Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
March-2019 Volume 54 Issue 3

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March-2019 Volume 54 Issue 3

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Fe3O4-solamargine induces apoptosis and inhibits metastasis of pancreatic cancer cells

Retraction in: /10.3892/ijo.2024.5657
  • Authors:
    • Xiaodong Xie
    • Xiuming Zhang
    • Jun Chen
    • Xun Tang
    • Meiqin Wang
    • Lei Zhang
    • Zhen Guo
    • Wenrong Shen
  • View Affiliations / Copyright

    Affiliations: Department of Radiology, Jiangsu Cancer Hospital, Jiangsu Institute of Cancer Research, Nanjing Medical University Affiliated Cancer Hospital, Nanjing, Jiangsu 210000, P.R. China, Department of Intervention, Jiangsu Cancer Hospital, Jiangsu Institute of Cancer Research, Nanjing Medical University Affiliated Cancer Hospital, Nanjing, Jiangsu 210000, P.R. China, Department of Clinical Laboratory, Jiangsu Cancer Hospital, Jiangsu Institute of Cancer Research, Nanjing Medical University Affiliated Cancer Hospital, Nanjing, Jiangsu 210000, P.R. China
    Copyright: © Xie et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 905-915
    |
    Published online on: November 19, 2018
       https://doi.org/10.3892/ijo.2018.4637
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Fe3O4-magnetic liposome (MLP) can deliver drugs to target tissues and can increase drug efficacy. The present study aimed to investigate the effects of solamargine (SM) and Fe3O4-SM in pancreatic cancer (PC). Cell viability was detected using a Cell Counting kit‑8 assay. Apoptosis and cell cycle progression was tested using a flow cytometry assay. A scratch assay was used to examine cell metastasis. Quantitative polymerase chain reaction, western blot analysis or immunohistochemical analysis were performed to determine the expression of target factors. Magnetic resonance imagining (MRI) and terminal deoxynucleotidyl-transferase-mediated dUTP nick end labelling were conducted to detect tumor growth and apoptosis in vivo, respectively. It was demonstrated that Fe3O4-SM inhibited cancer cell growth via a slow release of SM over an extended period of time. SM was revealed to induce apoptosis and cell cycle arrest. Furthermore, SM decreased the expression of X-linked inhibitor of apoptosis, Survivin, Ki‑67, proliferating cell nuclear antigen and cyclin D1, but increased the activity of caspase-3. It was also observed that SM inhibited tumor cell metastasis by modulating the expression of matrix metalloproteinase (MMP)-2 and TIMP metallopeptidase inhibitor-2. Furthermore, the phosphorylation of protein kinase B and mechanistic target of rapamycin was suppressed by SM. Notably, the effect of SM was enhanced by Fe3O4-SM. The malignant growth of PC was decreased by SM in vivo. Furthermore, the expression of Ki‑67 was decreased by SM and Fe3O4-SM. Additionally, cell apoptosis was increased in the Fe3O4-SM group, compared with the SM group. The present study illustrated the antitumor effect and action mec­hanism produced by SM. Additionally, it was demonstrated that Fe3O4-SM was more effective than SM in protecting against PC.

Introduction

Pancreatic cancer (PC) originates in the pancreas and when the pancreatic cells grow uncontrollably, a tumor mass forms. PC cells are able to invade other distant organs within the body (1). The most common type of PC is pancreatic ductal adenocarcinoma, which accounts for ~85% of PC cases (2), and the incidence of PC is increasing. Furthermore, PC is prone to metastasis in the early stages, and such a phenomenon leads to a high mortality rate among patients with PC. In 2015, 411,600 fatalities globally were caused by all types of PC (3). Although the development of surgical techniques and novel drugs is progressing, the 5-year survival rate remains approximately 6% (4). Therefore, investigating novel strategies to treat PC is of clinical significance.

Currently, surgery, radiotherapy and chemotherapy remain the three main traditional tumor therapy methods. However, it is difficult to achieve satisfactory outcomes through applying the traditional treatment methods, as surgery may result in trauma, and radiotherapy and chemotherapy may lead to severe side effects (5). Magnetic targeted drugs delivery system (MTDS), with its high delivery efficiency and good biocompatibility, has attracted much attention since the 1980s (6,7). Magnetic liposome (MLP) was first applied clinically in the 1990s (8,9). Magnetic nanoparticles are composed of a magnetic core and a biocompatible polymeric shell. Under the external magnetic field, the drug-encapsulated magnetic nanoparticles will accumulate in the target tissue area. The drug can then be released from particles in a controlled manner.

The magnetic particles used in nano-magnetic drug carriers are mainly iron monomers, for example, Fe2O3, Fe3O4 and manganese zinc ferrite complex (10,11). Fe3O4 nanoparticles, as one of the ferrites, have been regarded as magnetic nanoparticles in MTDS with good biocompatibility (12,13). The methods for applying an external magnetic field consist of static and alternating magnetic fields (14,15). It has been demonstrated that the drug-loaded magnetic nanoparticles can be gathered by an external magnetic field around the tumor region (16), thereby killing the tumor cells. Magnetic nanoparticles can be applied in magnetic resonance imaging (MRI) visibility and nanoparticle tracking (17). Therefore, it is of great significance to develop the magnetic targeting drug carrier.

As a steroidal molecule, solamargine (SM) can be isolated from solanum incanum (18). The structure of SM has also been identified previously (19). SM could deliver its effect by simple diffusion via penetrating the cell membrane. SM is belongs to the steroidal molecule family. It has been reported that SM can induce cell death by triggering cell apoptosis in various types of cancer cell (20-22). Nevertheless, the function of SM in PC remains to be investigated. In the present study, the effect of SM and Fe3O4-SM was determined, as the effects of a reagent not only rely on the properties itself, but also on the method of reagent delivery. SM was loaded onto Fe3O4 MLP to prepare a drug delivery system. The effect of Fe3O4-SM on PC was determined by determining cell growth, cell apoptosis and cell cycle progression. The present study also examined the potential mechanism of this. The results of the present study contributed toward the understanding of the effect of SM on PC and provided a novel drug delivery system in treating PC.

Materials and methods

Drugs

Solamargine (SM; CAS No., 20311-51-7; purity, >98%) was purchased from MedChemExpress (Monmouth Junction, NJ, USA).

