Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
January-2016 Volume 13 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2016 Volume 13 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Inhibition of the expression of aquaporin‑1 by RNA interference in pulmonary epithelial cells and its effects on water transport

  • Authors:
    • Qiuyue Zhang
    • Jianhua Fu
    • Xindong Xue
  • View Affiliations / Copyright

    Affiliations: Department of Pediatrics, The First Affiliated Hospital of Harbin Medical University, Harbin, Heilongjiang 150001, P.R. China, Department of Pediatrics, China Medical University Affiliated to Shengjing Hospital, Shenyang, Liaoning 110004, P.R. China
  • Pages: 281-286
    |
    Published online on: November 6, 2015
       https://doi.org/10.3892/mmr.2015.4519
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

In the present study, the effect of aquaporin‑1 (AQP1) on fluid transportation in pulmonary epithelial cells, and the role of AQP1 in alveolar fluid clearance were investigated to provide an experimental foundation to elucidate the pathogenesis of hyperoxic lung edema. An siRNA transfection technique was used to silence AQP1 in the A549 cell line. The transfected cells were randomized into a hyperoxia exposure and an air control group, with a negative control group set for each group. Cell volume was determined using flow cytometry, and Pf values were used to determine osmotic water permeability. Cell volume was found to be reduced in the AQP1‑silenced A549 cells, compared with the negative control group 72 h following air exposure. In addition, cell volume was reduced in the AQP1‑silenced A549 cells, compared with the negative control group 48 and 72 h following hyperoxia exposure. The osmotic water permeability of the AQP1‑silenced cells was reduced in the air control and hyperoxia exposure groups, compared with the negative control group 48 and 72 h following exposure. The volume and cell membrane osmotic water permeability of the A549 cells were reduced, compared with those in the control group following AQP1‑silencing, which indicated that the downregulation of AQP1 impedes extracellular to intracellular fluid transportation. Therefore, the disturbance in alveolar fluid clearance resulting from the downregulation of AQP1 following hyperoxia exposure may be one of the key mechanisms responsible for hyperoxic lung edema.

Introduction

High oxygen levels may cause bronchial pulmonary hypoplasia, which has a prevalence of 1.26% in China (1). It has been suggested that alterations in the expression levels of aquaporin-1 (AQP1) may be involved in the rapid transportation of alveolar fluid in the early stages of pulmonary injury, due to previous observations that the expression and activity levels of AQP1 are reduced in multiple pulmonary injuries (2–4).

The present study aimed to investigate whether high levels of oxygen affect the expression levels of AQP1 in newborn rat lung epithelial cells, which may be one of the reasons for high oxygen-induced pulmonary edema (5). At present, there is no direct experimental evidence to support the definite involvement of a downregulation in AQP1 in lung edema in newborn rats exposed to hyperoxia, due to the fact that sodium-potassium ATPase and fluid transportation systems in addition to AQP are also present in lung tissues (6). In the present study, the AQP1 gene was silenced using an RNA interference (RNAi) technique in human pulmonary adenocarcinoma A549 cells. This was performed in order to verify the direct correlation between AQP1 and cell fluid transportation at a cellular level, in addition to further elucidating its association with the pathogenesis of lung edema during hyperoxic pulmonary injury.

Oxygen is crucial for human beings, but long-term inhalation of a high concentration of oxygen can lead to lung injury in premature babies with bronchial pulmonary hypoplasia (BPD). The pathogenesis of BPD is not entirely clear, however, the pathological process includes early pulmonary edema and late pulmonary fibrosis.

Materials and methods

Cell culture

Human pulmonary adenocarcinoma A549 cells (Central Laboratory, China Medical University Affiliated Shenjing Hospital, Shenyang, China) were cultured in RPMI 1640 culture medium (Sigma-Aldrich, St. Louis, MO, USA) containing 10% fetal bovine serum (FBS; Clark, Seabrook, MD, USA) at 37°C and 5% CO2 in a cell incubator. The cell medium was refreshed every 1–2 days. Trypsin (0.25%; Merck Millipore, Darmstadt, Germany) was used to digest and passage the cells for 5–10 min every 2–3 days.

