-5p12  11  23
  2miR-181b-5p12  921
  3miR-29b-3p17  421
  4miR-29c-3p17  421
  5miR-20a-5p12  820
  6miR-125b-5p11  718
  7miR-196b-5p13  316
  8miR-15a-5p11  516
  9miR-129-5p8614
10miR-18a-5p12  214
11miR-17-3p12  214
12miR-2355-5p13  114
13miR-424-5p10  414
14miR-106b-5p6814
15miR-497-5p9413
16miR-93-5p6713
17miR-16-5p7613
18miR-29a-3p7512
19miR-15b-5p7512
20miR-335-5p5712
21miR-22-3p9211
22miR-503-5p10  111
23miR-25-3p6410
24miR-9-5p4610
25miR-145-5p6410
26miR-34a-5p2810
27miR-181c-5p1910
28miR-30e-5p6410

Table VIII

Hub transcription factors in B-ALL-related miRNA and transcription factor regulatory network.

Table VIII

Hub transcription factors in B-ALL-related miRNA and transcription factor regulatory network.

TopTranscription factorIn-degreeOut-degreeTotal degree
  1CREB1  86371
  2MYC144963
  3FOXO4183250
  4NFKB1  04949
  5MEF2A  04646
  6SRY  04040
  7STAT5A  83240
  8PAX2  03030
  9FOXO1  03030
10NFYB  02929
11NFYA  02929
12STAT5B121729
13NFKB2  02828
14FOXF2  02828
15NFYC  02727
16STAT6  02626
17FOXD1  02020
18HLF  01717
19NFIL3  01313

Discussion

B-ALL is a genetically heterogeneous disease and many different types of cytogenetic abnormalities and molecular genetic mutations are important initiating events in the leukemogenesis of B-ALL (6,11,39). However, these genetic alterations are insufficient to fully explain the biology and heterogeneity of this disease (11). The pathogenesis of B-ALL is still not entirely clear to date. In particular, the heterogeneity and complexity makes it difficult to discover hub regulators and regulatory motifs involved in the pathogenesis of B-ALL. By integrating high-throughput expression profiling technology and bioinformatics approaches, systems biology focuses on exploring the interactions between biological molecules and explaining the biological phenomenon on the network level, which may accelerate the discovery of hub regulators and pathways that control various aspects of the disease pathogenesis (55,56).

To improve our understanding of the molecular mechanism of B-ALL, we applied systems biology approach to obtain and integrate expression changes of miRNAs and TFs between bone marrow samples from adult B-ALL patients and their controls, and constructed a miRNA-TF mediated regulatory network associated with this disease (Fig. 3). Subsequently, we identified the miRNA and TF mediated regulatory motifs from the network, including FFLs and FBLs (Table V), which are significant and prevalent motifs in gene regulatory networks (21). It has been reported that FFLs may work as the core of the global gene regulatory network and play critical roles in disease pathogenesis (23,57). The majority of FFLs in our network are TF-FFLs, in which TF as the main regulator controls the expression of both miRNA and their common target gene. This finding is consistent with a recent study that TF-FFL was the dominant motif in the development of B lymphocytes (57), revealing an important role of TF-FFL in B cell development and B-ALL pathogenesis.

