Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
February-2016 Volume 13 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2016 Volume 13 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

MicroRNA‑200a mediates nasopharyngeal carcinoma cell proliferation through the activation of nuclear factor‑κB

  • Authors:
    • Zhuliang Shi
    • Zhiqiang Hu
    • Delu Chen
    • Jie Huang
    • Jie Fan
    • Subo Zhou
    • Xin Wang
    • Jiandao Hu
    • Fei Huang
  • View Affiliations / Copyright

    Affiliations: Department of Ear, Nose and Throat, People's Liberation Army 113th Hospital, Ningbo, Zhejiang 315000, P.R. China, Department of Ear, Nose and Throat, Yinzhou Hospital Affiliated to The Medical School of Ningbo University, Ningbo, Zhejiang 315000, P.R. China, Department of Stomatology, People's Liberation Army Navy General Hospital, Beijing 100048, P.R. China
  • Pages: 1732-1738
    |
    Published online on: December 30, 2015
       https://doi.org/10.3892/mmr.2015.4738
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

In nasopharyngeal carcinoma (NPC), the nuclear factor‑κB (NF‑κB) signaling pathway is highly active. The constitutive activation of NF‑κB prompts malignant cell proliferation, and microRNAs are considered an important mediator in regulating the NF‑κB signaling pathway. The current study investigated the effect of microRNA‑200a (miR‑200a) on NF‑κB activation. Reverse transcription‑quantitative polymerase chain reaction was used to quantify the relative level of miR‑200a in NPC tissue samples and CNE2 cells. An MTT assay was used to investigate the effect of miR‑200a on cell proliferation. To investigate the activation of NF‑κB, western blotting was used to measure the protein levels of NF‑κB and its downstream targets. To identify the target genes of miR‑200a, a luciferase reporter assay was used. The current study demonstrated that miR‑200a was upregulated in NPC tissue samples and cell lines. Overexpression of miR‑200a resulted in the proliferation of CNE2 cells. Western blot analysis indicated that the protein levels of p65 increased when CNE2 cells were transfected with miR‑200a mimics. Additionally, the downstream targets of miR‑200a were upregulated, including vascular cell adhesion molecule, intercellular adhesion molecule and monocyte chemoattractant protein‑1. The luciferase assay indicated that IκBα was the target gene of miR‑200a. In conclusion, miR‑200a was demonstrated to enhance NPC cell proliferation by activating the NF‑κB signaling pathway.

Introduction

As a squamous cell carcinoma, nasopharyngeal carcinoma (NPC) is derived from the epithelium of the nasopharynx. Compared with the rest of the world, the incidence of NPC in China is high (1), and therefore is a serious public health problem in China. In regions covered by the cancer registries in 2009, the crude incidence of NPC was 3.61/100,000 (5.08/100,000 in males and 2.10/100,000 in females; 4.19/100,000 in urban areas and 2.42/100,000 in rural areas) (1). Due to the high incidence of early metastasis, the rate of mortality is high in patients with NPC. At present, radiotherapy is the first choice of therapy for patients with NPC. However, despite improvements in the standards of radiotherapy, the five-year survival rate remains to be ~50–60% (2). Therefore, it is important for clinicians and researchers to develop novel effective treatment strategies.

The transcription factor nuclear factor-κB (NF-κB) consists of 5 subunits; Rel (cRel), p65 (RelA, NF-κB3), RelB, p50 (NF-κB1) and p52 (NF-κB2) (3), and the two most common dimers of NF-κB are p65 and p50 (3). In unstimulated cells, inhibitory κB (IκB) is bound to NF-κB, which remains in an inactive form in the cytoplasm (3). When cells are stimulated by extracellular signals, IκB kinase complex (IKK) phosphorylates IκB, exposing the nuclear localization sites of NF-κB (3). Subsequently the free NF-κB translocates into the nucleus where it binds with specific κB sequences, inducing gene transcription (3). Previous histological studies have indicated the importance of local inflammation in NPC tumorigenesis (4). As a key inflammatory signaling pathway, NF-κB has been demonstrated to be constitutively active in NPC tissue by immunohistochemical staining (4). The constitutive activation of NF-κB commonly results in malignant carcinoma cell proliferation in various types of cancer cells and tissues, as the NF-κB signaling pathway regulates a series of target genes involved in cell proliferation, apoptosis, immune responses and transcription (5).