Preparation of Fe3O4 and Fe3O4-SM

The chemical precipitation method (23) was adopted to prepare Fe3O4. The molar ratio of Fe2+:Fe3+=1:2 (a certain amount of FeSO4 and FeCl3) was dissolved in distilled water. Next, 4 mol/ml NaOH (pre-heated to 60°C) was incubated with FeSO4 and FeCl3 mixture with mechanical agitation. The Fe3O4 precipitate was then formed. The lecithin/Fe3O4 nanoparticle (quality ratio, 10:1) mixture was dissolved in water (the volume of water was equal to 1/5 of the mixture). In brief, the nanoparticles were added into the SM solution and underwent ultrasonic treatment for 6 h. The mixture was then further mixed with ether solution, which contained lecithin and cholesterol. Following rotation for 1 min, the mixture underwent rotary evaporation in a water bath at 37°C. Following emulsion being performed three times, the magnetic nanoparticles were aggregated. Fe3O4-SM was separated and purified. A transmission electron microscope (magnification, ×120,000) (2000 FX; JEOL, Ltd., Tokyo, Japan) was used to record TEM images. X-ray diffraction (XRD) was performed using Rigaku D/max 2550V (Rigaku Corporation, Tokyo, Japan). Particle size (PCS) analysis was performed using LS13320 (Beckman Coulter, Inc., Brea, CA, USA). The SM content in Fe3O4-SM nanocomplex was determined using inductively coupled plasma-mass spectrometry (ICPMS; Optima 5300DV, PerkinElmer, Inc., Waltham, MA, USA).

Cell culture and grouping

The pancreatic cancer BxPC-3 cell line (American Type Culture Collection, Manassas, VA, USA) was cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) in a humidified incubator with 5% CO2 at 37°C. For the subsequent experiments, the cell grouping was as follows: Mock group, tumor cells without any treatment; SM group, tumor cells were treated with SM for 16 h; and Fe3O4-SM group, cells were treated with Fe3O4-SM for 16 h. The final concentration of SM in the latter two groups was set at 4.8 µM.

Growth inhibition assay

The cells were seeded into 96-well plates at a density of 1x104 cells/well, prior to being treated with SM or Fe3O4-SM for 16 h. The final concentrations of SM were 2.4, 4.8 and 9.6 µM. Cell viability was determined using a CCK-8 assay (Beyotime Institute of Biotechnology, Haimen, China). Absorbance was read on an automated plate reader (Bio-Rad Laboratories, Inc., Hercules, CA, USA) at 450 nm. Cell growth inhibition is presented as the percentage of untreated controls. Growth inhibition was also determined when the cells were treated with SM or Fe3O4-SM (final concentration of SM, 4.8 µM) for 12, 18, 24 and 48 h. All determinations were performed in triplicate.

Flow cytometric analysis

Apoptosis was tested using an Annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) kit, according to the manufacturer's protocol. In brief, the tumor cells treated with SM or Fe3O4-SM were collected and re-suspended in PBS. Following incubation with Annexin V-FITC for 15 min and with PI for 10 min, cell apoptosis was analyzed using a FACScan flow cytom-eter (BD Biosciences, Franklin Lakes, NJ, USA). In order to determine cell cycle distribution, the cells were first fixed with 4% paraformaldehyde for 30 min at 4°C, prior to being collected and stained with PI for 30 min at 4°C. FACScan (BD Biosciences) with CELLQuest™ software version 3.3 (BD Biosciences) was used for data analysis.

Determination of caspase-3 activity

At a density of 2×106 cells/well, the cells were incubated with SM or Fe3O4-SM at 37°C for 16 h in a 96-well plate. Colorimetric substrate (Ac-DEVD-pNA) was used to detect the activities of caspase-3. The caspase-3 detection kit (cat. no. G007) was purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The samples were maintained at 37°C and the optical density at 405 nm was measured using an ELISA reader (Multisken Ascent; Thermo Labsystems, Santa Rosa, CA, USA).

Scratch assay

As previously described (24), a scratch assay was performed to detect cell migration. The cells (1.0×106 cells) were seeded onto the dishes and maintained in an incubator for 8 h. A P200 pipette tip was used to scratch the monolayer. Next, the cells were incubated for another 12 h. The gap distance between the scratch edges was measured by cellSens software (Olympus Corporation, Tokyo, Japan) to determine the cell migration ability.

Cell invasion assay

The invasive ability of the cells was determined using a Transwell assay with Matrigel. In brief, the cells were starved overnight. The cells at a density of 2×105 cells/ml were seeded with Matrigel (BD Biosciences) into the upper chamber of the Transwell. The upper chamber was filled with RPMI-1640 medium without FBS. RPMI-1640 medium containing 15% FBS was plated into the lower chamber of the Transwell. The Transwell was maintained at 37°C for 24 h, allowing the cells to invade into the lower chamber. The invaded cells were harvested and then fixed with 4% paraformaldehyde at 4°C for 30 min. The cells were then stained with 0.1% crystal violet dye for 20 min at room temperature. The cells were observed under an inverted microscope (magnification, ×40).

Quantitative polymerase chain reaction (qPCR)

RNAiso Plus (Takara Bio, Inc., Otsu, Japan) was used to isolate total RNA. The RNA was reverse transcribed using M-MLV reverse transcriptase (Promega Corporation, Madison, WI, USA). The synthesized cDNA was subject to subsequent PCR quantification. PCR was performed using SYBR qPCR mix (Toyobo Life Science, Osaka, Japan) on an iCycler (Bio-Rad Laboratories, Inc.). The thermocycling conditions were as follows: 95°C for 3 min; 33 cycles of 95°C for 15 sec, 60°C for 30 sec; a final extension at 72°C for 10 min. The 2−∆∆Cq method was used for data analysis (25). β-actin mRNA expression was used as a reference. The Primer-BLAST-based sequences are listed in Table I.

Table I

Summary of the reverse transcription-quantitative polymerase chain reaction primers.

Table I

Summary of the reverse transcription-quantitative polymerase chain reaction primers.

GeneForward primers (5′-3′)Reverse primers (5′-3′)
XIAP TGTCCCTTTGATTACGGGCT AAGCCTGTAATCCCAGCACT
Survivin GTCCCTGGCTCCTCTACTG GACGCTTCCTATCACTCTATTC
Ki-67 GCCCCTAAAGTAGAACCCGT GGGTTCGGATGATTTGCCTC
PCNA CGGATACCTTGGCGCTAGTA CACTCCGTCTTTTGCACAGG
Cyclin D1 CCCTCGGTGTCCTACTTCAA CTTAGAGGCCACGAACATGC
MMP-2 ACCACAGCCAACTACGATGA GCTCCTGAATGCCCTTGATG
MMP-9 GAGACTCTACACCCAGGACG GAAAGTGAAGGGGAAGACGC
TIMP-2 TGTGTTCCCTCAGTGTGGTT TTCGGTTTCATTGCGTGTGT
β-actin CTCCATCCTGGCCTCGCTGT GCTGTCACCTTCACCGTTCC

[i] XIAP, X-linked inhibitor of apoptosis protein; PCNA, proliferating cell nuclear antigen; MMP, matrix metalloproteinase; TIMP, TIMP metallopeptidase inhibitor.

