Mutation analysis of Leber congenital amaurosis‑associated genes in patients with retinitis pigmentosa

  • Authors:
    • Tao Shen
    • Liping Guan
    • Shiqiang Li
    • Jianguo Zhang
    • Xueshan Xiao
    • Hui  Jiang
    • Jianhua Yang
    • Xiangming Guo
    • Jun Wang
    • Qingjiong Zhang
  • View Affiliations

  • Published online on: November 7, 2014     https://doi.org/10.3892/mmr.2014.2894
  • Pages: 1827-1832
Metrics: HTML 0 views | PDF 0 views     Cited By (CrossRef): 0 citations

Abstract

The genetic defects underlying approximately half of all retinitis pigmentosa (RP) cases are unknown. A number of genes responsible for Leber congenital amaurosis (LCA) may also cause RP when they are mutated. Our previous study revealed that variants in the most frequently mutated nine exons accounted for approximately half of the mutations detected in a cohort of patients with LCA. The aim of the present study was to detect mutations in LCA-associated genes in patients with RP using two different strategies. Sanger sequencing was used to screen mutations in the nine exons in 293 patients with RP and exome sequencing was used to detect variants in 12 LCA-associated genes in 157 of the 293 patients with RP and then to validate the variants by Sanger sequencing. Potential pathogenic mutations were identified in four patients with early onset RP, including homozygous CRB1 mutations in two patients, compound heterozygous CRB1 mutations in one patient and compound heterozygous CEP290 mutations in one patient. The present study indicated that mutations in CEP290 may also be associated with RP but not with LCA. With the exception of CEP290, the remaining 11 genes known to be associated with LCA but not with RP are unlikely to be a common cause of RP.

Introduction

Retinitis pigmentosa (RP) is the most common form of progressive hereditary retinal degeneration, with a worldwide prevalence of ~1 in 4,000 (1,2). To date, mutations in at least 61 genes have been reported to cause RP (RetNet, https://sph.uth.edu/Retnet/). However, mutations in these genes contribute to only half of the clinical cases (3). Therefore, identification of additional genes responsible for RP is important to determine the molecular basis of RP and aid in the development of novel therapeutic strategies. Genes known to cause other forms of hereditary retinal degeneration may be good candidates for genes causing RP.

Leber congenital amaurosis (LCA) is the most severe form of hereditary retinal degeneration, with ~20 causative genes identified. Our previous study has shown that about half of the variants were detected in nine frequently mutated exons (4). Mutations in eight of the 20 LCA-associated genes have been reported to cause RP as well (47). However, systemic evaluation of LCA-associated genes in patients with RP is limited (810), particularly for those 12 of the 20 genes in which a mutation has not been identified in patients with RP. The 12 genes known to cause LCA but not RP are as follows: Aryl hydrocarbon interacting protein-like 1 (AIPL1) (11), calcium-binding protein 4 (CABP4) (12), centrosomal protein 290 kDa (CEP290) (13), death domain containing 1 (DTHD1) (14), guanylate cyclase 2D, membrane (retina-specific; GUCY2D) (15), IQ motif-containing protein B1 (IQCB1) (16), potassium inwardly-rectifying channel, subfamily J, member 13 (KCNJ13) (17), Leber congenital amaurosis 5 (LCA5) (18), nicotinamide nucleotide adenylyltransferase 1 (NMNAT1) (19), orthodenticle homeobox 2 (OTX2) (20), retinal degeneration 3 (RD3) (21) and retinitis pigmentosa GTPase regulator interacting protein 1 (RPGRIP1) (22).

In the present study, variations in LCA-associated genes were evaluated in a cohort of patients with RP using two methods: i) The most commonly mutated nine exons were analyzed by Sanger sequencing in 293 patients with RP; and ii) for the 12 genes known to associate with LCA but not RP, variants that resulted from exome sequencing in 157 of the 293 patients with RP were selected and then further confirmed by Sanger sequencing. Mutations in four patients with RP were identified in LCA-associated genes.