MicroRNAs (miRNAs) are small non-coding RNAs of 20–25 nucleotides. miRNAs negatively regulate gene expression by recognizing complementary sequences in the 3′-untranslated regions (UTR) of target mRNAs, resulting in their degradation (6). In previous studies, the aberrant expression of miRNAs has been associated with various types of human cancer (7,8). In addition, as an important mediator, miRNAs are accepted as key modulators and effectors of the NF-κB signaling pathway. For example, miR-146a and miR-146b negatively interact with interleukin-1 receptor-associated kinase 1 and tissue necrosis factor receptor-associated factor 6 protein levels, resulting in the activation of NF-κB (9). Furthermore, miR-199a has been demonstrated to suppress IKKβ, which reduces the activity of NF-κB signaling (10), whilst miR-200a has been reported to regulate various signaling pathways through targeting different genes, including epidermal growth factor receptor, c-Met and ephrin type-A receptor 1 (11,12).

In the current study, the relative expression levels of miR-200a were investigated in human NPC. In addition, the impact of increased miR-200a levels on NPC cell proliferation and migration was explored. The present study aimed to elucidate the effect of miR-200a on NPC cell proliferation and the role of the NF-κB signaling pathway in this process.

Materials and methods

Human samples and cell lines

A total of 40 samples of primary human NPC and 30 normal samples were collected at the People's Liberation Army 113th hospital (Ningbo, China) and written informed consent was obtained from all patients. Clinical information was obtained by reviewing the medical records on radiographic images, by telephone or written correspondence, and by reviewing death certificates. All specimens had confirmed pathological diagnosis and were staged according to the 1992 NPC staging system of China (13). The NPC cell lines (HNE1, CNE1 and CNE2) and an immortalized nasopharyngeal epithelial cell line (NP69) were purchased from the American Type Culture Collection (Manassas, VA, USA) and cultured in Eagle's minimum essential medium (MEM; GE Healthcare Life Sciences, Logan, UT, USA) with 10% fetal bovine serum(FBS; GE Healthcare Life Sciences). The HEK293T cells were cultured in 2 ml Dulbecco's modified Eagle's medium (GE Healthcare Life Sciences) supplemented with 100 U/ml penicillin (Beijing SolarBio Science & Technology Co., Ltd., Beijing, China, Beijing, China), 100 U/ml streptomycin and 10% FBS.

Tumor necrosis factor-α (TNF-α) treatment

CNE2 cells were seeded in the six-well plate at the concentration of 1×106 cells/well. After 24 h, the CNE2 cells were treated with 10 ng/ml TNFα for 48 h. The relative levels of miR-200a were then determined.

Transient transfection procedures

Shortly prior to transfection, 1.5×105 cells were seeded per well in a 6-well plate in 2 ml Dulbecco's modified Eagle's medium containing serum and supplemented with 100 U/ml penicillin and 100 U/ml streptomycin. Prior to transfection, the cells were incubated under normal growth conditions (typically 37°C and 5% CO2). Subsequently, miR-200a mimics, miR-200a inhibitor or the miR negative control (Shanghai Genepharma Co., Ltd., Shanghai, China) were pre-incubated with HiPerFect transfection reagent (Qiagen China Co., Ltd., Shanghai, China) with the final concentration of microRNA analogues at 100 nmol/l. The sequence of miR-200a was as follows: 5′-CAGUGCAAUAGUAUUGUCAAAGC-3′.

siRNA transfection

Specific siRNA targeting p65 was purchased from Shanghai Jima Co. (Shanghai, China). The siRNAs were transfected into the cells using Vigofect transfection reagent (Vigorous Biotechnology Beijing Co., Ltd., Beijing, China).

RNA extraction

Total RNA (2 µg) was extracted from cell lines and human samples (5 mg) with TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer's instructions.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

In order to detect and quantify mature miRNA-200a, a TaqMan MicroRNA Reverse Transcription kit and a TaqMan MicroRNA Assay were used according to the manufacturer's instructions (Applied Biosystems Life Technologies, Foster City, CA, USA). U6 RNA was used for normalization. To quantify miRNA levels, 10 ng total RNA was reverse transcribed using TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems Life Technologies) with specific primers for miR-200a and U6. Subsequently, the PCR amplifications were performed in 20 µl reaction volume containing 10 µg TaqMan 2X Universal PCR Master Mix, 1 µl 20X TaqMan MicroRNA Assay mix (Applied Biosystems Life Technologies) and 1.33 µl template cDNA in the same system used for mRNA quantification. The thermal cycling conditions were as follows: 95°C for 10 min, followed by 40 cycles at 95°C for 15 sec and 60°C for 1 min. Relative miRNA expression of miR-200a was normalized against the endogenous control, U6 RNA, using the comparative 2−ΔΔCt method (14). CFX Manager™ software (Bio-Rad Laboratories, Inc., Hercules, CA, USA) was used for quantification analysis for mRNA and miRNA. For reverse transcription, the specific primers are listed, as follows: (5′-3′): miR-200a, CUGGAUUUCCCAGCUUGACUCUAACACUGUCUGGUAACGAUGUUCAAAGGUGACCCGC; U6, GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAATATG. The primers used for qPCR were as follows (5′-3′): miR-200a forward, GCAAAGTGCATCCATTTTGTTTGT; U6 forward, GCGCGTCGTGAAGCGTTC; universal reverse primer, GTGCAGGGTCCGAGGT.