Experimental group assignment and intervention

The A549 cells were randomized into two groups: Air group and hyperoxia group. Each group was further divided into a gene silencing group and negative control group. The cells in the air group were cultured in a normal cell incubator (oxygen volume fraction=0.21) and the cells in the hyperoxia group were cultured in a hyperoxic incubator (oxygen volume fraction=0.90) for 24, 48 and 72 h prior to detection.

Preparation of the AQP1 gene-silencing cell model

To silence the gene expression of AQP1, AQP1-siRNA transient transfection using ON-TARGETplus Smart Pool siRNA (Thermo Fisher Scientific, Inc., Waltham, MA, USA) and DharmaFECT 1 (T-2001-01; Thermo Fisher Scientific, Inc.) transfection reagent was performed. The potential sequences in the target mRNAs of AQP1, beginning with an AA dinucleotide were identified and compared with the human genome database using the Basic Local Alignment Search Tool (BLAST; http://blast.ncbi.nlm.nih.gov/Blast.cgi). Any target sequences with base pairs of homology to other coding sequences were eliminated from consideration. In total, four pairs of sequences were designed and synthesized (Sangon Biotech Co., Ltd., Shanghai, China), as follows (5′-3′): siRNA1, 5′-GAACUCACUUGGCCGAAAU-3′; siRNA2, 5′-CCGUUAACCAUGUCGUGAA-3′; siRNA3, 5′-CCCAAAUAGAGGAGGCUUG-3′; and siRNA4, 5′-UGACGUGUGUGUUUAUUAA-3′. Negative siRNA sequences were used as negative controls. For knockdown of the expression of AQP1, the A549 cells were plated at a concentration of 4×105 cells/well in 6-well plates and incubated in antibiotic-free media overnight. A total of 100 µl siRNA (2 µmol/l) and 2 µl DharmaFECT were diluted with 100 µl and 198 µl serum-free medium, respectively, and set aside for 5 min at room temperature. The two dilutions were mixed and left for 20 min at room temperature, prior to the addition of 1,600 µl antibiotic-free and serum-free complete media, to produce a total volume of 2 ml transfection medium. The cells were overlaid with the transfection medium and were incubated for 6 h at 37°C. The cells were then washed with phosphate-buffered saline (PBS) and cultivated in RPMI 1640 medium containing 10% FBS. At 48 and 72 h post-transfection, the cells were harvested and stored at −80°C for further analysis.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

The A549 cells were harvested by centrifugation at 111.8 × g at 4°C for 5 min, and were randomized into a gene silencing and negative control group (1×109 cells/group), and were cultured in a cell incubator (oxygen volume fraction=0.21) for 48 h. Briefly, total RNA was extracted from the harvested cells using an acid guanidinium-phenol-chloroform method (TRIzol®; Invitrogen; Thermo Fisher Scientific, Inc.). The total RNA was reverse transcribed into cDNA in a 20 µl reaction containing 8 µl RNA, 2 µl oligo(dT)15 (Tiangen Biotech Co., Ltd., Beijing, China), 2 µl dNTP (2.5 mM; Tiangen Biotech Co., Ltd.), 1.5 µl RNase-free ddH2O, 4 µl 5X First-Strand Buffer (Tiangen Biotech Co., Ltd.), 1 µl (0.1 M) DTT (Tiangen Biotech Co., Ltd.), 0.5 µl RNasin (Tiangen Biotech Co., Ltd.) and 1 µl (200 M) TIANScript M-MLV (Tiangen Biotech Co., Ltd.). The mixture was incubated for 50 min at 42°C and the reaction was terminated by heating to 95°C for 5 min. The cDNA synthesized by reverse transcription was used as templates for quantitative fluorescent analysis using a fluorescent quantitator (Exicycler™ 96; Bioneer Corporation, Daejeon, Korea). An equal volume of cDNA was amplified in a reaction mixture consisting of 10 µl Taq 2X PCR Master Mix (Tiangen Biotech Co., Ltd.), 7.5 µl ddH2O, 9 µl SYBR Green (Tiangen Biotech Co., Ltd.), 1.5 µl cDNA and 1 µl gene-specific forward and reverse AQP1 primers. The primer sequences (Sangon Biotech Co., Ltd.) were as follows: Forward, 5′-ACCCGCAACTTCTCAAAC-3′ and reverse, 5′-CAGGTCATACTCCTCCACTT-3′. The initial denaturation was at 95°C for 10 min, followed by 40 cycles of 95°C for 10 sec, 55°C for 30 sec and 68°C for 40 sec. Melt curves were used to determine the formation of a single product. The quantification cycle (Cq) was recorded for each sample to reflect the mRNA expression levels. The Cq values and data were analyzed using the 2−∆∆Cq method (7). The hGAPDH gene (forward, GAAGGTCGGAGTCAACGGAT, and reverse, CCTGGAAGATGGTGATGGGAT) was used as an internal control. All experiments were repeated three times.

