Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular and Clinical Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9450 Online ISSN: 2049-9469
Journal Cover
February-2016 Volume 4 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2016 Volume 4 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Identification of DLC‑1 expression and methylation status in patients with non‑small‑cell lung cancer

  • Authors:
    • Hongxiang Feng
    • Zhenrong Zhang
    • Xiaowei Wang
    • Deruo Liu
  • View Affiliations / Copyright

    Affiliations: Department of Thoracic Surgery, China‑Japan Friendship Hospital, Beijing 100029, P.R. China
  • Pages: 249-254
    |
    Published online on: November 20, 2015
       https://doi.org/10.3892/mco.2015.681
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

In order to determine whether the deleted in liver cancer‑1 (DLC‑1) gene is deregulated in non‑small‑cell lung carcinoma (NSCLC) and to assess the contribution of molecular alterations in DLC‑1 to lung carcinogenesis, a total of 84 tissue specimens (30 NSCLC and 30 corresponding adjacent normal tissues; 5 benign tumor and 5 corresponding adjacent normal tissues; and 10 pulmonary bullae and 4 corresponding adjacent normal tissues), were obtained from 45 patients who underwent curative surgical resection. DLC‑1 mRNA expression was evaluated by reverse transcription‑quantitative polymerase chain reaction (PCR) and its protein level was assessed by western blot analysis. A significant downregulation of DCL‑1 at the mRNA and protein levels was observed in NSCLC tissues when compared to benign lung tumors and normal lung tissues (P<0.001). To further determine whether the decreased expression of DLC‑1 at the mRNA and protein levels is associated with the methylation of its promoter, methylation‑specific PCR was performed following extraction of genomic DNA from the samples. DLC‑1 promoter methylation was identified in 7 of the 30 (23.3%) NSCLC tissue samples, but not in the corresponding adjacent normal tissues from NSCLC patients or in lung tissues from non‑NSCLC patients. Our data indicated that DLC‑1 hypermethylation may play a crucial role in lung carcinogenesis and may be a target for the treatment of NSCLC.

Introduction

Lung cancer, with ~80% of the cases comprising non-small-cell lung carcinomas (NSCLCs), is one of the most common types of human cancer worldwide and the most common cause of cancer-related mortality in China (1). Since only 15–20% of the patients survive to 5-years (2), lung cancer cure rates are currently disappointing.

Tumorigenesis is a complex, multistage process, involving numerous epigenetic modifications and genetic alterations. It is essential to characterize the molecular mechanisms underlying tumor formation and progression in order to develop rational approaches to cancer diagnosis and therapy. The inactivation of the tumor suppressor gene deleted in liver cancer-1 (DLC-1), which is induced by promoter methylation, was recently suggested to play a central role in tumorigenesis in several cancer models, including diffuse large B-cell lymphoma (3), gallbladder carcinoma (4), gastric cancer (5), hepatocellular carcinoma (6), breast cancer (7) and multiple myeloma (8). Accumulating evidence indicates that DLC-1 inactivation induced by methylation may also be involved in lung carcinogenesis. It was demonstrated that DLC-1 transcription was significantly reduced or lost in primary tumors and NSCLC cell lines (9), while frequent heterozygous deletion (10) and DNA methylation of DLC-1 (11) was observed in lung cancer.

In this study, we investigated the possible involvement of DLC-1 in NSCLC and analyzed the correlation between aberrant DLC-1 methylation and clinicopathological parameters in Chinese NSCLC patients, with the aim to elucidate the molecular mechanism underlying the development of NSCLC.

Materials and methods

Subjects

A total of 84 tissue specimens were obtained from patients who underwent curative resection at the Department of Thoracic Surgery, China-Japan Friendship Hospital (Beijing, China) between November, 2008 and November, 2009. None of the patients had received radiotherapy or chemotherapy prior to surgery. Tissue specimens were obtained from NSCLC patients (n=30; mean age, 63 years; range, 49–74 years) and from patients with benign lung tumors (n=5; mean age, 56 years; range, 30–61 years) who underwent surgical resection. Normal adjacent lung tissue was available in all the cases. Specimens from patients with pulmonary bullae (n=10; mean age, 28 years; range, 17–63 years) and corresponding normal lung tissue samples (n=4) were also collected. All the normal, benign and malignant tissue samples were immediately snap-frozen and stored at −80°C for analysis. The clinical and histopathological characteristics of all the samples are listed in Table I. To confirm the diagnosis and determine the cellular composition of the tumor, all the samples were carefully reviewed at the Department of Pathology of our hospital. The pathological stage was determined according to the Revised International System for Staging Lung Cancer (12).