Protein extraction, western blotting and antibodies

Cellular proteins were extracted using RIPA buffer [50 mM Tris/HCl, pH 7.4, 150 mM NaCl, 1% (v/v) NP-40, 0.1% (w/v) SDS; Beijing SolarBio Science & Technology Co., Ltd.) containing 1% (v/v) phenylmethanesulfonylfluoride (Beijing SolarBio Science & Technology Co., Ltd.), 0.3% (v/v) protease inhibitor (Sigma-Aldrich, St. Louis, MO, USA) and 0.1% (v/v) phosphorylated proteinase inhibitor (Sigma-Aldrich). Lysates were centrifuged at 13,000 g at 4°C for 15 min and the supernatant was collected for total protein analysis. A bicinchoninic acid protein assay kit (Pierce Biotechnology, Inc., Rockford, IL, USA) was used to determine the protein concentration. Equal amounts of protein (15 µg) were separated on an SDS-PAGE gel [10% (v/v) polyacrylamide; Beijing SolarBio Science & Technology Co., Ltd.] and transferred onto a polyvinylidene fluoride membrane (Merck Millipore, Darmstadt, Germany). Nonspecific binding was blocked using 8% (w/v) milk in Tris-buffered saline-Tween 20 (TBST) for 2 h at room temperature. The membranes were incubated with primary antibodies against β-actin (8H10D10; mouse monoclonal; cat. no. 3700; 1:3,000, Cell Signaling Technology, Inc., Danvers, MA, USA), NF-κB p65 (D14E12) XP® Rabbit mAb (cat. no. 8242; 1:1,000; Cell Signaling Technology, Inc.), NF-κB1 p105/p50 antibody (cat. no. 3035; 1:1,000; Cell Signaling Technology, Inc.), Cox2 (D5H5) XP® rabbit mAb (cat. no. 12282; 1:1,000; Cell Signaling Technology, Inc.), MMP-2 (D8N9Y) rabbit mAb (cat. no. 13132; 1:1,000; Cell Signaling Technology, Inc.), human vascular endothelial growth factor-165 (cat. no. 8065; 1:1,000; Cell Signaling Technology, Inc.) Phosphorylated (p)-NF-κB p65 (Ser536; 93H1) rabbit mAb (cat. no. 3033; 1:1,000; Cell Signaling Technology, Inc.), ICAM-2 (D7P2Q) rabbit mAb (cat. no. 13355; 1:1,000, Cell Signaling Technology, Inc.), MCP-1 antibody (cat. no. 2027; 1:1,000; Cell Signaling Technology, Inc.) and IκBα (44D4) rabbit mAb (cat. no. 4812; 1:1,000; Cell Signaling Technology, Inc.) overnight at 4°C. Following three washes with TBST, the membranes were incubated in horseradish peroxidase (HRP)-conjugated goat anti-rabbit (cat. no. ZB-2307; 1:5,000; Zhongshan Gold Bridge Biotechnology Co., Ltd., Beijing, China) and anti-mouse (cat. no. ZB-2305 1:5,000; Zhongshan Gold Bridge Biotechnology, Co., Ltd.) or HRP-conjugated mouse anti-goat antibodies (cat. no. ZB-5305; Beijing Zhongshan Jinqiao Biotechnology Co., Ltd., Beijing, China; 1:5,000) for 2 h at room temperature and then washed with TBST three times (5 min each). The target proteins were subsequently visualized using enhanced chemiluminescence (EMD Millipore, Billerica, MA, USA) according to the manufacturer's instructions and quantified using density analysis with ImageJ 4.0 software (National Institutes of Health, Bethesda, MA, USA) normalized against β-actin, and expressed as the fold-change, compared with the control.