Western blot analysis

Total protein was extracted from the cells using radioimmunoprecipitation assay buffer (Beyotime Institute of Biotechnology, Shanghai, China), and were quantified using a standard curve. The cells were randomized into a gene silencing and a negative control group and were cultured in a cell incubator (oxygen volume fraction=0.21) for 72 h. Proteins were extracted from the harvested cells for quantitation. The proteins (9 µg) were loaded onto a 5% SDS-PAGE gel (Beyotime Institute of Biotechnology) for electrophoresis and transferred onto cellulose membranes (Merck Millipore) prior to blocking in buffer containing 5% non-fat milk powder for 2 h. The membrane was incubated with mouse anti-human monoclonal AQP1 primary antibody (cat. no. sc25287; 1:400; Santa Cruz Biotechnology, Inc., Danvers, MA, USA) at 37°C for 1 h, and washed with Tris-buffered saline with Tween 20 prior to hybridization with alkaline phosphatase-labeled goat anti-mouse monoclonal secondary antibody (cat. no. A0216; 1:10,000; Beyotime Institute of Biotechnology) at 37°C for 40 min. Subsequently, images of the film (WD-9413B; Beijng Liuyi Biotechnology Co., Ltd., Beijing, China) were captured using an imaging system (WD-9413B; Beijing Six One Company) following electrochemiluminescence (Merck Millipore) exposure, and analyzed using Exicycler 96 (Bioneer Corporation). The results were presented as the relative grey value of the AQP1 band/grey value of the GAPDH band.

Determination of cell volume following AQP1-silencing

The cells in each group were cultured for 24, 48 and 72 h prior to washing with PBS and digesting with 0.25% trypsin for 5–10 min. Equal volumes of Dulbecco's modified Eagle's medium containing 10% FBS were used to terminate digestion. Subsequently, the cells were centrifuged at 75.55 × g for 5 min at 4°C and washed twice with PBS. The resuspended cells were agitated to form a homogenous single cell suspension and were adjusted to 109 cells/l. Subsequently, 10,000 cells were obtained from 0.5 ml cell suspension and analyzed using flow cytometry (FACSCalibur; BD Biosciences, Franklin Lakes, CA, USA), and the average intensity of forward scatter (FSC) was calculated (8). Light scattering was generated when a single line of cells ejected from the nozzle of the flow cytometer was exposed to laser irradiation. The channel numbers of the average intensity of FSC were used to represent cell volume, as cell volume increased with the intensity of scattering light, or FSC intensity was proportional to cell volume.

Determination of cell osmotic fluid permeability (Pf) following gene silencing

The osmotic Pf of the cell represents the water trans-membrane transport capability driven by an osmotic gradient, and can directly reflect cell osmotic water transport function (9).

The Pf values were calculated using the following formula: Pf = [V0xd (V/V0)/dt] / [SxVWx(Osmin−Osmout)]; V = 4/3 × (area) × (area/π)½.

The area denotes the cell surface area, Osm denotes osmotic pressure, Osmin denotes intracellular osmotic pressure, Osmout denotes extracellular osmotic pressure. The Pf value was determined by the initial V/V0 time course ratio, d (V/V0)/dt; initial cell volume, V0 (cm3); initial cell surface area, S (cm2); and water molar volume, VW (18 mol/cm3).