Subjects and methods

Subjects

Probands with a clinical diagnosis of RP from 293 unrelated families were recruited from the Pediatric and Genetic Eye Clinic, Zhongshan Ophthalmic Center (Guangzhou, China) since 1996. The diagnosis of RP was based on phenotypes described in a previous study (23). Written informed consent from each participant or their guardians was obtained prior to collection of their clinical data and venous blood samples. Genomic DNA was prepared from leukocytes in venous blood as previously described (24). The present study was approved by the Institutional Review Board of the Zhongshan Ophthalmic Center.

Analysis of the nine frequently mutated exons

The most frequently mutated nine exons were selected based on our previous study (4), as listed in Table I. The genomic fragments of the nine exons were amplified by polymerase chain reaction, using primers encompassing each of the nine exons and the adjacent intronic regions (Table II). Touchdown PCR amplifications of the genomic fragments, sequencing and result analysis was processed as previously described (4).

Table I

Most frequently mutated nine exons analyzed.

Table I

Most frequently mutated nine exons analyzed.

GeneOMIMMap locationNumber of coding exonsTargeted exon(s)Frequency for mutant alleles in Chinese LCA patients (4), %
GUCY2D60017917p13.11829.00
113.85
123.85
CRB16042101q31-q32.11267.70
95.14
116.41
RPE651800691p311445.14
RPGRIP160544614q112435.14
CEP29061014212q21.325363.85

[i] OMIM, Online Mendelian Inheritance in Man; LCA, Leber congenital amaurosis.

Table II

Primers used for the most frequently mutated nine exons.

Table II

Primers used for the most frequently mutated nine exons.

Primer namePrimer sequence, 5′-3′Size of amplicon, bp
GUCY2D-E2a-FW ccttggccccagttagtctt552
GUCY2D-E2a-RV gttcaccggacccacgag
GUCY2D-E2b-FW gtccccgcttcgaggtag552
GUCY2D-E2b-RV accgagtgcatcaccatga
GUCY2D-E11-FW gatagttgcagggctggtct397
GUCY2D-E11-RV gtttcatcactgggctttgc
GUCY2D-E12-FW tgaacctctgatgtaaagaaacc398
GUCY2D-E12-RV gtagcctggaaggccagag
CRB1-E6a-FW ttcatgcacttctgcaagatt598
CRB1-E6a-RV tgaacagaagcacctttgactg
CRB1-E6b-FW cgaagcaacagggatgtgtt648
CRB1-E6b-RV tttcatagcaggcagaagca
CRB1-E9a-FW atgtatcaaatagtcaatatgcaatgt598
CRB1-E9a-RV gagataaatgcctccgatttc
CRB1-E9b-FW tgtgggagacagagctattga594
CRB1-E9b-RV cttgaggagagagctttccaa
CRB1-E11-FW agactgtgctgttccagagaga344
CRB1-E11-RV ctgttcaccccactcaacaa
RPE65-E4-FW ccctttattcttcatgttgtgc380
RPE65-E4-RV gtcagtaacctctactcctcgaaa
RPGRIP1-E3-FW tgtggttaatagatcacggtagatg530
RPGRIP1-E3-RV gcagaaaggagggagtgaga
CEP290-E6-FW gcttgttgttgactcatttgaa375
CEP290-E6-RV ttggtgatgacaaaatgaaca

[i] FW, forward; RV, reverse; bp, base pairs. Annealing temperature, 58–65°C.

Variants in 12 genes as determined by exome sequencing

Whole exome sequencing was performed on 157 of the 293 unrelated patients with RP, using a commercial service from BGI Shenzhen (Shenzhen, China; http://www.genomics.cn/index) as previously described (25,26). Mutations in 60 genes responsible for RP were identified in approximately half of these patients (27). The variants in the 12 genes known to be associated with LCA but not RP, resulted from exome sequencing of the 157 patients with RP, were collected for further analysis. Heterozygous variants for dominant genes and homozygous or compound heterozygous variants for recessive genes were selected and verified by Sanger sequencing, using primers to amplify the individual fragments harboring variants (Table III). The mutation hot spot, c.2991+1655A>G in CEP290 (13), is at the position beyond the scope of exome sequencing, thus genomic fragments of CEP290 encompassing c.2991+1655A>G were amplified and analyzed by Sanger sequencing in all 157 RP patients.