Luciferase target assay

TargetScan (http://www.targetscan.org/) was used to determine the potential binding sites of miR-200a on the 3′UTR of IκBα. For the luciferase assay, the 3′UTR of IκBα, including the binding site for miR-200a, was amplified from CNE2 cells using the following primers: IκBα-F, 5′-AAGGAGGAGGGCAGAATCAT-3′; IκBα-R, 5′-ATCTGCATGGTGATGTTGGA-3′.

The PCR product was digested with XbaI (New England Biolabs, Beverly, MA, USA) and cloned into the reporter plasmid pGL3 (Promega Corporation, Madison, WI, USA) downstream of the luciferase reporter gene. The modified firefly luciferase vector (500 ng/µl; Promega Corporation) was transfected into HEK293 cells (2×105 cells/ml; as previously described). Firefly and Renilla luciferase activities were measured 48 h following transfection with the Dual-Luciferase Reporter Assay System (Promega Corporation). Firefly activity was normalized to Renilla activity to control the transfection efficiency.

Dihydroethidium (DHE) staining

The cells were cultured in six-well chamber slides at a density of 1×106 cells/well, washed with PBS three times (5 min/wash) and incubated with ROS Fluorescent Probe-DHE (10 µM; Vigorous Biotechnology Beijing Co., Ltd.) in serum-free DMEM F-12 medium for 30 min at 37°C in the dark. Following incubation, the slides were fixed in 4% paraformaldehyde for 30 min at room temperature, were washed again and mounted. Immunofluorescence images were captured using fluorescence microscopy (Leica CM3000; Leica Microsystems GmbH, Wetzlar, Germany).

Dimethyl thiazolyl diphenyl tetrazolium (MTT) assay

To evaluate the effect of miR-200a on cell proliferation, cells were seeded 5,000 cells/well in 100 µl MEM in 96-well plates and transfected with miR-200a mimics (50 nM) and negative control-miRNA mimics (50 nM), as described above. At 24, 48 and 72 h post-transfection, 20 µl MTT reagent (Beijing SolarBio Science & Technology Co., Ltd.) was added to the wells, which were then incubated for 4 h at 37°C. Following removal of the medium, 200 µl dimethyl sulfoxide was added to dissolve the formazan and the absorbance was measured at 550 nm. Wells containing only CNE2 cells, which served as blanks.

Statistical analysis

Data are presented as the mean ± standard error from 3 independent experiments. Statistical analysis was conducted with Student's t-test using GraphPad Prism 5 software (National Institutes of Health). P<0.05 was considered to indicate a statistically significant difference.

Results

miR-200a is upregulated in human NPC cells and tissue samples

The relative levels of miR-200a in human NPC cells and tissue samples were measured in human NPC cells and patient tissue samples using RT-qPCR. Compared with NP69 immortalized nasopharyngeal epithelial cells, miR-200a levels were increased by greater than 2.38-fold in HNE1, CNE1 and CNE2 human NPC cells, and miR-200a expression levels were normalized to U6 (P<0.05; Fig. 1A). The expression levels of miR-200a were measured in 40 human NPC cancer specimens compared with 30 normal tissue samples. Compared with the normal tissue, the mean expression level of miR-200a was increased by greater than 3-fold (P<0.05; Fig. 1B). This indicated that miR-200a was significantly increased in the human NPC cells and tumor tissue.

Figure 1

Expression levels of miR-200a in human NPC cells and tissue samples. (A) Reverse transcription-quantitative polymerase chain reaction analysis of miR-200a expression in HNE1, CNE1 and CNE2 human NPC cells and NP69 immortalized nasopharyngeal epithelial cells. (B) Analysis of miR-200a expression in 40 human NPC tissue samples (Tumors) and paired nontumor tissue samples (Nontumors). U6 was used as an endogenous control. *P<0.05, vs. NP69. miR-200a, microRNA-200a, NPC, nasopharyngeal carcinoma.

Downregulation of miR-200a increases CNE2 cell viability

In order to investigate the effect of miR-200a on CNE2 cell viability, CNE2 cells were transfected with miR-200a mimics, miR-200a inhibitors or the negative control for 24, 48 and 72 h. In the current study, the mimics were analogues that enhanced miR-200a expression levels while inhibitors were analogues that reduced the expression of miR-200a. The MTT assay indicated that when miR-200a mimics were transfected into CNE2 human NPC cells, cell viability was significantly decreased by 23 and 35% at 48 and 72 h, respectively (Fig. 2A). However, when miR-200a expression was inhibited, cell viability was enhanced by 17 and 36% at 48 and 72 h, respectively (Fig. 2B). These results indicated that miR-200a may increase CNE2 cell viability.