Western blot analysis

Cells were lysed in NP40 lysis buffer (Beyotime Institute of Biotechnology) containing protease inhibitors. Following centrifugation at 12,000 × g for 5 min at 4°C, the protein concentration was detected using a bicinchoninic acid protein quantitative analysis kit (Thermo Fisher Scientific, Inc.). Proteins (20 µg) was separated by 8% SDS-PAGE and transferred onto polyvinylidene difluoride membranes. In order to block non-specific binding, the membranes were incubated with 5% skimmed milk at room temperature for 2 h. The membranes were incubated with primary antibodies against the following: XIAP (cat. no. ab28151; dilution, 1:100), survivin (cat. no. ab208938; dilution, 1:1,000), Ki-67 (cat. no. ab16667, 1:100), PCNA (cat. no. ab29; dilution, 1:200), cyclin D1 (cat. no. ab134175; dilution, 1:10,000), MMP-2 (cat. no. ab92536; dilution, 1:2,000), MMP-9 (cat. no. ab38898; dilution, 1:1,000), TIMP-2 (cat. no. ab1828; dilution, 1:1,000), p-Akt (cat. no. ab131443; dilution, 1:800), Akt (cat. no. ab188099; dilution, 1:2,000), p-mTOR (cat. no. ab109268; dilution, 1:1,000), mTOR (cat. no. ab2732; dilution, 1:2,000) and GAPDH (cat. no. ab8245; dilution, 1:1,000; all Abcam, Cambridge, UK) at 4°C overnight. The next day, the membranes were incubated with a goat anti-rabbit horseradish peroxidase-conjugated IgG H&L secondary antibody (cat. no. ab6721; dilution, 1:2,000; Abcam). Bands were developed on X-ray film by enhanced chemiluminescence (Beyotime Institute of Biotechnology). The density of the blots was read by using the Quantity One software version 2.4 (Bio-Rad Laboratories, Inc.).

Animals

The Balb/c nude mice (n=25, 4-6 weeks old, 12-15 g, male) were obtained from Shanghai Animal Center. Animals were housed at 22°C with 40-50% humidity. After being acclimatized, the animals were approved for the experiments. BxPC-3 cells (1.0×107/0.2 ml) were implanted into the hypoderm of the armpit of the mice to produce pancreatic cancer xenografts. When the diameter reached 3-4 mm, the mice were distributed into the following 4 groups (6 animals/group): Mock group, mice were considered as control; saline group, mice were injected with 0.9% saline by caudal vein injection; SM group, mice were injected with SM by caudal vein injection; Fe3O4-SM group, mice were injected with 0.2 ml Fe3O4-SM and a round magnet (magnet size was 0.3T; diameter, 25.40 mm; thickness 6.35 mm) was placed externally on the mouse (the magnet was tied using a steel wire under the armpit). The final concentration of SM was 4.8 µM (according to the data from the growth inhibition assay). The largest subcutaneous tumor detected in the present study had a diameter of 1.8 cm and no mice exhibited multiple subcutaneous tumors. According to previous studies (26,27), the humane endpoints were judged by the mouse weight loss (>20% of total body weight) or mouse activity assessment (hunching, stationary, ruffling and poor grooming) and mice were euthanized by O2/CO2-asphyxiation and dissected. All the protocols in the animal studies were approved by the Ethics Committee of Jiangsu Cancer Hospital (Nanjing, Jiangsu, China).

Tumor volume assessment and MRI imaging

The nude mice bearing xenografts were injected with saline (0.9%), SM or Fe3O4-SM by caudal vein injection. On the seventh, fourteenth and twenty first days after the injection, MRI scans were performed on the mice. MRI was conducted using a 1.5 Tesla scanner (INTERA ACHIEVA 1.5T; Philips Medical Systems) with SENSE-body coil. The tumor exhibited a high-signal intensity on T2-weighted images. The longitudinal diameter (d1) on the sagittal images, the anteroposterior diameter (d2) on the sagittal images and the largest lateral diameter (d3) on the axial images were measured. The diameter-based calculations for tumor volume were calculated as d1 × d2 × d3 × π/6.

H&E staining and immunohistochemistry (IHC)

The animals were sacrificed and the tumor mass were excised. Following fixing with 4% paraformaldehyde overnight at 4°C, the samples were dehydrated in a graded ethanol series, followed by routine paraffin embedding and sectioning (3-4 µm). The paraffin-embedded tissue sections were subjected to H&E staining and IHC. The sections were subjected to deparaffinization by washing with xylene and rehydration in a graded ethanol series. Slides were boiled by immersing them in a sodium citrate buffer (pH 6.0, 10 mM) and heated to 95°C for antigen retrieval. The cooled sections were then incubated in 3% hydrogen peroxide for 10 min at room temperature. Following incubation with 10% normal goat serum (Beyotime Institute of Biotechnology) for 30 min at 37°C, the sections were maintained with primary anti-Ki-67 antibody (cat. no. ab15580; dilution, 1:100, Abcam) at 4°C overnight. Biotin-labeled secondary antibodies were the incubated with the sections at room temperature for 1 h, prior to incubation with horseradish peroxidase-conjugated streptavidin for 30 min at room temperature. Slides were stained with diaminobenzidine (DAB) for 5 min at room temperature. Next, Mayer's hematoxylin (Sangon Biotech Co., Ltd., Shanghai, China) was incubated with the slides for 2 min at room temperature. The sections were observed using a light microscope (magnification, ×100). Finally, the sections were mounted with neutral balsam (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China).

Terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) staining

TUNEL was conducted using TUNEL assay kit (Roche Diagnostics, Basel, Switzerland), according to the manufacturer's protocol. In brief, the tissues were fixed with 4% paraformaldehyde overnight at 4°C. Xylene was used for deparaffinization of the paraffin-embedded sections. Terminal deoxynucleotidyl transferase (TdT) enzyme was incubated with sections for 1 h at 37°C. The sections were incubated with 0.3% H2O2 for 3 min at room temperature. The nuclei were stained with 50 µl DAB working solution for 10 min at room temperature. The slides were counterstained with hematoxylin and mounted with neutral balsam. A light microscope was used to observe the cell staining (magnification, ×100). The percentage of apoptotic cells was determined by counting TUNEL-positive cells. The brown staining demonstrated apoptotic cells and the blue staining demonstrated non-apoptotic cells. Five randomly selected fields was observed.