Table III

Primers used for validating variants from exome sequencing.

Table III

Primers used for validating variants from exome sequencing.

Primer namePrimer sequence, 5′-3′Target variant/sequenced sample
CEP290-E7-FW tttgaaaattttggcctattatttatg CEP290:c.442-10_11insT/RP397
CEP290-E7-RV tccctgagacaaagtcatacca
CEP290-IVS26+1655-FW ggttcaggccgttctcct CEP290:c.2991+1655A>G/All patients
CEP290-IVS26+1655-RV agtttttaaggcggggagtc
CEP290-E28-FW tccaggtctgatggaattcag CEP290:c.3104-2delA/RP276
CEP290-E28-RV ttcagagatccagacaaaccac
CEP290-E32-FW tttgtcatgtagtttgacaaaagat CEP290:c.4040G>A/RP276
CEP290-E32-RV cggatcatgaggtcaggaga
CEP290-E49-FW agcatttagagccccaggtt CEP290:c.6736A>G/RP397
CEP290-E49-RV ctgttcatcaggaagaaacca
LCA5-E4-FW caagagaaagaacgggcaac LCA5:c.634G>T/RP374
LCA5-E4-RV atgcccaatgagaaacatcc
LCA5-E9-FW ccagagagaagccccaaaac LCA5:c.1642C>T/RP374
LCA5-E9-RV tggatttgacctctctgatgtt

[i] FW, forward; RV, reverse. Annealing temperature, 58–65°C.

Bioinformatics analysis

In total, two online computational prediction algorithms, PolyPhen-2 (http://genetics.bwh.harvard.edu/pph2/) and SIFT (http://sift.jcvi.org/), were used to predict the functional impact of missense mutations identified (28). The PolyPhen-2 website can predict the functional effect of variants and classify them into ‘probably damaging’, ‘possibly damaging’, ‘benign’, and ‘unknown’ (29). The SIFT algorithm shows a normalized probability score of a missense variant: When the normalized probability is larger than 0.05, the variant is predicted to be ‘tolerated’, otherwise, the variant is predicted to be ‘damaging’ (30). The impact of variants on the splice site was predicted by NNSPLICE version 0.9 (http://fruitfly.org/seq_tools/splice.html) (7). The description of variants referred to the nomenclature of the Human Genomic Variation Society (http://www.hgvs.org/mutnomen/). Novel variants were further evaluated in 192 normal controls.

Results

Sanger sequencing

Analysis of the nine frequently mutated exons identified potential pathogenic mutations in the CRB1 gene in three patients, including one known and two novel mutations, i.e. c.1831T>C (p.S611P), c.1841G>T (p.G614V) and c.3442T>C (p.C1148R) (Table IV; Fig. 1). These variants were not present in the 192 unaffected controls. One patient had compound heterozygous mutations and the other two had homozygous mutations (Table V).

Table IV

Potential pathogenic mutations detected in patients with RP.

Table IV

Potential pathogenic mutations detected in patients with RP.