Table I.

Characteristics of the investigated patients.

Table I.

Characteristics of the investigated patients.

CharacteristicsNSCLC (n=30)Benign tumors (n=5)Bullae (n=10)
Gender
  Male2137
  Female  92  3
Age (years)
  <60112  1
  ≥60193  9
Histological type
  Adenocarcinoma18
  SCC11
  Others  1
Differentiation
  High/moderate15
  Poor/undifferentiated15
Stage
  I10
  II10
  III10
Smoking index
  <40012210
  ≥400183  0

[i] NSCLC, non-small-cell lung carcinoma; SCC, squamous cell carcinoma.

The present study was approved by the Institutional Review Board of the China-Japan Friendship Hospital and written informed consent was provided by all the participants.

Evaluation of DLC-1 mRNA using quantitative PCR (qPCR)

DLC-1 mRNA expression was evaluated by reverse transcription (RT)-qPCR. Briefly, total RNA was extracted using the Dr. P kit (BioChain, Newark, CA, USA) according to the manufacturer's instructions. Total RNA (2 µg) was reverse transcribed with the oligo (dT) primer (Invitrogen, Carlsbad, CA, USA) using Moloney Murine Leukemia Virus Reverse Transcriptase (Promega, Madison, WI, USA) in a total reaction volume of 20 µl. Following the RT reaction, sequence-specific PCR primers (Table II) for DLC-1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (both from Invitrogen, Carlsbad, CA, USA) were used for qPCR. DLC-1 was amplified on the same plate under the control of GAPDH, using the Eva QPCR SuperMix kit (BioChain). The data were analyzed with the 2−ΔΔCt method (13) using GADPH as a reference gene. The results are presented as fold-change relative to the GADPH control. A two-fold increased or decreased expression was considered as significant.

Table II.

Primer sequences for DLC-1 and GAPDH in MSP using USP.

Table II.

Primer sequences for DLC-1 and GAPDH in MSP using USP.

PrimersSequence, 5′-3′PCR product size (bp)
qDLC-1FCCG CCT GAG CAT CTA CG138
qDLC-1RACT ATC CGC TGC ATC CC
GAPDH-F GAAGGTGAAGGTCGGAGTCA226
GAPDH-R GAAGATGGTGATGGGATTTC
MSP-F TTTAAAGATCGAAACGAGGGAGCG172
MSP-R CCCAACGAAAAAACCCGACTAACG

[i] DLC-1, deleted in liver cancer 1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; PCR, polymerase chain reaction; MSP, methylation-specific PCR; USP, universal sample processing; F, forward; R, reverse.

Western blot analysis

Protein expression was evaluated by western blotting. Briefly, total protein was extracted using the Dr. P kit according to the manufacturer's instructions. The total protein concentration was determined by the BCA Protein Assay kit (Vigorous Instruments, Beijing, China). Equal amounts of total proteins were resolved by SDS-PAGE and subjected to western blotting. The primary antibody was goat polyclonal anti-DLC-1 antibody (dilution 1:800; cat. no. TA302467; OriGene, Rockville, MD, USA). The proteins were transferred from the gels to polyvinylidene difluoride membranes (Millipore, Billerica, MA, USA). The membranes were blocked using the Attoglow Western Blot Analysis kit, followed by anti-goat secondary antibody (dilution 1:8,000; cat. no. K3171120; BioChain). The films were scanned and the protein band signal intensity was measured with Adobe Photoshop CS2 (Adobe, San Jose, CA, USA). The relative expression difference of the DLC-1 protein in all the lung tissue samples was calculated compared with the average expression in the normal samples. A two-fold increase or decrease was considered to be a significant expression difference.

Detection of DLC-1 methylation using methylation-specific PCR

Genomic DNA (500 ng) extracted from tissue samples was modified by sodium bisulfite with the DNA Methylation Detection kit (BioChain) according to the manufacturer's instructions. Modified DNA (7 µl) was used for PCR in a total reaction volume of 25 µl as follows: 35 cycles of melting (30 sec at 95°C), annealing (30 sec at 55°C) and extension (30 sec at 72°C). The 25-µl reaction mixture contained 1X PCR Buffer (Mg2+ Plus; Promega), 200 µM of each dNTP, 0.5 µM forward and 0.5 µM reverse primers (the primer sequences are provided in Table II) and 0.5 U GoTaq® Hot Start Polymerase (Promega). The PCR products were separated in 3% agarose gel supplemented with ethidium bromide. DNA was visualized under ultraviolet illumination.