Statistical analysis

P<0.05 was considered to indicate a statistically significant difference. Prism Graphpad version 6.0 software (GraphPad Software, Inc., La Jola, CA, USA) was used to analyze the data. Data was shown as mean ± standard deviation. One-way analysis of variance followed by Tukey's multiple comparisons test.

Results

Identification of Fe3O4-MLP

As demonstrated in Fig. 1A, the average particle size of Fe3O4-MLP was 11.9 nm. The results from XRD demonstrated that the diffraction peaks of Fe3O4-MLP were 210, 320, 410, 435, 520, 450 and 533. The results were in line with the characteristic peak of Fe3O4 nanoparticles (Fig. 1B). The average particle size of Fe3O4-SM was 5-6 nm (Fig. 2A and B).The diffraction peaks of Fe3O4-SM were similar to that of Fe3O4-MLP (Fig. 2C).

Figure 1

Identification of Fe3O4-MLP. (A) Particle size distribution of Fe3O4-MLP measured by particle size. (B) X-ray diffraction imaging of Fe3O4-MLP. MLP, magnetic liposome.

Figure 2

Imaging and size distribution of Fe3O4-SM. (A) Transmission electron microscopy images for Fe3O4-SM. (B) The particle size distribution of Fe3O4-SM measured by particle size. (C) X-ray diffraction imaging of Fe3O4-SM. SM, solamargine.

Effect of Fe3O4-SM on cell viability in vitro

As demonstrated in Fig. 3A, the Fe3O4-MLP treatment did not decrease cell growth. Compared with the Mock group, the cell viability was first depressed by SM (P<0.05) and was then further inhibited by Fe3O4-SM (P<0.05). The effect of SM occurred in a dose-dependent manner. Furthermore, CCK-8 results demonstrated that during 12-18 h, the cell growth inhibition effect produced by SM was stronger than that generated by Fe3O4-SM. However, the inhibitory effect of Fe3O4-SM was greater than that of SM after 24 h (Fig. 3B; P<0.05). The results demonstrated that the Fe3O4-SM exerted its antitumor effect slowly.

Figure 3

Effects of Fe3O4-SM on the cell apoptosis and cell cycle. (A) Effect of SM on growth inhibition at different concentrations was detected by Cell Counting kit-8 assay. The PC cells were treated with SM, Fe3O4-SM or Fe3O4-magnetic liposome for 16 h, the untreated PC cells acted as control. *P<0.05 vs. 2.4 µM; ^P<0.05 vs. 4.8 µM; #P<0.05 vs. SM group. (B) Growth inhibition at different time-points. The PC cells were treated with SM or Fe3O4-SM, and viability was detected after 12, 18, 24 and 48 h. *P<0.05 vs. SM group. (C and D) Apoptosis detection by FCM; (E and F) Cell cycle distribution determined by FCM. Mock, PC cells without treatment; SM, cells treated with SM; Fe3O4-SM, cells treated with Fe3-O4SM; *P<0.05, **P<0.01 vs. Mock group; #P<0.05 vs. SM group. SM, solamargine; PC, pancreatic cancer; FCM, flow cytometry.

Effect of Fe3O4-SM on apoptosis and cell cycle progression in vitro

Subsequently, apoptosis and cell cycle progression were determined. Flow cytometric results demonstrated that apoptosis was first induced by SM (P<0.05) and then further enhanced by Fe3O4-SM (P<0.05; Fig. 3C and D). Furthermore, compared with the mock group, the cell numbers in the G1 phase during the cell cycle progression were higher in the SM (P<0.05) and Fe3O4-SM (P<0.01) groups. However, the cell percentage in G2 phase was reduced in the SM and Fe3O4-SM groups (P<0.05). Fe3O4-SM was revealed to significantly enhance the effect of SM (Fig. 3E and F; P<0.05). To further confirm the pro-apoptotic effect of Fe3O4-SM, the expression of proliferation-related and apoptosis-related molecules was determined. The results demonstrated that the expression of XIAP, survivin, Ki-67, PCNA and cyclin D1 were decreased at the transcriptional and translational levels in the SM and Fe3O4-SM groups. Treatment with Fe3O4-SM further increased the effect of SM (P<0.05; Fig. 4A–C). The activity of caspase-3 was also tested, and data from ELISA revealed that the active caspase-3 activity was also increased in the Fe3O4-SM group, compared with the SM group (P<0.01; Fig. 4D).

Figure 4

Effects of Fe3O4-SM on the expression of cell apoptosis-related and cell cycle-related genes. (A) Quantitative polymerase chain reaction for the mRNA expression of XIAP, Survivin, Ki-67, PCNA and cyclin D1; (B and C) western blot analysis for the protein expression of XIAP, survivin, Ki-67, PCNA and cyclin D1; and (D) the caspase-3 activity measured by ELISA; *P<0.05, **P<0.01 vs. Mock group; #P<0.05, ##P<0.01 vs. SM group. SM, solamargine; XIAP, X-linked inhibitor of apoptosis; PCNA, proliferating cell nuclear antigen.

Effect of Fe3O4-SM on tumor cell migration and invasion in vitro

Metastasis is also a common and typical phenotype of cancer. Therefore, the effect of Fe3O4-SM on cell migration and invasion ability was examined. Fig. 5A demonstrated that the wound thickness was larger in the SM and Fe3O4-SM (P<0.01) groups, suggesting that the cell migration ability was depressed. Furthermore, it was demonstrated that the cell migration ability was dampened more by Fe3O4-SM than by SM. Additionally, cell invasion was further inhibited by Fe3O4-SM, compared with the SM group (P<0.01; Fig. 5B). The expression of molecules associated with tumor metastasis was also detected. The results of the present study demonstrated that the expression of MMP-2 was decreased more in the Fe3O4-SM group than in SM group (P<0.05). However, the expression of MMP-9 exhibited no significant changes among these groups. By contrast, the expression of TIMP-2 was higher in the Fe3O4-SM group than that in the SM group (P<0.05; Fig. 5C–E).