The cell group assignment and harvesting methods were, as described above. The cells were transferred between PBS of 200 mOsm and 70 mOsm (diluted with deionized water) prior to microscopic image capture (IX53; Olympus Corporation, Tokyo, Japan) every 30 sec for 3 min. The cell area was calculated using Image-Pro 6.0 software (Media Cybernetics, Inc., Rockville, MD, USA) for imaging analysis. The cell volume and Pf values were calculated using the above formula.

Statistical analysis

SPSS software, version 13.0 (SPSS, Inc., Chicago, IL, USA) was used for statistical analysis. The independent t-test was used for comparisons of means between two samples. P<0.05 was considered to indicate a statistically significant difference.

Results

mRNA expression of AQP1 is decreased in A549 cells following gene silencing

The RT-qPCR analysis performed in the present study revealed a significant downregulation in the mRNA expression of AQP1 in the gene silencing group (P<0.01), when compared with that of the negative control group. The AQP1 mRNA inhibition rate was 75.5% (Fig. 1).

Figure 1

Changes in the relative mRNA expression levels of AQP1 subsequent to AQP1 gene silencing. The results of the RT-qPCR analysis demonstrated that the A549 cells were successfully transfected by AQP1-siRNA. For knockdown of the expression of AQP1, four pairs of sequences were used in the gene silencing group. Negative siRNA sequences were used as controls in the negative control group. At 48 h following transfection, the cells were harvested and analyzed. Subsequent RT-qPCR indicated that the the AQP1 mRNA inhibition rate was 75.5%. Data are presented as means ± standard deviation. **P<0.01, vs. negative control group. AQP1, aquaporin-1; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.

Protein expression of AQP1 decreases following A549 cell gene silencing

The results of the western blotting revealed a significant downregulation in the protein expression of AQP1 in the gene silencing group (P<0.01), compared with that of the negative control group. The inhibition rate of AQP1 protein was 81.5% (Fig. 2).

Figure 2

Protein expression of AQP1. (A) Changes in the relative protein expression levels of AQP1 subsequent to gene silencing. Data are presented as means ± standard deviation. **P<0.01, vs. negative control group. (B) Detection of the protein expression of AQP1 following RNA interference using western blotting. AQP1, aquaporin-1.

Changes in A549 cell volume following gene silencing

No significant difference in cell volume was observed at 24 or 48 h between the gene silencing group and negative control group when exposed to air (P>0.05), whereas the cell volume in the gene silencing group was significantly reduced, compared with that in the negative control group at 72 h (P<0.01; Fig. 3).

Figure 3

Changes in cell volume. (A) Cell volume of the two groups following gene silencing. Data are presented as means ± standard deviation. **P<0.01, vs. negative control group. Determination cell volumes in the AQP1 gene-silencing group exposed to air were determined using flow cytometry at (B) 24 h (purple, silencing group; blue, negative control group), (C) 48 h (pink, silencing group; blue, negative control group) and (D) 72 h (yellow, silencing group; blue, negative control group) following transfection. AQP1, aquaporin-1; FSC-H, forward scatter height.

Cell volume in the gene silencing group exposed to hyperoxia was significantly reduced, compared with the negative control group at 48 and 72 h (P<0.01), although no significant differences in cell volume were observed at 24 h (P>0.05; Fig. 4).

Figure 4

Changes in cell volume. (A) Cell volumes in the two hyperoxic groups following gene silencing. Data are presented as means ± standard deviation. **P<0.01, vs. negative control group. Determination of cell volumes in the AQP1 gene silencing group exposed to hyperoxia were determined using flow cytometry (B) 24 h (green, gene silencing group; red, negative control group), (C) 48 h (dark green, gene silencing group; light green, negative control group) and (D) 72 h (dark green, gene silencing group; light green, negative control group) following transfection. AQP1, aquaporin-1; FSC-H, forward scatter height.