For evaluating the functional properties of this network, GO and KEGG pathway annotation were used to analyze the enrichment of the network nodes (Fig. 4 and Table VI). Among 10 highly-enriched biological process terms, one half of these terms were related to the occurrence and development of B-ALL. Moreover, more than half of significantly-enriched pathways were directly associated with leukemia or hematopoiesis. Among them, four pathways have been reported to be implicated in B-ALL pathogenesis, such as PI3K-Akt signaling pathway, Jak-STAT signaling pathway, Ras signaling pathway and cell cycle pathway. Further network topological analysis identified 28 hub miRNAs and 19 hub TFs within the network (Tables VII and VIII). Of these, 4 hub miRNAs (miR-17-5p, miR-125b-5p, miR-18a-5p and miR-34a-5p) and 5 hub TFs (MYC, STAT5A, STAT5B, FOXO1 and HLF) were functionally associated with B-ALL, which have been confirmed in previous studies. Collectively, these results preliminarily verified the reliability of our network. Among these hub TFs, MYC, STAT5A and STAT5B participated in Jak-STAT signaling pathway which is the well-known pathway involved in B-ALL. As a member of the helix-loop-helix/leucine-zipper transcription factor family, MYC is a master regulator of important biological processes such as cell survival, proliferation, differentiation, metabolism and pluripotency maintenance (58,59). Constitutive activation of MYC exhibited in a variety of B-ALL cell lines (60). Double trans-genesis of MYC and Bcl-2 caused hyperproliferation of pre-B and B cells and promoted initiation of B-ALL in mice (51). Inhibition of MYC expression and STAT5 phosphorylation by JQ1 significantly prolonged survival in mice xenografted with primary human CRLF2-rearranged B-ALL (52). STAT5 is a cytoplasmic transcription factor that is usually transiently activated by phosphorylation in response to a wide variety of growth factors and cytokines (61). STAT5 consists of two separate genes, STAT5A and STAT5B, which collectively are key regulators of cell proliferation and survival in early B lymphopoiesis as well as plays an important role in ordering immunoglobulin recombination during B cell development (41). Constitutively high expression of STAT5A induced by retrovirus integration in mice perturbed signaling in early pre-B cells leading to spontaneous pre-B-ALL/pre-B lymphomas (62). Overexpression of STAT5A in mice cooperate with the loss of p53 function also promoted faster initiation of B-ALL/B-cell lymphoma (55). Furthermore, transgenic expression of STAT5B strongly synergized with adapter protein BLNK deficiency to induce pre-B-ALL in mice by inhibiting expression of p27 (54). To further investigate the regulation of MYC, STAT5A and STAT5B on highly complex molecular network in B-ALL, we subsequently constructed a B-ALL-related Jak-STAT signaling sub-network (Fig. 6) by extracting MYC, STAT5A, STAT5B and all their directly linking nodes from the network.

In the sub-network, MYC stood out as a key regulator due to its direct linking to STAT5A and STAT5B, which may establish cross-talk between MYC and all sub-network nodes. Notably, MYC and miR-15a-5p were predicted to cooperatively regulate their common target genes FMS-like tyrosine kinase 3 (FLT3), which constitute a MYC/miR-15a-5p/FLT3 TF-FFL. As a member of the miR-15 family as well as a hub miRNA in our network, miR-15a-5p is a potential tumor suppressor and is downregulated in glioma, bladder cancer, hepatoma, prostate cancer, chronic lymphocytic leukemia and different kinds of lymphoma, exerting its function by inducing apoptosis, inhibiting cell proliferation or suppressing tumorigenicity (63,64). In accord with the above-mentioned reports, decreased expression of miR-15a-5p was also observed in our study, indicating a potential relationship between miR-15a-5p and B-ALL. However, the exact effect of miR-15a-5p on B-ALL occurrence and development is still unknown. It has been reported that MYC transcriptionally repressed miR-15a-5p expression by binding to its host gene (DLEU2) promoter (58). Inhibition of miR-15a-5p expression by MYC may promote expression of their common target gene, the FLT3. Therefore, we speculate that MYC may synergize with miR-15a-5p to induce FLT3 expression in MYC/miR-15a-5p/FLT3 TF-FFL. FLT3 is a type III receptor tyrosine kinase, which is primarily expressed in lymphoid progenitors and early myeloid and plays a crucial role in their differentiation and proliferation (65). Highly expressed FLT3 was observed in nearly all pre-B-ALL and most acute myeloid leukemia (AML) patient samples as well as the majority of pre-B-ALL and AML cell lines (65–67). In B-ALL patients with an MLL-AF4 gene rearrangement, a high level of FLT3 expression was significantly correlated with a high risk of therapy failure (39). It has been reported that FLT3 may collaborate with MLL gene fusions to promote leukemogenesis of B-ALL (65). IMC-EB10, an anti-FLT3 monoclonal antibody, can inhibit FLT3 signaling as well as significantly prolongs survival and decrease the engraftment of NOD/SCID mice injected with human B-ALL cells, indicating an important role of FLT3 in the pathogenesis of B-ALL (67). FLT3 was also demonstrated to potently activate the STAT5A in both B-ALL and AML cell lines (65). Recently, STAT5A has been shown to bind to the 3′ super-enhancer of MYC and recruited BRD2 proteins to induce MYC gene expression (59), which establish a regulatory circuit that FLT3 may regulate MYC expression via activating the STAT5A. In our sub-network, upregulation of MYC expression may further promote the expression of FLT3 by the MYC/miR-15a-5p/FLT3 FFL, implying a positive feedback between MYC and FLT3 which will be involved in the pathogenesis of B-ALL. In the discussion above, we present a model of MYC/miR-15a-5p/FLT3 FFL involving in Jak-STAT signaling pathway and regulatory network in B-ALL (Fig. 7). Based on the literature review and our sub-network analysis, we propose that MYC/miR-15a-5p/FLT3 FFL is a potential key motif in the B-ALL miRNA-TF regulatory network, which may be associated with the occurrence and development of B-ALL.