Statistical analysis

The statistical analysis was performed with Fisher's exact test and Student's t-test. P<0.05 was considered to indicate a statistically significant difference.

Results

Expression of DLC-1 at the mRNA and protein level

The DLC-1 expression was significantly reduced in NSCLC compared to that in benign lung tumors and normal lung tissue (both P<0.001; Fig. 1). The DCL-1 mRNA level in the 30 investigated NSCLCs was decreased or undetectable (100%); among these, 26 (86.7%) exhibited less than half of the DCL-1 mRNA levels observed in normal lung tissues. There was no significant difference in DLC-1 expression between normal lung tissues and benign lung tumors (P=0.603). Compared to the unmethylated NSCLC specimens, the DLC-1 expression level in the methylated specimens was significantly reduced (P=0.001 and P<0.05, respectively).

Figure 1.

DLC-1 mRNA expression was evaluated by reverse transcription-quantitative polymerase chain reaction. DLC-1, deleted in liver cancer-1; NSCLC, non-small-cell lung carcinoma.

In order to validate the observed reduction of DLC-1 mRNA in NSCLC patients, the protein expression level was evaluated by western blotting. Loss or low expression of the DLC-1 protein was detected in 19 of the 30 (63%) NSCLCs and in 1 of the 5 (20%) benign lung tumor samples (Fig. 2). This result was in accordance with that observed in the DLC-1 mRNA.

Figure 2.

The expression of the DLC-1 protein in lung tissue was evaluated by western blotting. T, cancer tissue in NSCLC; N, corresponding adjacent normal lung tissue in NSCLC. DLC-1, deleted in liver cancer-1; NSCLC, non-small-cell lung carcinoma. GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

DLC-1 methylation detection using methylation-specific PCR (MSP)

To investigate the mechanism underlying the loss of DLC-1 expression at the mRNA and protein levels, the methylation status of the 5′CpG island in the DLC-1 gene was determined using MSP (Fig. 3). DLC-1 promoter methylation was significantly higher in NSCLCs (P=0.011), observed in 23.3% (7/30) of the NSCLC samples, but was not detected in any of the corresponding adjacent normal tissue, benign tumor, or pulmonary bullae samples. By further analyzing the protein expression data in cancer tissues with methylation of DLC-1 DNA, reduced or loss of expression of the DLC-1 protein was observed in 4 of the 7 (57.1%) tumor tissue samples with methylated DLC-1, indicating that the methylation status of the 5′CpG island in the DLC-1 gene may be associated with decreased DLC-1 protein expression in NSCLCs.

Figure 3.

DLC-1 methylation was detected by methylation-specific polymerase chain reaction. T, cancer tissue in NSCLC; N, corresponding adjacent normal lung tissue in NSCLC. DLC-1, deleted in liver cancer-1; NSCLC, non-small-cell lung carcinoma.

DLC-1 methylation and clinicopathological characteristics

The association between the methylation of DLC-1 and clinicopathological characteristics was analyzed in NSCLC patients (Table III). There were no significant correlations of DLC-1 methylation with gender, age, tumor site, differentiation, TNM stage or histological type. However, we observed a tendency for the DLC-1 methylation level in squamous cell carcinomas (5/11) to be higher compared to that observed in adenocarcinomas (2/18) (Chi-square test, likelihood ratio, 0.087). DLC-1 methylation in men also exhibited a tendency for higher incidence compared to that observed in women. The preferential methylation of DLC-1 in male patients and in squamous cell carcinomas prompted us to investigate the association between smoking and DLC-1 methylation in NSCLC. We observed that the incidence of DLC-1 methylation in heavy smoking NSCLC patients [with a smoking index (number of cigarettes smoked per day × years of smoking) of >400] was significantly higher compared to that observed in light smoking (with smoking index <400) and non-smoking patients (Fisher's exact test, P=0.024).

Table III.

Correlation of DLC-1 methylation and mRNA and protein expression with clinical and histological variables in NSCLC patients.

Table III.