Osmotic Pf following gene silencing

No significant differences were observed in the Pf values between the gene silencing group and negative control group exposed to air at 24 h (P>0.05). However, the Pf values of the gene silencing group were significantly reduced, compared with those of the negative control group at 48 and 72 h (P<0.01, Fig. 5).

Figure 5

Cell Pf value of the two groups exposed to air following aqua-porin-1 gene silencing. Data are presented as means ± standard deviation. **P<0.01, vs. negative control group. Pf, fluid permeability.

No significant difference were observed in the Pf values between the gene silencing group and negative control group exposed to hyperoxia at 24 h (P>0.05), however, the Pf values of the gene silencing group were reduced, compared with those of the negative control group at 48 and 72 h (P<0.01; Fig. 6).

Figure 6

Cell Pf valued of the two groups exposed to hyperoxia following aquaporin-1 gene silencing. Data are presented as means ± standard deviation. **P<0.01, vs,. negative control group. Pf, fluid permeability.

Discussion

The AQP family is a group of small, hydrophobic trans-membrane proteins, of which the monomers are 26–34 kDa in size. AQPs are selectively permeable to water at a velocity of 100–200×10−6 m.s−1, which is 109-fold higher than normal diffusion velocity (10). At present, 13 AQPs (AQP0-12) have been identified, which are observed in all life forms, including humans, animals, plants, bacteria and yeasts (11). Currently, the expression of six AQPs, including AQP1, AQP3, AQP4, AQP5, AQP8 and AQP9, have been identified in lung tissues (12).

AQPs are important in maintaining the water equilibrium between alveoli and capillaries. AQP1 is expressed in lung endothelial and epithelial cells and regulates water transport, being important in a number of edema-associated lung diseases (13,14). Lung injury resulting from multiple factors is accompanied by reductions in the expression and activities of AQP1. Towne et al (14) demonstrated that adenovirus infection resulted in pneumonia, pulmonary edema and downregulation of AQP1 in lung tissues. It has also been reported that the trans-membrane fluid transportation capacity mediated by AQP in lung tissues is reduced by 43% in mice following exposure to 100% oxygen for 5 days (15), with reductions in the expression or activity of AQP1 observed. The mRNA expression levels of AQP1 and AQP4 have been found to be downregulated in allergen-induced mouse models of asthma (16). In addition, reduced expression levels of lung AQP1 and AQP5 may be associated with the development of pulmonary edema and increased severity of lung injury and pulmonary edema, which provides an additional mechanism for pancreatitis-associated lung injury (17). It has also been observed that impaired alveolar fluid clearance rate is the predominant manifestation in lipopolysaccharide-induced acute lung injury, and symptoms can be relieved through dopamine-induced upregulation in the expression levels of AQP1 and AQP5, and subsequent enhancement of alveolar fluid reabsorption (18). Qi et al (2) reported that limb ischemia-reperfusion-induced lung injury was accompanied by upregulation of the toll-like receptor 4-myeloid differentiation primary response protein 88-nuclear factor κB pathway and downregulation of the expression of AQP1/AQP5. Ventilation with a large tidal volume results in the production of inflammatory mediators and the downregulation of AQP1, which can be attenuated by the inhibition of cyclooxygenase-2 (19). Gao et al (20) observed that the Chinese medicine, Qing Yi Tang, protects the lungs from injury induced by severe acute pancreatitis via the upregulation of AQP1, which suppresses the expression of tumor necrosis factor α.

Experiments have revealed that, compared with wild-type mice, water permeability between the alveoli and the capillaries in AQP1-knockout mice was reduced 10-fold (21). King et al (22) reported that the airway wall was unchanged following saline perfusion in the congenital absence of AQP1, whereas the wall was thickened by 50% in normal airways.