Figure 5

Effects of Fe3O4-SM on cell invasion and migration. (A) Scratch assay for cell migration; scale bar, 20 µm. (B) Transwell assay for cell invasion.; scale bar, 20 µm. (C) Quantitative polymerase chain reaction for the mRNA expression of MMP-2, MMP-9 and TIMP-2. (D and E) Western blot analysis for the protein expression of MMP-2, MMP-9 and TIMP-2. *P<0.05, **P<0.01 vs. Mock group; #P<0.05, ##P<0.01 vs. SM group. SM, solamargine; MMP, matrix metalloproteinase; TIMP, TIMP metallopeptidase inhibitor.

Effect of Fe3O4-SM on the Akt/mTOR signaling pathway

To illustrate the underlying mechanisms, the activity of the Akt/mTOR signaling pathway was determined. The results revealed that the expression of p-Akt and p-mTOR was decreased by SM (P<0.05), compared with the Mock group. Furthermore, treatment with Fe3O4-SM further enhanced the effect of SM (P<0.01; Fig. 6A and B).

Figure 6

Effects of Fe3O4-SM on the activity of the Akt/mTOR signaling pathway. Western blot analysis for the protein expression of (A) p-Akt and (B) p-mTOR. *P<0.05, **P<0.01 vs. Mock group; ##P<0.01 vs. SM group. SM, solamargine; p-Akt, phosphorylated protein kinase B; p-mTOR, phosphorylated mechanistic target of rapamycin.

Fe3O4-SM inhibits tumor growth and induces tumor apoptosis in vivo

The effect produced by Fe3O4-SM was estimated in vivo. MRI was employed to assess tumor size and volume. MRI images revealed that the tumor volume increased as time progressed. However, the tumor growth rates in the SM and Fe3O4-SM groups were slower than those in the mock and saline groups. After 21 days, the tumor volume, size and weight in the Fe3O4-SM group was the smallest and lightest among these four groups (P<0.01; Figs. 7A and B and 8A). Furthermore, H&E staining demonstrated that, compared with the SM group (Fig. 8B), the tumor malignance was first decreased by SM (P<0.05), and then further inhibited by Fe3O4-SM (P<0.05). To further confirm the antitumor effect of Fe3O4-SM, the expression of Ki-67 was determined by IHC. The assay demonstrated that the expression of Ki-67 was suppressed by SM and Fe3O4-SM (P<0.01; Fig. 9A). In addition, the TUNEL assay demonstrated that SM significantly induced apoptosis, and Fe3O4-SM further enhanced the apop-tosis mediated by SM (P<0.01; Fig. 9B).

Figure 7

Effect of Fe3O4-SM on tumor volume. (A) Tumor volume was measured by magnetic resonance imaging. (B) The determination of tumor volume. *P<0.05, **P<0.01 vs. Mock group; ##P<0.01 vs. saline group; ^^P<0.01 vs. SM group.

Figure 8

Effect of Fe3O4-SM on tumor growth. (A) Preventative images for diameter of PC xenografts and the tumor weight of PC xenografts; (B) H&E staining for the malignant growth of xenografts tissues. Scale bar, 20 µm. PC, pancreatic cancer. *P<0.05 vs. saline group; #P<0.05 vs. SM group.

Figure 9

Effect of Fe3O4-SM on tumor apoptosis. (A) Immunohistochemical staining for the expression of Ki-67. (B) Terminal deoxynucleotidyl trans-ferase dUTP nick end labelling staining was performed to detect the apoptosis of xenografts tissues. **P<0.01 vs. Mock group; ##P<0.01 vs. Saline group; ^^P<0.01 vs. SM group. Scale bar, 20 µm.

Discussion

Although surgery, and/or radiotherapy and chemotherapy have been the standard methods used to treat PC (28), drug-loaded MLP has also attracted a great deal of attention (29). Furthermore, traditional Chinese medicines have been recognized as having a strong capability of modulating cell activities (30). SM, a main active component from solanum incanum, exerts antitumor effects in multiple tumor types (21,31,32). Therefore, the present study investigated the effect of SM on PC. It was revealed that SM inhibited tumor cell growth in a dose-dependent manner. Drug-loaded MLP delivered the agent directly to the targeted tissues and released the drug in a controlled manner, thereby reducing the drug dosage required and the number of toxic side effects. Therefore, Fe3O4-SM was prepared to aid in determining the effect produced by Fe3O4-SM on PC. It was demonstrated that Fe3O4-MLP alone did not inhibit tumor cell growth. However, although Fe3O4-SM increased the drug effectiveness of SM, it decreased the release rate of SM. This suggested that the growth inhibition effect of Fe3O4-SM was mediated by SM.

The 'suicidal' behavior of cells is mainly regulated by apoptosis, which is a research focus of oncology. Induction of apoptosis is considered as an action mechanism of the majority of antitumor regents (33). Therefore, cell apoptosis was examined following the cells were being treated with SM or Fe3O4-SM. FCM data demonstrated that SM caused tumor cell death by apoptosis, which was enhanced by Fe3O4-SM. Furthermore, disorder of cell cycle progression may cause tumor formation (34). As the number of dividing cells is larger in tumors than in normal tissues, it leads to the malignant proliferation of tumor cells. The cells in active division may be the targets of drugs in tumor therapy. The results of the present study revealed that SM induced G1 cell cycle arrest. Similarly, the Fe3O4-SM enhanced the effect of SM. Furthermore, numerous molecules, including XIAP (35), Survivin (36), Ki-67 (37), PCNA (38) and cyclin D1 (39), participate in tumor cell growth, apoptosis and cell cycle progression. The results of the present study revealed that the expression of these genes was regulated by SM and Fe3O4-SM. Activation of caspase-3 was the convergence of several apoptotic pathways. The activity of caspase-3 was higher in Fe3O4-SM-treated cells than in SM-treated cells, and this phenomenon confirmed the antitumor effect of SM. Taken together, the results of the present study demonstrated that SM exerted its antitumor effect by inducing apoptosis and cell cycle arrest, and that the effect of SM was enhanced by Fe3O4-SM.

Distant metastasis is a common characteristic of malignant tumors and is a major cause of refractory tumors (40). Data from scratch assay and Transwell assay demonstrated that cell migration and invasion were further depressed by Fe3O4-SM, compared with SM, indicating that Fe3O4-SM may have the potential to block metastasis in clinical practice. MMP-2 and MMP-9, which are two MMP family members, are associated with the metastatic potential of tumors. TIMP-2 is an inhibitor of MMP-2 (41), and the balance between MMPs and TIMP is crucial to tumor metastasis. The results of the present study demonstrated that the expression of MMP-2 was decreased by SM; the expression of TIMP-2 was increased by SM, The effect of SM was enhanced following loaded on Fe3O4. The expression of MMP-9 remained relatively stable in the present study. Previous studies have reported that high expression of MMP-2 contributed toward the promotion of tumor metastasis (42,43), suggesting that SM may mediate its antitumor effect by inhibiting tumor metastasis.