Correlation of DLC-1 methylation and mRNA and protein expression with clinical and histological variables in NSCLC patients.

Methylation mRNA Protein



CharacteristicsPresentAbsentP-value(mean ± SE)P-valueNormalReducedP-value
Age (years) 1 0.502 1
  <60  92 24.6±7.3   4  7
  ≥60145 19.0±4.7   712
Smoking index 0.024 0.042 0.442
  <400120 30.7±6.7   3  9
  ≥400117 14.6±4.3   810
Histological type 0.071 0.399 0.432
Adenocarcinoma  65 16.5±6.5   5  6
  SCC162 23.8±5.3   513
TNM stage 0.657 0.592 0.425
  I/II164 19.5±4.5   614
  III  73 24.1±7.8   5  5
Differentiation 1 0.883 1
  High/moderate  30 19.2±7.4   1  2
  Poor/undifferentiated207 21.2±4.3 1017

[i] DLC-1, deleted in liver cancer-1; NSCLC, non-small-cell lung carcinoma; SCC, squamous cell carcinoma; SE, standard error; TNM, tumor node metastastis.

Discussion

In the present study, DLC-1 expression at the mRNA level was evaluated by RT-qPCR and at the protein level by western blotting. Significant downregulation of DCL-1 at the mRNA as well as the protein level was observed in NSCLC tissues when compared to benign lung tumors and normal lung tissues (P<0.001). To further investigate whether the reduced expression of DLC-1 at the mRNA and protein levels is associated with the methylation on its promoter, methylation-specific PCR was performed following extraction of genomic DNA from the samples. DLC-1 promoter methylation was identified in 7 of the 30 (23.3%) tumor tissue samples, but not in corresponding adjacent normal tissue samples from NSCLC patients or in lung tissues from non-NSCLC patients. Our data are consistent with those of previous studies (9,11,14). The level of expression of DLC-1 in methylated specimens was significantly reduced compared to that in unmethylated NSCLC samples. The majority of the methylated tumors exhibited a reduction or a loss of expression of the DLC-1 protein. Promoter methylation has been hypothesized to be one of the key mechanisms responsible for the inactivation of the DLC-1 gene in NSCLCs (15). Our data further support this hypothesis.

DLC-1 methylation was observed in 4 of 20 (20%) stage I–II tumors and the percentage of methylation did not increase significantly in more advanced-stage tumors, suggesting that DLC-1 methylation may occur at a relatively early stage during the multistep process of lung carcinogenesis. However, the pathobiological significance of DLC-1 methylation in multistage carcinogenesis may differ between squamous cell carcinomas and adenocarcinomas. DLC-1 methylation appears to be a relatively early event in adenocarcinomas, since its incidence was 14% in stage I tumors but did not significantly change in more advanced-stage tumors. By contrast, DLC-1 methylation appears to be a late event in squamous cell carcinomas, since its incidence increased significantly as tumor stage advanced from I to III (Chi-square test, P=0.015 and P<0.05). By contrast, methylation of the differentially expressed in adenocarcinoma of the lung-1 gene was reported to be an early event in squamous cell carcinomas but a late event in adenocarcinomas (16). The finding that 27.3% (3/11) of NSCLCs exhibited methylation with normal expression of the DLC-1 protein suggests that DLC-1 methylation is an early event during lung cancer development. In addition, the expression of DLC-1 was significantly reduced in NSCLC and was marginally lower in benign lung tumors. Therefore, methylation of DLC-1 appears to be a useful biomarker for the early diagnosis of NSCLC.

Tobacco smoking is the main etiologic factor associated with lung carcinoma and an estimated 86% of lung carcinoma deaths are attributed to smoking (17). Although there is no direct evidence that smoking induces DNA hypermethylation, it was recently demonstrated that there is an association of DNA methylation with exposure to the carcinogens in tobacco.