GeneMethodNucleotide changeAmino acid changeBioinformaticsStatus/patient IDAllele frequencyReported


P/SSSIFTPatientsControls
CRB1Sangerc.1831T>Cp.S611PPrDDHet/RP019; Hom/RP0514/5860/384Li et al (4)
CRB1Sangerc.1841G>Tp.G614VPrDDHet/RP0191/5860/384Novel
CRB1Sangerc.3442T>Cp.C1148RPrDDHom/RP1731/5860/384Novel
CEP290Exomec.3104-2delASplicing defectSSANAHet/RP2761/3140/192Novel
CEP290Exomec.4040G>Ap.W1347*NANAHet/RP2761/3140/192Novel

{ label (or @symbol) needed for fn[@id='tfn4-mmr-11-03-1827'] } RP, retinitis pigmentosa; P/SS, Polyphen-2/Splice Site Prediction; SIFT, Scale-invariant feature transform; ID, identity; Het, heterozygous; Hom, homozygous; PrD, probably damaging; D, damaging; SSA, splicing site abolished; NA, not applicable,

* stop codon.

Table V

Clinical data of the four patients with mutations.

Table V

Clinical data of the four patients with mutations.

Patient IDGeneVariationsInheritanceGenderAge (years)First symptomVisual acuity (OD; OS)Fundus changesElectroretinography response


ExamOnsetRodCone
RP019CRB1 c.[1831T>C];[1841G>T]ARMale17ECPV, NBFC; FCAV, WPD, PD, MDNANA
RP051CRB1 c.[1831T>C];[1831T>C]IsolatedFemale53NB, CB0.1; 0.3PD, MDSeverely reducedSeverely reduced
RP173CRB1 c.[3442T>C];[3442T>C]Isolated/consFemale29ECPVHM; HMAV, PDNANA
RP276CEP290 c.[4040G>A];[3104-2delA]IsolatedMale6ECNBNDAV, CRDExtinguishedExtinguished

[i] ID, identity; OD, right eye; OS, left eye; AR, autosomal recessive; EC, early childhood; PV, poor vision; NB, night blindness; FC, finger counting; AV, attenuated vessels; WPD, waxy pale disc; PD, pigment deposit; MD, macular degeneration; NA, not available; CB, color blindness; Cons, consanguinity; HM, hand movement; ND, not dectected; CRD, carpet-like retinal degeneration.

Exome sequencing

Exome sequencing identified six variants in two of the 12 genes, including four variants in CEP290 and two variants in LCA5, i.e. c.[442-10_11insT];[6736A>G] in CEP290 of RP397, c.[4040G>A];[3104-2delA] in CEP290 of RP276, and c.[1642C>T];[634G>T] in LCA5 of RP374. The compound heterozygous c.[4040G>A];[3104-2delA] mutations in CEP290 of RP276 were considered to be potential pathogenic mutations (Tables IV and V, Fig. 1). The other two compound heterozygous variants in CEP290 and LCA5, respectively, were unlikely pathogenic since the c.6736A>G (p.K2246E) in CEP290 and the c.1642C>T (p.P548S) in LCA5 were predicted to be benign or tolerated by PolyPhen-2 and SIFT, while mutations in these two genes are associated with recessive retinal diseases. No potentially pathogenic variants were detected in the remaining 10 of the 12 genes, including AIPL1, CABP4, DTHD1, GUCY2D, IQCB1, KCNJ13, NMNAT1, OTX2, RD3 and RPGRIP1.

Clinical data of patients with LCA-associated gene mutations

Clinical data of the four RP patients with mutations in the LCA-associated genes were summarized in Table V. The patients examined were between 5 and 29 years old. Although they presented with poor vision or night blindness, none of thee patients exhibited nystagmus or oculardigital sign. These patients were likely to have early onset severe RP.

Discussion

In the present study, potentially pathogenic mutations in LCA-associated genes were identified in four of the 293 patients with RP. By screening the most frequently mutated nine exons, homozygous or compound heterozygous mutations were identified in two exons of the CRB1 gene in 1.0% (3/293) of RP probands. No such variant was detected in the rest of the six exons of the other four genes. This indicates that the mutation rate of these nine exons in RP patients is markedly lower compared with that in the LCA patients (4). After analyzing the variants in 12 genes, associated with LCA but not RP, resulting from exome sequencing of 157 patients, it was confirmed that one patient harbored compound heterozygous mutations in CEP290. Previously, the CEP290 mutation in patients with RP has rarely been reported, except for the compound heterozygous mutations, c.[4705-1G>T];[3559delC], in an autosomal recessive RP patient (32).