Figure 7

A schematic model of MYC/miR-15a-5p/FLT3 FFL involving in Jak-STAT signaling pathway and regulatory network in B-ALL. Round nodes, TFs; rectangle nodes, miRNAs; hexagonal nodes, cytokines; ellipse nodes, genes. Edges, sharp arrow means activation; T-shaped arrow represents repression.

In conclusion, the miRNA and TF-based network analysis allows us to acquire an overall view of the molecular regulatory network involved in B-ALL. It also identified some key regulators and regulatory motifs for B-ALL, as well as provided new clues for deciphering the B-ALL pathogenesis at the transcriptional and post-transcriptional levels.

Abbreviations:

B-ALL

B-cell acute lymphoblastic leukemia

ALL

acute lymphoblastic leukemia

T-ALL

T-cell acute lymphoblastic leukemia

miRNA

microRNA

TF

transcription factor

TFBS

transcription factor binding site

FBL

feedback loop

FFL

feed-forward loop

WHO

World health Organization

HRP

horseradish peroxidase

qPCR

quantitative PCR

TSS

transcription start site

GO

Gene Oncology

KEGG

Kyoto Encydopedia of Gene and Genomes

STAT5

signal transducer and activator of transcription 5

FLT3

FMS-like tyrosine kinase 3

AML

acute myeloid leukemia

Acknowledgments

This study was financially supported by the Guangdong Provincial Natural Science Foundation of China (no. 2016A030313677), the Medical Science and Technology Research Fund of Guangdong Province (no. A2016193) and the Open Project Program of Guangdong Provincial Key Laboratory of Medical Molecular Diagnostics (no. FZZD201604). We sincerely thank all donors for taking part in this investigation.

References

1 

Purizaca J, Meza I and Pelayo R: Early lymphoid development and microenvironmental cues in B-cell acute lymphoblastic leukemia. Arch Med Res. 43:89–101. 2012. View Article : Google Scholar : PubMed/NCBI

2 

Sanjuan-Pla A, Bueno C, Prieto C, Acha P, Stam RW, Marschalek R and Menéndez P: Revisiting the biology of infant t(4;11)/MLL-AF4+ B-cell acute lymphoblastic leukemia. Blood. 126:2676–2685. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Korfi K, Smith M, Swan J, Somervaille TC, Dhomen N and Marais R: BIM mediates synergistic killing of B-cell acute lymphoblastic leukemia cells by BCL-2 and MEK inhibitors. Cell Death Dis. 7:e21772016. View Article : Google Scholar : PubMed/NCBI

4 

Luna-Aguirre CM, de la Luz Martinez-Fierro M, Mar-Aguilar F, Garza-Veloz I, Treviño-Alvarado V, Rojas-Martinez A, Jaime-Perez JC, Malagon-Santiago GI, Gutierrez-Aguirre CH, Gonzalez-Llano O, et al: Circulating microRNA expression profile in B-cell acute lymphoblastic leukemia. Cancer Biomark. 15:299–310. 2015. View Article : Google Scholar : PubMed/NCBI

5 

Tasian SK and Gardner RA: CD19-redirected chimeric antigen receptor-modified T cells: A promising immunotherapy for children and adults with B-cell acute lymphoblastic leukemia (ALL). Ther Adv Hematol. 6:228–241. 2015. View Article : Google Scholar : PubMed/NCBI