However, upregulation in the expression of AQP1 in lung injury has been observed in previous studies. In a study by Li et al (23), results from RT-qPCR and western blotting indicated that intratracheal installation of seawater upregulated the mRNA and protein levels of AQP1 and AQP5 in lung tissues. Lai et al (24) observed that inflammatory factors were able to stimulate the expression of AQP1 in cell models, and Song et al (25) used transgenic technology and observed that AQP1-, AQP4- and AQP5-knockout in mice had no effects on pulmonary edema or pleural effusion formation, or on the clearance of lung fluid in acute lung injury of neonatal mice. The underlying pathology of early phase pulmonary edema in hyperoxic lung injury had been confirmed (26). The present study hypothesized that hyperoxia results in the downregulation of AQP1 on the type II alveolar epithelial cell (AEC-II) membrane, affecting alveolar water transport and clearance. In order to confirm this, an RNAi technique was used to determine the roles of AQP1 in extracellular water transport by silencing the gene expression of AQP1, and to assist in elucidating the mechanism of impaired alveolar fluid clearance in lung edema. As A549 cells and AEC-II share similar structure and function (27), in the present study A549 cells were used as they multiply more rapidly and are easy to obtain, rather than pulmonary epithelial cells.

RNAi refers to the phenomenon of specific degradation of homologous mRNA, resulting from exogenous or endogenous small double-stranded RNA and subsequent post-transcriptional gene silencing in an organism (28). RNAi as a novel gene disruption technique, which has become an important tool in investigating gene function due to its advantages, including high specificity, high efficacy, high stability and low toxicity (29).

In the present study, the extracellular to intracellular fluid transportation capacity was attenuated following AQP1-silencing, as the cell volume was reduced in the transfection group exposed to air and hyperoxia, compared with that in the negative control group at 72 h. Reduced osmotic water permeability and impaired water transport function following AQP1 gene silencing were also observed. In addition, the Pf values were reduced in the gene silencing group, compared with the negative control group at 48 and 72 h, in exposure to air or hyperoxia. These results indicated that AQP1 is important in fluid transport in A549 cells. Combined with the findings of previous studies, these changes may be correlated with the downregulation of AQP1 induced by hyperoxia, and weakened fluid transportation function (5,18). Therefore, the downregulation of AQP1 induced by hyperoxia in A549 cells impaired the fluid transportation function of the cell membrane and reduced alveolar fluid clearance, which may be one of the important causal factors responsible for lung edema during the acute phase of hyperoxic lung injury.

Acknowledgments

The authors would like to thank the Experimental Center of China Medical University Affiliated Shengjing Hospital for the guidance and assistance provided. The present study was supported by the National Natural Science Foundation of China (grant no. 30872781) and the Scientific Research Fund of the First Affiliated Hospital of Harbin Medical University (grant no. 2013B18).

References

1 

Chang LW: Part of China's urban premature incidence of bronchial pulmonary dysplasia and risk factors. In: The 9th national neonatal meeting; 2009

2 

Qi QY, Chen W, Li XL, Wang YW and Xie XH: H2S protecting against lung injury following limb ischemia-reperfusion by alleviating inflammation and water transport abnormality in rats. Biomed Environ Sci. 27:410–418. 2014.PubMed/NCBI

3 

Elias AS, Oliveira GP, Ornellas DS, Morales MM, Capelozzi VL, Haddad R, Pelosi P, Rocco PR and Garcia CS: Effects of early and late pneumothorax drainage on the development of pulmonary oedema. Respir Physiol Neurobiol. 195:27–36. 2014. View Article : Google Scholar : PubMed/NCBI

4 

Wang Q, Ishikawa T, Michiue T, Zhu BL, Guan DW and Maeda H: Molecular pathology of pulmonary edema after injury in forensic autopsy cases. Int J Legal Med. 126:875–882. 2012. View Article : Google Scholar : PubMed/NCBI

5 

Zhang QY, Fu JH and Xue XD: Expression and function of aquaporin-1 in hyperoxia-exposed alveolar epithelial type II cells. Exp Ther Med. 8:493–498. 2014.PubMed/NCBI

6 

Lecuona E, Trejo HE and Sznajder JI: Regulation of Na, K-ATPase during acute lung injury. J Bioenerg Biomembr. 39:391–395. 2007. View Article : Google Scholar : PubMed/NCBI