All four patients with RP demonstrated early onset severe retinal degeneration, but also, they were marginally different from LCA due to the absence of nystagmus and oculodigital signs. According to previous studies, among RP patients caused by CRB1 mutations, patients with null mutations (i.e., nonsense, frameshift and splice-site mutations) on the two alleles are likely to result in a more severe form of retinal degeneration (e.g. LCA), while a missense mutation on at least one allele may suffer from a milder phenotype (e.g. RP) (33,34). Previous studies have revealed that CRB1 can cause autosomal recessive RP, and it was recently reported that CRB1 mutations are a relatively frequent cause of autosomal recessive early onset retinal degeneration in Israeli, Palestinian and Spanish populations (34,35).

Hereditary retinal degeneration is a complicated group of diseases causing blindness. For each form, including RP, LCA or cone-rod dystrophies, a number of causative genes have been identified. Sometimes, atypical phenotypes or phenotypic progression may hinder proper classification of the diseases and as a result analysis of pertinent candidate genes may not be available. Conversely, a number of genes responsible for one form of retinal degeneration may also lead to other forms of the disease. Those genes that are considered to cause a certain form of retinal degeneration may remain potential candidate genes for other forms of retinal dystrophy. Extensive analysis of all the potential candidate genes, not just a subset of well-defined known causative genes, may lead to the identification of the genetic defects in more patients with retinal degeneration. This may be increasingly significant in the era of exome sequencing.

Acknowledgements

The authors would like to thank all of the patients and controls for their participation. The present study was supported by the National Natural Science Foundation of China (grant nos. 81170881 and U1201221) and the Guangdong Department of Science & Technology Translational Medicine Center (grant no. 2011A080300002).

References

1 

Parmeggiani F: Clinics, epidemiology and genetics of retinitis pigmentosa. Curr Genomics. 12:236–237. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Hu DN: Prevalence and mode of inheritance of major genetic eye diseases in China. J Med Genet. 24:584–588. 1987. View Article : Google Scholar : PubMed/NCBI

3 

Hartong DT, Berson EL and Dryja TP: Retinitis pigmentosa. Lancet. 368:1795–1809. 2006. View Article : Google Scholar : PubMed/NCBI

4 

Li L, Xiao X, Li S, et al: Detection of variants in 15 genes in 87 unrelated Chinese patients with Leber congenital amaurosis. PLoS One. 6:e194582011. View Article : Google Scholar : PubMed/NCBI

5 

den Hollander AI, Heckenlively JR, van den Born LI, et al: Leber congenital amaurosis and retinitis pigmentosa with Coats-like exudative vasculopathy are associated with mutations in the crumbs homologue 1 (CRB1) gene. Am J Hum Genet. 69:198–203. 2001. View Article : Google Scholar : PubMed/NCBI

6 

Zernant J, Külm M, Dharmaraj S, et al: Genotyping microarray (disease chip) for Leber congenital amaurosis: detection of modifier alleles. Invest Ophthalmol Vis Sci. 46:3052–3059. 2005. View Article : Google Scholar : PubMed/NCBI

7 

Reese MG, Eeckman FH, Kulp D and Haussler D: Improved splice site detection in Genie. J Comput Biol. 4:311–323. 1997. View Article : Google Scholar : PubMed/NCBI

8 

Morimura H, Fishman GA, Grover SA, et al: Mutations in the RPE65 gene in patients with autosomal recessive retinitis pigmentosa or leber congenital amaurosis. Proc Natl Acad Sci USA. 95:3088–3093. 1998. View Article : Google Scholar : PubMed/NCBI

9 

Rivolta C, Sharon D, DeAngelis MM and Dryja TP: Retinitis pigmentosa and allied diseases: numerous diseases, genes, and inheritance patterns. Hum Mol Genet. 11:1219–1227. 2002. View Article : Google Scholar : PubMed/NCBI