In human NSCLCs, it has been demonstrated that the hypermethylation of the p16/cyclin-dependent kinase inhibitor 2A (18,19), Ras association domain family 1 isoform A (20) and tumor suppressor in lung cancer 1/immunoglobulin superfamily member 4 genes (21) was significantly associated with tobacco smoking, indicating that the carcinogens in tobacco smoke induce DNA hypermethylation. Similar to other published reports, our data demonstrated that aberrant methylation of DLC-1 is associated with exposure to smoke and correlated to long-term smoking habit (20,22). Although only few adenocarcinoma patients were smokers, the two methylated adenocarcinoma patients were heavy smokers. There were no significant differences between former smokers (had quit smoking >12 months prior to tumor development) and current smokers (smoked within the 12 months preceding tumor development), although a trend towards a higher methylation frequency among smokers was noted. The incidence of DLC-1 methylation in tumors was significantly higher among heavy smokers. In particular, methylation was detected in the 3 former smokers, whereas methylation rates did not differ between current and former smokers (4/10 vs. 3/9, respectively). These data indicate that aberrant methylation is not only correlated to current smoke exposure, but continues for a long period of time following smoking cessation. Smoking cessation reduces the subsequent risk of lung cancer and quitting smoking before middle age eliminates >90% of the risk attributable to tobacco (23).

The mechanism through which the carcinogens in cigarette smoke cause DLC-1 methylation in NSCLC remains unclear. Smoking exposure may induce significant and sustained lung inflammation (24), which was found to be significantly associated with aberrant DNA methylation (25). Inflammation may increase CpG island methylation. Furthermore, smoking increases the activity of DNA methyltransferase (26), which drives the de novo hypermethylation of susceptible loci (27). These direct or indirect mechanisms may be involved in the enhanced DNA methylation observed in the NSCLC of heavy smokers.

In conclusion, DLC-1 promoter methylation was detected in 7 of 30 (23.3%) primary NSCLCs. Furthermore, our results indicated that DLC-1 promoter hypermethylation is a potential molecular marker for the early detection of lung cancer. This methylation is associated with heavy tobacco smoking and may play a role in lung carcinogenesis. The promoter of the DLC-1 gene is likely one of the important targets of methylation by smoking during the development or progression of NSCLCs. Our results also indicated that epigenetic silencing of DLC-1 in Chinese NSCLC patients may be used as a biomarker for NSCLC diagnosis and a therapeutic option.

Acknowledgements

The authors would like to thank the Department of Pathology of China-Japan Friendship Hospital for specimen collection and BioChain Science-Technology Inc., for assisting with the experiments.

Glossary

Abbreviations

Abbreviations:

NSCLCs

non-small-cell lung carcinomas

DLC-1

deleted in liver cancer-1

MSP

methylation-specific polymerase chain reaction

References

1 

Song F, He M, Li H, Qian B, Wei Q, Zhang W, Chen K and Hao X: A cancer incidence survey in Tianjin: the third largest city in China-between 1981 and 2000. Cancer Causes Control. 19:443–450. 2008. View Article : Google Scholar : PubMed/NCBI

2 

Jemal A, Siegel R, Ward E, Hao Y, Xu J and Thun MJ: Cancer statistics, 2009. CA Cancer J Clin. 59:225–249. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Pike BL, Greiner TC, Wang X, Weisenburger DD, Hsu YH, Renaud G, Wolfsberg TG, Kim M, Weisenberger DJ, Siegmund KD, Ye W, Groshen S, Mehrian-Shai R, Delabie J, Chan WC, Laird PW and Hacia JG: DNA methylation profiles in diffuse large B-cell lymphoma and their relationship to gene expression status. Leukemia. 22:1035–1043. 2008. View Article : Google Scholar : PubMed/NCBI

4 

García P, Manterola C, Araya JC, Villaseca M, Guzman P, Sanhueza A, Thomas M, Alvarez H and Roa JC: Promoter methylation profile in preneoplastic and neoplastic gallbladder lesions. Mol Carcinog. 48:79–89. 2009. View Article : Google Scholar : PubMed/NCBI

5 

Kim TY, Jong HS, Song SH, Dimtchev A, Jeong SJ, Lee JW, Kim TY, Kim NK, Jung M and Bang YJ: Transcriptional silencing of the DLC-1 tumor suppressor gene by epigenetic mechanism in gastric cancer cells. Oncogene. 22:3943–3951. 2003. View Article : Google Scholar : PubMed/NCBI

6 

Wong CM, Lee JM, Ching YP, Jin DY and Ng IO: Genetic and epigenetic alterations of DLC-1 gene in hepatocellular carcinoma. Cancer Res. 63:7646–7651. 2003.PubMed/NCBI

7 

Teramoto A, Tsukuda K, Yano M, Toyooka S, Dote H, Doihara H and Shimizu N: Less frequent promoter hypermethylation of DLC-1 gene in primary breast cancers. Oncol Rep. 12:141–144. 2004.PubMed/NCBI