6 

Woo JS, Alberti MO and Tirado CA: Childhood B-acute lymphoblastic leukemia: A genetic update. Exp Hematol Oncol. 3:162014. View Article : Google Scholar : PubMed/NCBI

7 

Zhou Y, You MJ, Young KH, Lin P, Lu G, Medeiros LJ and Bueso-Ramos CE: Advances in the molecular pathobiology of B-lymphoblastic leukemia. Hum Pathol. 43:1347–1362. 2012. View Article : Google Scholar : PubMed/NCBI

8 

Pegram HJ, Smith EL, Rafiq S and Brentjens RJ: CAR therapy for hematological cancers: Can success seen in the treatment of B-cell acute lymphoblastic leukemia be applied to other hematological malignancies? Immunotherapy. 7:545–561. 2015. View Article : Google Scholar : PubMed/NCBI

9 

Zhang XH, Wang CC, Jiang Q, Yang SM, Jiang H, Lu J, Wang QM, Feng FE, Zhu XL, Zhao T, et al: ADAM28 overex-pression regulated via the PI3K/Akt pathway is associated with relapse in de novo adult B-cell acute lymphoblastic leukemia. Leuk Res. 39:1229–1238. 2015. View Article : Google Scholar

10 

Sikaria S, Aldoss I and Akhtari M: Monoclonal antibodies and immune therapies for adult precursor B-acute lymphoblastic leukemia. Immunol Lett. 172:113–123. 2016. View Article : Google Scholar : PubMed/NCBI

11 

Mullighan CG: Molecular genetics of B-precursor acute lymphoblastic leukemia. J Clin Invest. 122:3407–3415. 2012. View Article : Google Scholar : PubMed/NCBI

12 

Othman MA, Grygalewicz B, Pienkowska-Grela B, Rygier J, Ejduk A, Rincic M, Melo JB, Carreira IM, Meyer B and Liehr T: A novel IGH@ gene rearrangement associated with CDKN2A/B deletion in young adult B-cell acute lymphoblastic leukemia. Oncol Lett. 11:2117–2122. 2016.PubMed/NCBI

13 

Iacobucci I, Iraci N, Messina M, Lonetti A, Chiaretti S, Valli E, Ferrari A, Papayannidis C, Paoloni F, Vitale A, et al: IKAROS deletions dictate a unique gene expression signature in patients with adult B-cell acute lymphoblastic leukemia. PLoS One. 7:e409342012. View Article : Google Scholar : PubMed/NCBI

14 

Moorman AV: The clinical relevance of chromosomal and genomic abnormalities in B-cell precursor acute lymphoblastic leukaemia. Blood Rev. 26:123–135. 2012. View Article : Google Scholar : PubMed/NCBI

15 

Yoda A, Yoda Y, Chiaretti S, Bar-Natan M, Mani K, Rodig SJ, West N, Xiao Y, Brown JR, Mitsiades C, et al: Functional screening identifies CRLF2 in precursor B-cell acute lympho-blastic leukemia. Proc Natl Acad Sci USA. 107:252–257. 2010. View Article : Google Scholar

16 

Luan C, Yang Z and Chen B: The functional role of microRNA in acute lymphoblastic leukemia: Relevance for diagnosis, differential diagnosis, prognosis, and therapy. Onco Targets Ther. 8:2903–2914. 2015.PubMed/NCBI

17 

Cocco C and Airoldi I: Cytokines and microRNA in pediatric B-acute lymphoblastic leukemia. Cytokine Growth Factor Rev. 22:149–156. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Bousquet M, Harris MH, Zhou B and Lodish HF: MicroRNA miR-125b causes leukemia. Proc Natl Acad Sci USA. 107:21558–21563. 2010. View Article : Google Scholar : PubMed/NCBI

19 

Scherr M, Elder A, Battmer K, Barzan D, Bomken S, Ricke-Hoch M, Schröder A, Venturini L, Blair HJ, Vormoor J, et al: Differential expression of miR-17-92 identifies BCL2 as a therapeutic target in BCR-ABL-positive B-lineage acute lymphoblastic leukemia. Leukemia. 28:554–565. 2014. View Article : Google Scholar

20 

Piriyapongsa J, Jordan IK, Conley AB, Ronan T and Smalheiser NR: Transcription factor binding sites are highly enriched within microRNA precursor sequences. Biol Direct. 6:612011. View Article : Google Scholar : PubMed/NCBI