The association between Akt-mTOR tango and cancer has been previously reported (44). To illustrate the molecular mechanism of SM, the activity of the Akt/mTOR signaling pathway was determined in the present study. The results of the present study demonstrated that the expression of p-Akt and p-mTOR was decreased by the effect produced by SM. The effi-cacy of SM was increased by the encapsulation of Fe3O4-MLP. Consistently, Akt and mTOR phosphorylation have been identified in multiple tumor types (45-47). Therefore, the Akt/mTOR pathway may be considered as a target of cancer therapy (48).

Finally, the present study investigated the effect delivered by SM in vivo. MRI is a powerful non-invasive and in situ real time detection method for the diagnosis of cancer (49). The MRI image demonstrated that the tumor volume was decreased by the effect mediated by SM, compared with the mock and saline groups. The present study also demonstrated that Fe3O4-MLP was an effective MRI contrast agent. The data of tumor diameter was consistent with the MRI results. Furthermore, the malignant proliferation was inhibited by Fe3O4-SM more than by SM. Furthermore, Fe3O4-SM further depressed the staining for Ki-67, compared with SM. The proportion of apoptotic cells was increased in the Fe3O4-SM group, compared with the SM group. Therefore, these data confirmed the antitumor effect mediated by SM in vivo.

To the best of our knowledge, the present study was the first to demonstrate the protective effect of SM on pancreatic cancer (PC). The present study demonstrated that Fe3O4-SM enhanced the antitumor effect of SM. The action mechanism of SM was determined by inducing apoptosis and cell cycle arrest, and by suppressing tumor cell metastasis. Inhibition of the Akt/mTOR signal pathway was observed to promote the antitumor effect mediated by SM. In conclusion, the in vitro and in vivo results of the present study proved that SM produced an antitumor effect, and that Fe3O4-MLP may be an effective delivery agent in PC treatment. Therefore, the present study provided an alternative strategy for PC therapy.

Funding

The present study was supported by the Jiangsu Cancer Hospital College Project (Jiangsu, China; grant nos., ZN201611 and ZQ201502) and The Jiangsu Cancer Hospital Young Talents Plan (Jiangsu, China).

Availability of data and materials

The analyzed datasets generated during the present study are available from the corresponding author on reasonable request.

Authors' contributions

XX wrote the main manuscript. XX, XZ, JC, XT, MW, LZ and ZG performed the experiments. XX, XZ, JC and WS designed the study. XC, XZ, JC, XT, MW, LZ and WS performed data analysis. XC, XZ, JC and WS contributed to manuscript revisions. All authors reviewed the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

All the protocols in the animal studies were approved by the Ethics Committee of Jiangsu Cancer Hospital (Nanjing, Jiangsu, China).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Acknowledgments

Not applicable.

References

1 

Raimondi S, Lowenfels AB, Morselli-Labate AM, Maisonneuve P and Pezzilli R: Pancreatic cancer in chronic pancreatitis; aetiology, incidence, and early detection. Best Pract Res Clin Gastroenterol. 24:349–358. 2010. View Article : Google Scholar : PubMed/NCBI

2 

No authors listed. The World Cancer Report - the major findings. Cent Eur J Public Health. 11:177–179. 2003.

3 

GBD 2016 Causes of Death Collaborators: Global, regional, and national age-sex specific mortality for 264 causes of death, 1980–2016: A systematic analysis for the Global Burden of Disease Study 2016. Lancet. 390:1151–1210. 2017. View Article : Google Scholar

4 

Kleeff J, Michalski C, Friess H and Büchler MW: Pancreatic cancer: From bench to 5-year survival. Pancreas. 33:111–118. 2006. View Article : Google Scholar : PubMed/NCBI

5 

Schiff E and Ben-Arye E: Complementary therapies for side effects of chemotherapy and radiotherapy in the upper gastrointestinal system. Eur J Integr Med. 3:11–16. 2011. View Article : Google Scholar

6 

Gupta AK and Gupta M: Synthesis and surface engineering of iron oxide nanoparticles for biomedical applications. Biomaterials. 26:3995–4021. 2005. View Article : Google Scholar : PubMed/NCBI

7 

Gan ZJJ: Preparation of magnetic monodisperse nanoparticles and biopolymer assembly on the magnetic carriers. Huaxue Jinzhan. 17:978–986. 2005.

8 

Gallo JM, Hafeli U, Lübbe AS, et al: Preclinical experiences with magnetic drug targeting: tolerance and efficacy. Cancer Res. 56:4694–4701. 1996.

Clinical experiences with magnetic drug targeting: a phase I study with 4′-epidoxorubicin in 14 patients with advanced solid tumors. Cancer Res. 56:4686–4693. 1996.

Cancer Res. 57:3063–3065. 1997.

9 

Lübbe AS, Bergemann C, Riess H, Schriever F, Reichardt P, Possinger K, Matthias M, Dörken B, Herrmann F, Gürtler R, et al: Clinical experiences with magnetic drug targeting: A phase I study with 4′-epidoxorubicin in 14 patients with advanced solid tumors. Cancer Res. 56:4686–4693. 1996.

10 

Sabaté R, Barnadas-Rodríguez R, Callejas-Fernández J, Hidalgo-Alvarez R and Estelrich J: Preparation and characterization of extruded magnetoliposomes. Int J Pharm. 347:156–162. 2008. View Article : Google Scholar

11 

Fricker J: Drugs with a magnetic attraction to tumours. Drug Discov Today. 6:387–389. 2001. View Article : Google Scholar : PubMed/NCBI

12 

Kohler N, Sun C, Wang J and Zhang M: Methotrexate-modified superparamagnetic nanoparticles and their intracellular uptake into human cancer cells. Langmuir. 21:8858–8864. 2005. View Article : Google Scholar : PubMed/NCBI

13 

Cinteza LO, Ohulchanskyy TY, Sahoo Y, Bergey EJ, Pandey RK and Prasad PN: Diacyllipid micelle-based nanocarrier for magnetically guided delivery of drugs in photodynamic therapy. Mol Pharm. 3:415–423. 2006. View Article : Google Scholar : PubMed/NCBI

14 

Novikov VV, Ponomarev VO, Novikov GV, Kuvichkin VV, Iablokova EV and Fesenko EE: Effects and molecular mechanisms of the biological action of weak and extremely weak magnetic fields. Biofizika. 55:565–572. 2010.