7 

Winer J, Jung CK, Shackel I and Williams PM: Development and validation of real-time quantitative reverse transcriptase- polymerase chain reaction for monitoring gene expression in cardiac myocytes in vitro. Anal Biochem. 270:41–49. 1999. View Article : Google Scholar : PubMed/NCBI

8 

Jordan CT, Yamasaki G and Minamoto D: High-resolution cell cycle analysis of defined phenotypic subsets within primitive human hematopoietic cell populations. Exp Hematol. 24:1347–1355. 1996.PubMed/NCBI

9 

Preston GM, Carroll TP, Guggino WB and Agre P: Appearance of water channels in Xenopus oocytes expressing red cell CHIP28 protein. Science. 256:385–387. 1992. View Article : Google Scholar : PubMed/NCBI

10 

Verkman AS: Physiological importance of aquaporin water channels. Ann Med. 34:192–200. 2002. View Article : Google Scholar : PubMed/NCBI

11 

Itoh T, Rai T, Kuwahara M, Ko SB, Uchida S, Sasaki S and Ishibashi K: Identification of a novel aquaporin, AQP12, expressed in pancreatic acinar cells. Biochem Biophys Res Commun. 330:832–838. 2005. View Article : Google Scholar : PubMed/NCBI

12 

Borok Z and Verkman AS: Lung edema clearance: 20 years of progress: Invited review: Role of aquaporin water channls in fluid transport in lung and airways. J Appl Physiol (1985). 93:2199–2206. 2002. View Article : Google Scholar

13 

Jiao GY, Li ER and Yu R: Decreased expression of AQP1 and AQP5 in acute injured lungs in rats. Chin Med J (Engl). 155:963–967. 2002.

14 

Towne JE, Harrod KS, Krane CM and Menon AG: Decreased expression of aquaporin (AQP)1 and AQP5 in mouse lung after acute viral infection. Am J Respir Cell Mol Biol. 22:34–44. 2000. View Article : Google Scholar

15 

Matthay MA, Folkesson HG and Clerici C: Lung epithelial fluid transport and the resolution of pulmonary edema. Physiol Rev. 82:569–600. 2002. View Article : Google Scholar : PubMed/NCBI

16 

Krane CM, Deng B, Mutyam V, McDonald CA, Pazdziorko S, Mason L, Goldman S, Kasaian M, Chaudhary D, Williams C and Ho MW: Altered regulation of aquaporin gene expression in allergen and IL-13-induced mouse models of asthma. Cytokine. 46:111–118. 2009. View Article : Google Scholar : PubMed/NCBI

17 

Wang F, Huang H, Lu F and Chen Y: Acute lung injury and change in expression of aquaporins 1 and 5 in a rat model of acute pancreatitis. Hepatogastroenterology. 57:1553–1562. 2010.

18 

Wu XM, Wang HY, Li GF, Zang B and Chen WM: Dobutamine enhances alveolar fluid clearance in a rat model of acute lung injury. Lung. 187:225–231. 2009. View Article : Google Scholar : PubMed/NCBI

19 

Jin LD, Wang LR, Wu LQ, Shan YL, Zhao XY, Xiong XQ, Zhou JH, Lin LN and Jin LL: Effects of COX-2 inhibitor on ventilator-induced lung injury in rats. Int Immunopharmacol. 16:288–295. 2013. View Article : Google Scholar : PubMed/NCBI

20 

Gao Z, Xu J, Sun D, Zhang R, Liang R, Wang L and Fan R: Traditional Chinese medicine, Qing Ying Tang, ameliorates the severity of acute lung injury induced by severe acute pancreatitis in rats via the upregulation of aquaporin-1. Exp Ther Med. 8:1819–1824. 2014.PubMed/NCBI

21 

Song Y, Ma T, Mathay MA and Verkman AS: Role of aquaporin-4 in airspace-to-capillary water permeability in intact mouse lung measured by a novel gravimetric method. J Gen Physol. 155:17–27. 2000.