21 

Zhang HM, Kuang S, Xiong X, Gao T, Liu C and Guo AY: Transcription factor and microRNA co-regulatory loops: Important regulatory motifs in biological processes and diseases. Brief Bioinform. 16:45–58. 2015. View Article : Google Scholar

22 

Bhatia S, Kaul D and Varma N: Potential tumor suppressive function of miR-196b in B-cell lineage acute lymphoblastic leukemia. Mol Cell Biochem. 340:97–106. 2010. View Article : Google Scholar : PubMed/NCBI

23 

Ye H, Liu X, Lv M, Wu Y, Kuang S, Gong J, Yuan P, Zhong Z, Li Q, Jia H, et al: MicroRNA and transcription factor co-regulatory network analysis reveals miR-19 inhibits CYLD in T-cell acute lymphoblastic leukemia. Nucleic Acids Res. 40:5201–5214. 2012. View Article : Google Scholar : PubMed/NCBI

24 

Vardiman JW, Thiele J, Arber DA, Brunning RD, Borowitz MJ, Porwit A, Harris NL, Le Beau MM, Hellström-Lindberg E, Tefferi A, et al: The 2008 revision of the World Health Organization (WHO) classification of myeloid neoplasms and acute leukemia: Rationale and important changes. Blood. 114. pp. 937–951. 2009, View Article : Google Scholar

25 

Alvarnas JC, Brown PA, Aoun P, Ballen KK, Bellam N, Blum W, Boyer MW, Carraway HE, Coccia PF, Coutre SE, et al National Comprehensive Cancer Network: Acute lymphoblastic leukemia. J Natl Compr Canc Netw. 10:858–914. 2012.PubMed/NCBI

26 

Allen A, Gill K, Hoehn D, Sulis M, Bhagat G and Alobeid B: C-myc protein expression in B-cell acute lymphoblastic leukemia, prognostic significance? Leuk Res. 38:1061–1066. 2014. View Article : Google Scholar : PubMed/NCBI

27 

Pfaffl MW: A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29:e452001. View Article : Google Scholar : PubMed/NCBI

28 

Sui W, Lin H, Peng W, Huang Y, Chen J, Zhang Y and Dai Y: Molecular dysfunctions in acute rejection after renal transplantation revealed by integrated analysis of transcription factor, microRNA and long noncoding RNA. Genomics. 102:310–322. 2013. View Article : Google Scholar : PubMed/NCBI

29 

Dong M, Wang X, Zhao HL, Chen XL, Yuan JH, Guo JY, Li KQ and Li G: Integrated analysis of transcription factor, microRNA and LncRNA in an animal model of obliterative bronchiolitis. Int J Clin Exp Pathol. 8:7050–7058. 2015.PubMed/NCBI

30 

Lin Y, Wu J, Chen H, Mao Y, Liu Y, Mao Q, Yang K, Zheng X and Xie L: Cyclin-dependent kinase 4 is a novel target in micoRNA-195-mediated cell cycle arrest in bladder cancer cells. FEBS Lett. 586:442–447. 2012. View Article : Google Scholar : PubMed/NCBI

31 

Rappaport N, Nativ N, Stelzer G, Twik M, Guan-Golan Y, Stein TI, Bahir I, Belinky F, Morrey CP, Safran M, et al: MalaCards: An integrated compendium for diseases and their annotation. Database (Oxford). 2013:bat0182013. View Article : Google Scholar

32 

Felice B, Cattoglio C, Cittaro D, Testa A, Miccio A, Ferrari G, Luzi L, Recchia A and Mavilio F: Transcription factor binding sites are genetic determinants of retroviral integration in the human genome. PLoS One. 4:e45712009. View Article : Google Scholar : PubMed/NCBI

33 

Bang SY, Kim JH, Lee PY, Chi SW, Cho S, Yi GS, Myung PK, Park BC, Bae KH and Park SG: Candidate target genes for the Saccharomyces cerevisiae transcription factor, Yap2. Folia Microbiol (Praha). 58:403–408. 2013. View Article : Google Scholar