10 

Booij JC, Florijn RJ, ten Brink JB, et al: Identification of mutations in the AIPL1, CRB1, GUCY2D, RPE65, and RPGRIP1 genes in patients with juvenile retinitis pigmentosa. J Med Genet. 42:e672005. View Article : Google Scholar : PubMed/NCBI

11 

Sohocki MM, Bowne SJ, Sullivan LS, et al: Mutations in a new photoreceptor-pineal gene on 17p cause Leber congenital amaurosis. Nat Genet. 24:79–83. 2000. View Article : Google Scholar

12 

Aldahmesh MA, Al-Owain M, Alqahtani F, Hazzaa S and Alkuraya FS: A null mutation in CABP4 causes Leber’s congenital amaurosis-like phenotype. Mol Vis. 16:207–212. 2010.PubMed/NCBI

13 

den Hollander AI, Koenekoop RK, Yzer S, et al: Mutations in the CEP290 (NPHP6) gene are a frequent cause of Leber congenital amaurosis. Am J Hum Genet. 79:556–561. 2006. View Article : Google Scholar : PubMed/NCBI

14 

Abu-Safieh L, Alrashed M, Anazi S, et al: Autozygome-guided exome sequencing in retinal dystrophy patients reveals pathogenetic mutations and novel candidate disease genes. Genome Res. 23:236–247. 2013. View Article : Google Scholar :

15 

Perrault I, Rozet JM, Calvas P, et al: Retinal-specific guanylate cyclase gene mutations in Leber’s congenital amaurosis. Nat Genet. 14:461–464. 1996. View Article : Google Scholar : PubMed/NCBI

16 

Estrada-Cuzcano A, Koenekoop RK, Coppieters F, et al: IQCB1 mutations in patients with leber congenital amaurosis. Invest Ophthalmol Vis Sci. 52:834–839. 2011. View Article : Google Scholar

17 

Sergouniotis PI, Davidson AE, Mackay DS, et al: Recessive mutations in KCNJ13, encoding an inwardly rectifying potassium channel subunit, cause leber congenital amaurosis. Am J Hum Genet. 89:183–190. 2011. View Article : Google Scholar : PubMed/NCBI

18 

den Hollander AI, Koenekoop RK, Mohamed MD, et al: Mutations in LCA5, encoding the ciliary protein lebercilin, cause Leber congenital amaurosis. Nat Genet. 39:889–895. 2007. View Article : Google Scholar : PubMed/NCBI

19 

Koenekoop RK, Wang H, Majewski J, et al: Mutations in NMNAT1 cause Leber congenital amaurosis and identify a new disease pathway for retinal degeneration. Nat Genet. 44:1035–1039. 2012. View Article : Google Scholar : PubMed/NCBI

20 

Henderson RH, Williamson KA, Kennedy JS, et al: A rare de novo nonsense mutation in OTX2 causes early onset retinal dystrophy and pituitary dysfunction. Mol Vis. 15:2442–2447. 2009.PubMed/NCBI

21 

Friedman JS, Chang B, Kannabiran C, et al: Premature truncation of a novel protein, RD3, exhibiting subnuclear localization is associated with retinal degeneration. Am J Hum Genet. 79:1059–1070. 2006. View Article : Google Scholar : PubMed/NCBI

22 

Dryja TP, Adams SM, Grimsby JL, et al: Null RPGRIP1 alleles in patients with Leber congenital amaurosis. Am J Hum Genet. 68:1295–1298. 2001. View Article : Google Scholar : PubMed/NCBI

23 

Ji Y, Wang J, Xiao X, Li S, Guo X and Zhang Q: Mutations in RPGR and RP2 of Chinese patients with X-linked retinitis pigmentosa. Curr Eye Res. 35:73–79. 2010. View Article : Google Scholar