8 

Song YF, Xu R, Zhang XH, Chen BB, Chen Q, Chen YM and Xie Y: High-frequency promoter hypermethylation of the deleted in liver cancer-1 gene in multiple myeloma. J Clin Pathol. 59:947–951. 2006. View Article : Google Scholar : PubMed/NCBI

9 

Yuan BZ, Jefferson AM, Baldwin KT, Thorgeirsson SS, Popescu NC and Reynolds SH: DLC-1 operates as a tumor suppressor gene in human non-small cell lung carcinomas. Oncogene. 23:1405–1411. 2004. View Article : Google Scholar : PubMed/NCBI

10 

Xue W, Krasnitz A, Lucito R, Sordella R, Vanaelst L, Cordon-Cardo C, Singer S, Kuehnel F, Wigler M, Powers S, Zender L and Lowe SW: DLC1 is a chromosome 8p tumor suppressor whose loss promotes hepatocellular carcinoma. Genes Dev. 22:1439–1444. 2008. View Article : Google Scholar : PubMed/NCBI

11 

Dammann R, Strunnikova M, Schagdarsurengin U, Rastetter M, Papritz M, Hattenhorst UE, Hofmann HS, Silber RE, Burdach S and Hansen G: CpG island methylation and expression of tumour-associated genes in lung carcinoma. Eur J Cancer. 41:1223–1236. 2005. View Article : Google Scholar : PubMed/NCBI

12 

Mountain CF: Revisions in the International System for Staging Lung Cancer. Chest. 111:1710–1717. 1997. View Article : Google Scholar : PubMed/NCBI

13 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2−∆∆CT method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

14 

Castro M, Grau L, Puerta P, Gimenez L, Venditti J, Quadrelli S and Sánchez-Carbayo M: Multiplexed methylation profiles of tumor suppressor genes and clinical outcome in lung cancer. J Transl Med. doi: 10.1186/1479-5876-8-86.

15 

Seng TJ, Low JS, Li H, Cui Y, Goh HK, Wong ML, Srivastava G, Sidransky D, Califano J, Steenbergen RD, Rha SY, Tan J, Hsieh WS, Ambinder RF, Lin X, Chan AT and Tao Q: The major 8p22 tumor suppressor DLC1 is frequently silenced by methylation in both endemic and sporadic nasopharyngeal, esophageal, and cervical carcinomas, and inhibits tumor cell colony formation. Oncogene. 26:934–944. 2007. View Article : Google Scholar : PubMed/NCBI

16 

Kikuchi S, Yamada D, Fukami T, Masuda M, Sakurai-Yageta M, Williams YN, Maruyama T, Asamura H, Matsuno Y, Onizuka M and Murakami Y: Promoter methylation of DAL-1/4.1B predicts poor prognosis in non-small cell lung cancer. Clin Cancer Res. 11:2954–2961. 2005. View Article : Google Scholar : PubMed/NCBI

17 

Shopland DR, Eyre HJ and Pechacek TF: Smoking-attributable cancer mortality in 1991: is lung cancer now the leading cause of death among smokers in the United States? J Natl Cancer Inst. 83:1142–1148. 1991. View Article : Google Scholar : PubMed/NCBI

18 

Kim DH, Nelson HH, Wiencke JK, Zheng S, Christiani DC, Wain JC, Mark EJ and Kelsey KT: p16(INK4a) and histology-specific methylation of CpG islands by exposure to tobacco smoke in non-small cell lung cancer. Cancer Res. 61:3419–3424. 2001.PubMed/NCBI

19 

Jarmalaite S, Kannio A, Anttila S, Lazutka JR and Husgafvel-Pursiainen K: Aberrant p16 promoter methylation in smokers and former smokers with nonsmall cell lung cancer. Int J Cancer. 106:913–918. 2003. View Article : Google Scholar : PubMed/NCBI

20 

Kim DH, Kim JS, Ji YI, Shim YM, Kim H, Han J and Park J: Hypermethylation of RASSF1A promoter is associated with the age at starting smoking and a poor prognosis in primary non-small cell lung cancer. Cancer Res. 63:3743–3746. 2003.PubMed/NCBI

21 

Kikuchi S, Yamada D, Fukami T, Maruyama T, Ito A, Asamura H, Matsuno Y, Onizuka M and Murakami Y: Hypermethylation of the TSLC1/IGSF4 promoter is associated with tobacco smoking and a poor prognosis in primary nonsmall cell lung carcinoma. Cancer. 106:1751–1758. 2006. View Article : Google Scholar : PubMed/NCBI