34 

Lin XC, Xu Y, Sun GP, Wen JL, Li N, Zhang YM, Yang ZG, Zhang HT and Dai Y: Molecular dysfunctions in acute myeloid leukemia revealed by integrated analysis of microRNA and transcription factor. Int J Oncol. 48:2367–2380. 2016.PubMed/NCBI

35 

Alexiou P, Vergoulis T, Gleditzsch M, Prekas G, Dalamagas T, Megraw M, Grosse I, Sellis T and Hatzigeorgiou AG: miRGen 2.0: A database of microRNA genomic information and regulation. Nucleic Acids Res. 38:D137–D141. 2010. View Article : Google Scholar :

36 

Harris MA, Clark J, Ireland A, Lomax J, Ashburner M, Foulger R, Eilbeck K, Lewis S, Marshall B, Mungall C, et al Gene Ontology Consortium: The Gene Ontology (GO) database and informatics resource. Nucleic Acids Res. 32:D258–D261. 2004. View Article : Google Scholar

37 

Kanehisa M, Araki M, Goto S, Hattori M, Hirakawa M, Itoh M, Katayama T, Kawashima S, Okuda S, Tokimatsu T, et al: KEGG for linking genomes to life and the environment. Nucleic Acids Res. 36:D480–D484. 2008. View Article : Google Scholar :

38 

Arora S, Rana R, Chhabra A, Jaiswal A and Rani V: miRNA-transcription factor interactions: A combinatorial regulation of gene expression. Mol Genet Genomics. 288:77–87. 2013. View Article : Google Scholar : PubMed/NCBI

39 

Zhou Y, Kanagal-Shamanna R, Zuo Z, Tang G, Medeiros LJ and Bueso-Ramos CE: Advances in B-lymphoblastic leukemia: Cytogenetic and genomic lesions. Ann Diagn Pathol. 23:43–50. 2016. View Article : Google Scholar : PubMed/NCBI

40 

Brondfield S, Umesh S, Corella A, Zuber J, Rappaport AR, Gaillard C, Lowe SW, Goga A and Kogan SC: Direct and indirect targeting of MYC to treat acute myeloid leukemia. Cancer Chemother Pharmacol. 76:35–46. 2015. View Article : Google Scholar : PubMed/NCBI

41 

Malin S, McManus S and Busslinger M: STAT5 in B cell development and leukemia. Curr Opin Immunol. 22:168–176. 2010. View Article : Google Scholar : PubMed/NCBI

42 

Berger A, Sexl V, Valent P and Moriggl R: Inhibition of STAT5: A therapeutic option in BCR-ABL1-driven leukemia. Oncotarget. 5:9564–9576. 2014. View Article : Google Scholar : PubMed/NCBI

43 

Chae HD, Mitton B, Lacayo NJ and Sakamoto KM: Replication factor C3 is a CREB target gene that regulates cell cycle progression through the modulation of chromatin loading of PCNA. Leukemia. 29:1379–1389. 2015. View Article : Google Scholar

44 

Köhrer S, Havranek O, Seyfried F, Hurtz C, Coffey GP, Kim E, Ten Hacken E, Jäger U, Vanura K, O'Brien S, et al: Pre-BCR signaling in precursor B-cell acute lymphoblastic leukemia regulates PI3K/AKT, FOXO1 and MYC, and can be targeted by SYK inhibition. Leukemia. 30:1246–1254. 2016. View Article : Google Scholar : PubMed/NCBI

45 

Coomans de Brachène A and Demoulin JB: FOXO transcription factors in cancer development and therapy. Cell Mol Life Sci. 73:1159–1172. 2016. View Article : Google Scholar

46 

Grosjean-Raillard J, Adès L, Boehrer S, Tailler M, Fabre C, Braun T, De Botton S, Israel A, Fenaux P and Kroemer G: Flt3 receptor inhibition reduces constitutive NFkappaB activation in high-risk myelodysplastic syndrome and acute myeloid leukemia. Apoptosis. 13:1148–1161. 2008. View Article : Google Scholar : PubMed/NCBI

47 

Vacca A, Felli MP, Palermo R, Di Mario G, Calce A, Di Giovine M, Frati L, Gulino A and Screpanti I: Notch3 and pre-TCR interaction unveils distinct NF-kappaB pathways in T-cell development and leukemia. EMBO J. 25:1000–1008. 2006. View Article : Google Scholar : PubMed/NCBI