15 

Sato K, Watanabe Y, Horiuchi A, Yukumi S, Doi T, Yoshida M, Yamamoto Y, Maehara T, Naohara T and Kawachi K: Novel tumor-ablation device for liver tumors utilizing heat energy generated under an alternating magnetic field. J Gastroenterol Hepatol. 23:1105–1111. 2008. View Article : Google Scholar : PubMed/NCBI

16 

Chertok B, David AE and Yang VC: Brain tumor targeting of magnetic nanoparticles for potential drug delivery: effect of administration route and magnetic field topography. J Control Release. 155:393–399. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Lu ZR, Ye F and Vaidya A: Polymer platforms for drug delivery and biomedical imaging. J Control Release. 122:269–277. 2007. View Article : Google Scholar : PubMed/NCBI

18 

Gan KH, Lin CN and Won SJ: Cytotoxic principles and their derivatives of Formosan Solanum plants. J Nat Prod. 56:15–21. 1993. View Article : Google Scholar : PubMed/NCBI

19 

Alzérreca A and Hart G: Molluscicidal steroid glycoalkaloids possessing stereoisomeric spirosolane structures. Toxicol Lett. 12:151–155. 1982. View Article : Google Scholar : PubMed/NCBI

20 

Xie X, Zhu H, Yang H, Huang W, Wu Y, Wang Y, Luo Y, Wang D and Shao G: Solamargine triggers hepatoma cell death through apoptosis. Oncol Lett. 10:168–174. 2015. View Article : Google Scholar : PubMed/NCBI

21 

Kuo KW, Hsu SH, Li YP, Lin WL, Liu LF, Chang LC, Lin CC, Lin CN and Sheu HM: Anticancer activity evaluation of the solanum glycoalkaloid solamargine. Triggering apoptosis in human hepatoma cells. Biochem Pharmacol. 60:1865–1873. 2000. View Article : Google Scholar : PubMed/NCBI

22 

Liang CH, Shiu LY, Chang LC, Sheu HM and Kuo KW: Solamargine upregulation of Fas, downregulation of HER2, and enhancement of cytotoxicity using epirubicin in NSCLC cells. Mol Nutr Food Res. 51:999–1005. 2007. View Article : Google Scholar : PubMed/NCBI

23 

Yang X, Zhang X, Ma Y, Huang Y, Wang Y and Chen Y: Superparamagnetic graphene oxide-Fe3O4 nanoparticles hybrid for controlled targeted drug carriers. J Mater Chem. 19:2710–2714. 2009. View Article : Google Scholar

24 

Liang C-C, Park AY and Guan J-L: In vitro scratch assay: A convenient and inexpensive method for analysis of cell migration in vitro. Nat Protoc. 2:329–333. 2007. View Article : Google Scholar : PubMed/NCBI

25 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar

26 

van Rij CM, Frielink C, Goldenberg DM, Sharkey RM, Lütje S, McBride WJ, Oyen WJ and Boerman OC: Pretargeted radioim-munotherapy of prostate cancer with an anti-TROP-2xanti-HSG bispecific antibody and a (177)Lu-labeled peptide. Cancer Biother Radiopharm. 29:323–329. 2014. View Article : Google Scholar : PubMed/NCBI

27 

Liao MY, Kuo MY, Lu TY, Wang YP and Wu HC: Generation of an anti-EpCAM antibody and epigenetic regulation of EpCAM in colorectal cancer. Int J Oncol. 46:1788–1800. 2015. View Article : Google Scholar : PubMed/NCBI

28 

Wanebo HJ, Glicksman AS, Vezeridis MP, Clark J, Tibbetts L, Koness RJ and Levy A: Preoperative chemotherapy, radiotherapy, and surgical resection of locally advanced pancreatic cancer. Arch Surg. 135:81–87; discussion 88. 2000. View Article : Google Scholar : PubMed/NCBI

29 

Kalra AV and Campbell RB: Development of 5-FU and doxorubicin-loaded cationic liposomes against human pancreatic cancer: Implications for tumor vascular targeting. Pharm Res. 23:2809–2817. 2006. View Article : Google Scholar : PubMed/NCBI

30 

Zhang L, Chang CJ, Bacus SS and Hung M-C: Suppressed transformation and induced differentiation of HER-2/neu-overexpressing breast cancer cells by emodin. Cancer Res. 55:3890–3896. 1995.PubMed/NCBI

31 

Shiu LY, Chang LC, Liang CH, Huang YS, Sheu HM and Kuo KW: Solamargine induces apoptosis and sensitizes breast cancer cells to cisplatin. Food Chem Toxicol. 45:2155–2164. 2007. View Article : Google Scholar : PubMed/NCBI

32 

Liu LF, Liang CH, Shiu LY, Lin WL, Lin CC and Kuo KW: Action of solamargine on human lung cancer cells - enhancement of the susceptibility of cancer cells to TNFs. FEBS Lett. 577:67–74. 2004. View Article : Google Scholar : PubMed/NCBI

33 

Fisher DE: Apoptosis in cancer therapy: Crossing the threshold. Cell. 78:539–542. 1994. View Article : Google Scholar : PubMed/NCBI

34 

Ho A and Dowdy SF: Regulation of G1 cell-cycle progression by oncogenes and tumor suppressor genes. Curr Opin Genet Dev. 12:47–52. 2002. View Article : Google Scholar : PubMed/NCBI

35 

Schimmer AD, Welsh K, Pinilla C, Wang Z, Krajewska M, Bonneau MJ, Pedersen IM, Kitada S, Scott FL, Bailly-Maitre B, et al: Small-molecule antagonists of apoptosis suppressor XIAP exhibit broad antitumor activity. Cancer Cell. 5:25–35. 2004. View Article : Google Scholar : PubMed/NCBI

36 

Li F, Ambrosini G, Chu EY, Plescia J, Tognin S, Marchisio PC and Altieri DC: Control of apoptosis and mitotic spindle checkpoint by survivin. Nature. 396:580–584. 1998. View Article : Google Scholar : PubMed/NCBI

37 

Coates PJ, Hales SA and Hall PA: The association between cell proliferation and apoptosis: Studies using the cell cycle-associated proteins Ki67 and DNA polymerase alpha. J Pathol. 178:71–77. 1996. View Article : Google Scholar : PubMed/NCBI

38 

Ouhtit A, Gaur RL, Abdraboh M, Ireland SK, Rao PN, Raj SG, Al-Riyami H, Shanmuganathan S, Gupta I, Murthy SN, et al: Simultaneous inhibition of cell-cycle, proliferation, survival, metastatic pathways and induction of apoptosis in breast cancer cells by a phytochemical super-cocktail: Genes that underpin its mode of action. J Cancer. 4:703–715. 2013. View Article : Google Scholar : PubMed/NCBI