22 

Toyooka S, Maruyama R, Toyooka KO, McLerran D, Feng Z, Fukuyama Y, Virmani AK, Zochbauer-Muller S, Tsukuda K, Sugio K, Shimizu N, Shimizu K, Lee H, Chen CY, Fong KM, Gilcrease M, Roth JA, Minna JD and Gazdar AF: Smoke exposure, histologic type and geography-related differences in the methylation profiles of non-small cell lung cancer. Int J Cancer. 103:153–160. 2003. View Article : Google Scholar : PubMed/NCBI

23 

Peto R, Darby S, Deo H, Silcocks P, Whitley E and Doll R: Smoking, smoking cessation, and lung cancer in the UK since 1950: combination of national statistics with two case-control studies. BMJ. 321:323–329. 2000. View Article : Google Scholar : PubMed/NCBI

24 

Hussain SP and Harris CC: Inflammation and cancer: an ancient link with novel potentials. Int J Cancer. 121:2373–2380. 2007. View Article : Google Scholar : PubMed/NCBI

25 

Maekita T, Nakazawa K, Mihara M, Nakajima T, Yanaoka K, Iguchi M, Arii K, Kaneda A, Tsukamoto T, Tatematsu M, Tamura G, Saito D, Sugimura T, Ichinose M and Ushijima T: High levels of aberrant DNA methylation in Helicobacter pylori-infected gastric mucosae and its possible association with gastric cancer risk. Clin Cancer Res. 12:989–995. 2006. View Article : Google Scholar : PubMed/NCBI

26 

Belinsky SA, Nikula KJ, Baylin SB and Issa JP: Increased cytosine DNA-methyltransferase activity is target-cell-specific and an early event in lung cancer. Proc Natl Acad Sci USA. 93:4045–4050. 1996. View Article : Google Scholar : PubMed/NCBI

27 

Vertino PM, Yen RW, Gao J and Baylin SB: De novo methylation of CpG island sequences in human fibroblasts overexpressing DNA (cytosine-5-)-methyltransferase. Mol Cell Biol. 16:4555–4565. 1996. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Feng H, Zhang Z, Wang X and Liu D: Identification of DLC‑1 expression and methylation status in patients with non‑small‑cell lung cancer. Mol Clin Oncol 4: 249-254, 2016.
APA
Feng, H., Zhang, Z., Wang, X., & Liu, D. (2016). Identification of DLC‑1 expression and methylation status in patients with non‑small‑cell lung cancer. Molecular and Clinical Oncology, 4, 249-254. https://doi.org/10.3892/mco.2015.681
MLA
Feng, H., Zhang, Z., Wang, X., Liu, D."Identification of DLC‑1 expression and methylation status in patients with non‑small‑cell lung cancer". Molecular and Clinical Oncology 4.2 (2016): 249-254.
Chicago
Feng, H., Zhang, Z., Wang, X., Liu, D."Identification of DLC‑1 expression and methylation status in patients with non‑small‑cell lung cancer". Molecular and Clinical Oncology 4, no. 2 (2016): 249-254. https://doi.org/10.3892/mco.2015.681
Copy and paste a formatted citation
x
Spandidos Publications style
Feng H, Zhang Z, Wang X and Liu D: Identification of DLC‑1 expression and methylation status in patients with non‑small‑cell lung cancer. Mol Clin Oncol 4: 249-254, 2016.
APA
Feng, H., Zhang, Z., Wang, X., & Liu, D. (2016). Identification of DLC‑1 expression and methylation status in patients with non‑small‑cell lung cancer. Molecular and Clinical Oncology, 4, 249-254. https://doi.org/10.3892/mco.2015.681
MLA
Feng, H., Zhang, Z., Wang, X., Liu, D."Identification of DLC‑1 expression and methylation status in patients with non‑small‑cell lung cancer". Molecular and Clinical Oncology 4.2 (2016): 249-254.
Chicago
Feng, H., Zhang, Z., Wang, X., Liu, D."Identification of DLC‑1 expression and methylation status in patients with non‑small‑cell lung cancer". Molecular and Clinical Oncology 4, no. 2 (2016): 249-254. https://doi.org/10.3892/mco.2015.681
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team