48 

Bruns HA and Kaplan MH: The role of constitutively active Stat6 in leukemia and lymphoma. Crit Rev Oncol Hematol. 57:245–253. 2006. View Article : Google Scholar

49 

LeBrun DP: E2A basic helix-loop-helix transcription factors in human leukemia. Front Biosci. 8:s206–s222. 2003. View Article : Google Scholar : PubMed/NCBI

50 

Puissegur MP, Eichner R, Quelen C, Coyaud E, Mari B, Lebrigand K, Broccardo C, Nguyen-Khac F, Bousquet M and Brousset P: B-cell regulator of immunoglobulin heavy-chain transcription (Bright)/ARID3a is a direct target of the oncomir microRNA-125b in progenitor B-cells. Leukemia. 26:2224–2232. 2012. View Article : Google Scholar : PubMed/NCBI

51 

Strasser A, Harris AW, Bath ML and Cory S: Novel primitive lymphoid tumours induced in transgenic mice by cooperation between myc and bcl-2. Nature. 348:331–333. 1990. View Article : Google Scholar : PubMed/NCBI

52 

Ott CJ, Kopp N, Bird L, Paranal RM, Qi J, Bowman T, Rodig SJ, Kung AL, Bradner JE and Weinstock DM: BET bromodomain inhibition targets both c-Myc and IL7R in high-risk acute lymphoblastic leukemia. Blood. 120:2843–2852. 2012. View Article : Google Scholar : PubMed/NCBI

53 

Joliot V, Cormier F, Medyouf H, Alcalde H and Ghysdael J: Constitutive STAT5 activation specifically cooperates with the loss of p53 function in B-cell lymphomagenesis. Oncogene. 25:4573–4584. 2006. View Article : Google Scholar : PubMed/NCBI

54 

Nakayama J, Yamamoto M, Hayashi K, Satoh H, Bundo K, Kubo M, Goitsuka R, Farrar MA and Kitamura D: BLNK suppresses pre-B-cell leukemogenesis through inhibition of JAK3. Blood. 113:1483–1492. 2009. View Article : Google Scholar :

55 

Cho JH, Gelinas R, Wang K, Etheridge A, Piper MG, Batte K, Dakhallah D, Price J, Bornman D, Zhang S, et al: Systems biology of interstitial lung diseases: Integration of mRNA and microRNA expression changes. BMC Med Genomics. 4:82011. View Article : Google Scholar : PubMed/NCBI

56 

Li H: Systems genetics in '-omics' era: Current and future development. Theory Biosci. 132:1–16. 2013. View Article : Google Scholar

57 

Lin Y, Zhang Q, Zhang HM, Liu W, Liu CJ, Li Q and Guo AY: Transcription factor and miRNA co-regulatory network reveals shared and specific regulators in the development of B cell and T cell. Sci Rep. 5:152152015. View Article : Google Scholar : PubMed/NCBI

58 

Jackstadt R and Hermeking H: MicroRNAs as regulators and mediators of c-MYC function. Biochim Biophys Acta. 1849:544–553. 2015. View Article : Google Scholar

59 

Pinz S, Unser S and Rascle A: Signal transducer and activator of transcription STAT5 is recruited to c-Myc super-enhancer. BMC Mol Biol. 17:102016. View Article : Google Scholar : PubMed/NCBI

60 

Han SS, Han S and Kamberos NL: Piperlongumine inhibits the proliferation and survival of B-cell acute lymphoblastic leukemia cell lines irrespective of glucocorticoid resistance. Biochem Biophys Res Commun. 452:669–675. 2014. View Article : Google Scholar : PubMed/NCBI

61 

Schepers H, Wierenga AT, Vellenga E and Schuringa JJ: STAT5-mediated self-renewal of normal hematopoietic and leukemic stem cells. JAK-STAT. 1:13–22. 2012. View Article : Google Scholar : PubMed/NCBI

62 

Tsuruyama T, Nakamura T, Jin G, Ozeki M, Yamada Y and Hiai H: Constitutive activation of Stat5a by retrovirus integration in early pre-B lymphomas of SL/Kh strain mice. Proc Natl Acad Sci USA. 99:8253–8258. 2002. View Article : Google Scholar : PubMed/NCBI