39 

Shirali S, Aghaei M, Shabani M, Fathi M, Sohrabi M and Moeinifard M: Adenosine induces cell cycle arrest and apoptosis via cyclinD1/Cdk4 and Bcl-2/Bax pathways in human ovarian cancer cell line OVCAR-3. Tumour Biol. 34:1085–1095. 2013. View Article : Google Scholar : PubMed/NCBI

40 

Pàez-Ribes M, Allen E, Hudock J, Takeda T, Okuyama H, Viñals F, Inoue M, Bergers G, Hanahan D and Casanovas O: Antiangiogenic therapy elicits malignant progression of tumors to increased local invasion and distant metastasis. Cancer Cell. 15:220–231. 2009. View Article : Google Scholar : PubMed/NCBI

41 

Fang W, Li H, Kong L, Niu G, Gao Q, Zhou K, Zheng J and Wu B: Role of matrix metalloproteinases (MMPs) in tumor invasion and metastasis: Serial studies on MMPs and TIMPs. Beijing Da Xue Xue Bao Yi Xue Ban. 35:441–443. 2003.In Chinese. PubMed/NCBI

42 

Chetty C, Bhoopathi P, Joseph P, Chittivelu S, Rao JS and Lakka S: Adenovirus-mediated small interfering RNA against matrix metalloproteinase-2 suppresses tumor growth and lung metastasis in mice. Mol Cancer Ther. 5:2289–2299. 2006. View Article : Google Scholar : PubMed/NCBI

43 

Luca M, Huang S, Gershenwald JE, Singh RK, Reich R and Bar-Eli M: Expression of interleukin-8 by human melanoma cells up-regulates MMP-2 activity and increases tumor growth and metastasis. Am J Pathol. 151:1105–1113. 1997.PubMed/NCBI

44 

Hay N: The Akt-mTOR tango and its relevance to cancer. Cancer Cell. 8:179–183. 2005. View Article : Google Scholar : PubMed/NCBI

45 

Altomare DA, Wang HQ, Skele KL, De Rienzo A, Klein-Szanto AJ, Godwin AK and Testa JR: AKT and mTOR phosphorylation is frequently detected in ovarian cancer and can be targeted to disrupt ovarian tumor cell growth. Oncogene. 23:5853–5857. 2004. View Article : Google Scholar : PubMed/NCBI

46 

Uesugi A, Kozaki K, Tsuruta T, Furuta M, Morita K, Imoto I, Omura K and Inazawa J: The tumor suppressive microRNA miR-218 targets the mTOR component Rictor and inhibits AKT phosphorylation in oral cancer. Cancer Res. 71:5765–5778. 2011. View Article : Google Scholar : PubMed/NCBI

47 

Kitano H, Chung JY, Ylaya K, Conway C, Takikita M, Fukuoka J, Doki Y, Hanaoka J and Hewitt SM: Profiling of phospho-AKT, phospho-mTOR, phospho-MAPK and EGFR in non-small cell lung cancer. J Histochem Cytochem. 62:335–346. 2014. View Article : Google Scholar : PubMed/NCBI

48 

Morgensztern D and McLeod HL: PI3K/Akt/mTOR pathway as a target for cancer therapy. Anticancer Drugs. 16:797–803. 2005. View Article : Google Scholar : PubMed/NCBI

49 

Takahashi M and Kohda H: Diagnostic utility of magnetic resonance imaging in malignant melanoma. J Am Acad Dermatol. 27:51–54. 1992. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Xie X, Zhang X, Chen J, Tang X, Wang M, Zhang L, Guo Z and Shen W: Fe3O4-solamargine induces apoptosis and inhibits metastasis of pancreatic cancer cells Retraction in /10.3892/ijo.2024.5657. Int J Oncol 54: 905-915, 2019.
APA
Xie, X., Zhang, X., Chen, J., Tang, X., Wang, M., Zhang, L. ... Shen, W. (2019). Fe3O4-solamargine induces apoptosis and inhibits metastasis of pancreatic cancer cells Retraction in /10.3892/ijo.2024.5657. International Journal of Oncology, 54, 905-915. https://doi.org/10.3892/ijo.2018.4637
MLA
Xie, X., Zhang, X., Chen, J., Tang, X., Wang, M., Zhang, L., Guo, Z., Shen, W."Fe3O4-solamargine induces apoptosis and inhibits metastasis of pancreatic cancer cells Retraction in /10.3892/ijo.2024.5657". International Journal of Oncology 54.3 (2019): 905-915.
Chicago
Xie, X., Zhang, X., Chen, J., Tang, X., Wang, M., Zhang, L., Guo, Z., Shen, W."Fe3O4-solamargine induces apoptosis and inhibits metastasis of pancreatic cancer cells Retraction in /10.3892/ijo.2024.5657". International Journal of Oncology 54, no. 3 (2019): 905-915. https://doi.org/10.3892/ijo.2018.4637
Copy and paste a formatted citation
x
Spandidos Publications style
Xie X, Zhang X, Chen J, Tang X, Wang M, Zhang L, Guo Z and Shen W: Fe3O4-solamargine induces apoptosis and inhibits metastasis of pancreatic cancer cells Retraction in /10.3892/ijo.2024.5657. Int J Oncol 54: 905-915, 2019.
APA
Xie, X., Zhang, X., Chen, J., Tang, X., Wang, M., Zhang, L. ... Shen, W. (2019). Fe3O4-solamargine induces apoptosis and inhibits metastasis of pancreatic cancer cells Retraction in /10.3892/ijo.2024.5657. International Journal of Oncology, 54, 905-915. https://doi.org/10.3892/ijo.2018.4637
MLA
Xie, X., Zhang, X., Chen, J., Tang, X., Wang, M., Zhang, L., Guo, Z., Shen, W."Fe3O4-solamargine induces apoptosis and inhibits metastasis of pancreatic cancer cells Retraction in /10.3892/ijo.2024.5657". International Journal of Oncology 54.3 (2019): 905-915.
Chicago
Xie, X., Zhang, X., Chen, J., Tang, X., Wang, M., Zhang, L., Guo, Z., Shen, W."Fe3O4-solamargine induces apoptosis and inhibits metastasis of pancreatic cancer cells Retraction in /10.3892/ijo.2024.5657". International Journal of Oncology 54, no. 3 (2019): 905-915. https://doi.org/10.3892/ijo.2018.4637
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team