24 

Wang Q, Wang P, Li S, et al: Mitochondrial DNA haplogroup distribution in Chaoshanese with and without myopia. Mol Vis. 16:303–309. 2010.PubMed/NCBI

25 

Chen Y, Zhang Q, Shen T, et al: Comprehensive mutation analysis by whole-exome sequencing in 41 Chinese families with Leber congenital amaurosis. Invest Ophthalmol Vis Sci. 54:4351–4357. 2013. View Article : Google Scholar : PubMed/NCBI

26 

Li Y, Vinckenbosch N, Tian G, et al: Resequencing of 200 human exomes identifies an excess of low-frequency non-synonymous coding variants. Nat Genet. 42:969–972. 2010. View Article : Google Scholar : PubMed/NCBI

27 

Xu Y, Guan L, Shen T, et al: Mutations of 60 known causative genes in 157 families with retinitis pigmentosa based on exome sequencing. Hum Genet. 133:1255–1271. 2014. View Article : Google Scholar : PubMed/NCBI

28 

Flanagan SE, Patch AM and Ellard S: Using SIFT and PolyPhen to predict loss-of-function and gain-of-function mutations. Genet Test Mol Biomarkers. 14:533–537. 2010. View Article : Google Scholar : PubMed/NCBI

29 

Ramensky V, Bork P and Sunyaev S: Human non-synonymous SNPs: server and survey. Nucleic Acids Res. 30:3894–3900. 2002. View Article : Google Scholar : PubMed/NCBI

30 

Kumar P, Henikoff S and Ng PC: Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm. Nat Protoc. 4:1073–1081. 2009. View Article : Google Scholar : PubMed/NCBI

31 

Wang J, Liu J and Zhang Q: FOXL2 mutations in Chinese patients with blepharophimosis-ptosis-epicanthus inversus syndrome. Mol Vis. 13:108–113. 2007.PubMed/NCBI

32 

Neveling K, Collin RW, Gilissen C, et al: Next-generation genetic testing for retinitis pigmentosa. Hum Mutat. 33:963–972. 2012. View Article : Google Scholar : PubMed/NCBI

33 

Beryozkin A, Zelinger L, Bandah-Rozenfeld D, et al: Mutations in CRB1 are a relatively common cause of autosomal recessive early-onset retinal degeneration in the Israeli and Palestinian populations. Invest Ophthalmol Vis Sci. 54:2068–2075. 2013. View Article : Google Scholar : PubMed/NCBI

34 

Bujakowska K, Audo I, Mohand-Saïd S, et al: CRB1 mutations in inherited retinal dystrophies. Hum Mutat. 33:306–315. 2012. View Article : Google Scholar :

35 

Corton M, Tatu SD, Avila-Fernandez A, et al: High frequency of CRB1 mutations as cause of Early-Onset Retinal Dystrophies in the Spanish population. Orphanet J Rare Dis. 8:202013. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

March 2015
Volume 11 Issue 3

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Shen, T., Guan, L., Li, S., Zhang, J., Xiao, X., Jiang, H. ... Zhang, Q. (2015). Mutation analysis of Leber congenital amaurosis‑associated genes in patients with retinitis pigmentosa. Molecular Medicine Reports, 11, 1827-1832. https://doi.org/10.3892/mmr.2014.2894
MLA
Shen, T., Guan, L., Li, S., Zhang, J., Xiao, X., Jiang, H., Yang, J., Guo, X., Wang, J., Zhang, Q."Mutation analysis of Leber congenital amaurosis‑associated genes in patients with retinitis pigmentosa". Molecular Medicine Reports 11.3 (2015): 1827-1832.
Chicago
Shen, T., Guan, L., Li, S., Zhang, J., Xiao, X., Jiang, H., Yang, J., Guo, X., Wang, J., Zhang, Q."Mutation analysis of Leber congenital amaurosis‑associated genes in patients with retinitis pigmentosa". Molecular Medicine Reports 11, no. 3 (2015): 1827-1832. https://doi.org/10.3892/mmr.2014.2894