63 

Gao SM, Yang J, Chen C, Zhang S, Xing CY, Li H, Wu J and Jiang L: miR-15a/16–1 enhances retinoic acid-mediated differentiation of leukemic cells and is upregulated by retinoic acid. Leuk Lymphoma. 52:2365–2371. 2011. View Article : Google Scholar : PubMed/NCBI

64 

Huang E, Liu R and Chu Y: miRNA-15a/16: As tumor suppressors and more. Future Oncol. 11:2351–2363. 2015. View Article : Google Scholar : PubMed/NCBI

65 

Gu TL, Nardone J, Wang Y, Loriaux M, Villén J, Beausoleil S, Tucker M, Kornhauser J, Ren J, MacNeill J, et al: Survey of activated FLT3 signaling in leukemia. PLoS One. 6:e191692011. View Article : Google Scholar : PubMed/NCBI

66 

Annesley CE and Brown P: The biology and targeting of FLT3 in pediatric leukemia. Front Oncol. 4:2632014. View Article : Google Scholar : PubMed/NCBI

67 

Small D: Targeting FLT3 for the treatment of leukemia. Semin Hematol. 45(Suppl 2): S17–S21. 2008. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Lin X, Liu X, Zhang Y, Li N, Yang Z, Fu W, Lan L, Zhang H and Dai Y: Integrated analysis of microRNA and transcription factor reveals important regulators and regulatory motifs in adult B-cell acute lymphoblastic leukemia. Int J Oncol 50: 671-683, 2017.
APA
Lin, X., Liu, X., Zhang, Y., Li, N., Yang, Z., Fu, W. ... Dai, Y. (2017). Integrated analysis of microRNA and transcription factor reveals important regulators and regulatory motifs in adult B-cell acute lymphoblastic leukemia. International Journal of Oncology, 50, 671-683. https://doi.org/10.3892/ijo.2016.3832
MLA
Lin, X., Liu, X., Zhang, Y., Li, N., Yang, Z., Fu, W., Lan, L., Zhang, H., Dai, Y."Integrated analysis of microRNA and transcription factor reveals important regulators and regulatory motifs in adult B-cell acute lymphoblastic leukemia". International Journal of Oncology 50.2 (2017): 671-683.
Chicago
Lin, X., Liu, X., Zhang, Y., Li, N., Yang, Z., Fu, W., Lan, L., Zhang, H., Dai, Y."Integrated analysis of microRNA and transcription factor reveals important regulators and regulatory motifs in adult B-cell acute lymphoblastic leukemia". International Journal of Oncology 50, no. 2 (2017): 671-683. https://doi.org/10.3892/ijo.2016.3832
Copy and paste a formatted citation
x
Spandidos Publications style
Lin X, Liu X, Zhang Y, Li N, Yang Z, Fu W, Lan L, Zhang H and Dai Y: Integrated analysis of microRNA and transcription factor reveals important regulators and regulatory motifs in adult B-cell acute lymphoblastic leukemia. Int J Oncol 50: 671-683, 2017.
APA
Lin, X., Liu, X., Zhang, Y., Li, N., Yang, Z., Fu, W. ... Dai, Y. (2017). Integrated analysis of microRNA and transcription factor reveals important regulators and regulatory motifs in adult B-cell acute lymphoblastic leukemia. International Journal of Oncology, 50, 671-683. https://doi.org/10.3892/ijo.2016.3832
MLA
Lin, X., Liu, X., Zhang, Y., Li, N., Yang, Z., Fu, W., Lan, L., Zhang, H., Dai, Y."Integrated analysis of microRNA and transcription factor reveals important regulators and regulatory motifs in adult B-cell acute lymphoblastic leukemia". International Journal of Oncology 50.2 (2017): 671-683.
Chicago
Lin, X., Liu, X., Zhang, Y., Li, N., Yang, Z., Fu, W., Lan, L., Zhang, H., Dai, Y."Integrated analysis of microRNA and transcription factor reveals important regulators and regulatory motifs in adult B-cell acute lymphoblastic leukemia". International Journal of Oncology 50, no. 2 (2017): 671-683. https://doi.org/10.3892/ijo.2016.3832
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team