22 

King LS, Nielsen S, Agre P and Brown RH: Decreased pulmonary vascular permeability in aquaporin-1-null humans. Proc Natl Acad Sci USA. 99:1059–1063. 2002. View Article : Google Scholar : PubMed/NCBI

23 

Li J, Xu M, Fan Q, Xie X, Zhang Y, Mu D, Zhao P, Zhang B, Cao F, Wang Y, et al: Tanshinone IIA ameliorates seawater exposure-induced lung injury by inhibiting aquaporins (AQP) 1 and AQP5 expression in lung. Respir Physiol Neurobiol. 176:39–49. 2011. View Article : Google Scholar : PubMed/NCBI

24 

Lai KN, Leung JC, Metz CN, Lai FM, Bucala R and Lan HY: Role for macrophage migration inhibitory factor in acute respiratory distress syndrome. J Pathol. 199:496–508. 2003. View Article : Google Scholar : PubMed/NCBI

25 

Song Y, Fukuda N, Bai C, Ma T, Matthay MA and Verkman AS: Role of aquaporins in alveolar fluid clearance in neonatal and adult lung and in oedema formation following acute lung injury: Studies in transgenic aquaporin null mice. J Physiol. 525:771–779. 2000. View Article : Google Scholar

26 

Modi N: Clinical implications of postnatal alterations in body water distribution. Semin Neonatol. 8:301–306. 2003. View Article : Google Scholar

27 

Chen F, Zhang C, Jia X, Wang S, Wang J, Chen Y, Zhao J, Tian S, Han X and Han L: Transcriptome profiles of human lung epithelial cells A549 interacting with aspergillus fumigatus by RNA-Seq. PLoS One. 10:e01357202015. View Article : Google Scholar : PubMed/NCBI

28 

Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE and Mello CC: Potent and spectific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391:806–811. 1998. View Article : Google Scholar : PubMed/NCBI

29 

Aagaard L and Rossi JJ: RNAi therapeutics: Principles, prospects and chanllenges. Adv Drug Deliv Rev. 59:75–86. 2007. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhang Q, Fu J and Xue X: Inhibition of the expression of aquaporin‑1 by RNA interference in pulmonary epithelial cells and its effects on water transport. Mol Med Rep 13: 281-286, 2016.
APA
Zhang, Q., Fu, J., & Xue, X. (2016). Inhibition of the expression of aquaporin‑1 by RNA interference in pulmonary epithelial cells and its effects on water transport. Molecular Medicine Reports, 13, 281-286. https://doi.org/10.3892/mmr.2015.4519
MLA
Zhang, Q., Fu, J., Xue, X."Inhibition of the expression of aquaporin‑1 by RNA interference in pulmonary epithelial cells and its effects on water transport". Molecular Medicine Reports 13.1 (2016): 281-286.
Chicago
Zhang, Q., Fu, J., Xue, X."Inhibition of the expression of aquaporin‑1 by RNA interference in pulmonary epithelial cells and its effects on water transport". Molecular Medicine Reports 13, no. 1 (2016): 281-286. https://doi.org/10.3892/mmr.2015.4519
Copy and paste a formatted citation
x
Spandidos Publications style
Zhang Q, Fu J and Xue X: Inhibition of the expression of aquaporin‑1 by RNA interference in pulmonary epithelial cells and its effects on water transport. Mol Med Rep 13: 281-286, 2016.
APA
Zhang, Q., Fu, J., & Xue, X. (2016). Inhibition of the expression of aquaporin‑1 by RNA interference in pulmonary epithelial cells and its effects on water transport. Molecular Medicine Reports, 13, 281-286. https://doi.org/10.3892/mmr.2015.4519
MLA
Zhang, Q., Fu, J., Xue, X."Inhibition of the expression of aquaporin‑1 by RNA interference in pulmonary epithelial cells and its effects on water transport". Molecular Medicine Reports 13.1 (2016): 281-286.
Chicago
Zhang, Q., Fu, J., Xue, X."Inhibition of the expression of aquaporin‑1 by RNA interference in pulmonary epithelial cells and its effects on water transport". Molecular Medicine Reports 13, no. 1 (2016): 281-286. https://doi.org/10.3892/mmr.2015.4519
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team