Figure 2

CNE2 human NPC cell viability was altered by miR-200a. CNE2 cells were transfected with (A) miR-200a mimics, (B) miR-200a inhibitors or the negative control for 24, 48 and 72 h. Cell viability was measured using an MTT assay. Data represent the mean ± standard error, n=6 independent experiments. *P<0.05 vs. NC. NPC, nasopharyngeal carcinoma; miR-200a, microRNA-200a; NC, negative control; OD, optical density.

miR-200a activates the NF-κB signaling pathway

In NPC, the NF-κB signaling pathway is constitutively activated (15). In the current study, CNE2 cells were treated with 10 ng/µl TNF-α for 48 h, following which the relative levels of miR-200a were measured. As presented in Fig. 3A, the relative level of miR-200a was increased by greater than 4.8-fold with TNF-α treatment. To address whether miR-200a contributes to NF-κB activation, CNE2 cells were transfected with miR-200a mimics. Western blot analysis indicated that when miR-200a was overexpressed, NF-κB was significantly activated. As presented in Fig. 3, compared with the negative control, the p-NF-κB/NF-κB ratio was increased by greater than 2.36-fold (Fig. 3B). Vascular cell adhesion molecule (VCAM), intercel-lular adhesion molecule (ICAM) and monocyte chemoattractant protein-1 (MCP-1) are important adhesion molecules that are aberrantly increased in various types of cancer (16). To further investigate the alterations in NF-κB activation, the protein levels of VCAM, ICAM and MCP-1 were measured. As presented in Fig. 3B, the relative levels of VCAM, ICAM and MCP-1 were significantly increased. Together, these data indicate that miR-200a contributed to TNF-α-stimulated NF-κB activation. To investigate the effect of NF-κB on cell proliferation, a small interfering RNA (siRNA) targeting NF-κB was used. Following treatment with the siRNA against NF-κB, the protein levels of NF-κB were reduced, as were the expression levels of VCAM, ICAM and MCP-1. Additionally, this effect was observed in the cells transfected with miR-200a mimics (Fig. 3C). VCAM was increased by 2.1-fold following the addition of mimics, although the reduction in MCP-1 was less marked. Furthermore, as presented in Fig. 3D, with NF-κB knockdown, cell viability was significantly reduced even in the cells transfected with miR-200a mimics. These data suggest that miR-200a enhances cell proliferation through the activation of the NF-κB signaling pathway.

Figure 3

NF-κB signaling pathway activation with overexpression of miR-200a in CNE2 cells. (A) Reverse transcription-quantitative polymerase chain reaction was used to measure the relative levels of miR-200a when CNE2 cells were treated with 10 ng/µl TNFα for 48 h. (B) Western blot analysis of NF-κB activation and its downstream regulators following miR-200a overexpression. (C) Western blot analysis of an short interfering RNA targeting NF-κB. (D) MTT assay indicated a reduced rate of cell proliferation in cells cotransfected with si-NF-κB and miR-200a mimics. Data represent the mean ± standard error, n=3 independent experiments. *P<0.05 vs. control. NF-κB, nuclear factor-κB; miR-200a, microRNA-200a; TNFα, tissue necrosis factor α; si-NF-κB, short interfering NF-κB; Con, control; p-NF-κB, phosphorylated NF-κB; VCAM, vascular cell adhesion molecule; ICAM, intercellular adhesion molecule; MCP-1, monocyte chemoattractant protein-1.

IκBα is the host gene of miR-200a

To further investigate whether NF-κB was activated by miR-200a overexpression, immunofluorescence was used. As presented in Fig. 4A, increased NF-κB (p65) protein levels were observed when CNE2 cells were transfected with miR-200a mimics. In previous studies, numerous miRNAs have been reported to activate NF-κB, for instance, miR-200a targeted NF-κB-repressing factor and correlated with altered NF-κB activation (17,18). In the current study, the target gene of miR-200a was identified using a bio-informatics database. TargetScan predicted miR-200a to target position 356–362 in the 3′UTR in IκBα (Fig. 4B). IκB is an NF-κB inhibitory protein, which in unstimulated cells is bound to p65 and P50, resulting in the inactivation of NF-κB in the cytoplasm (19). Following the activation of IKK, IκBα is degraded and the two subunits of NF-κB translocate from the cytoplasm to the nucleus, thereby inducing the downstream signaling pathway (20). Therefore, the effect of miR-200a on IκBα expression was investigated. When CNE2 cells were transfected with miR-200a mimics for 4 h, the expression levels of IκBα were significantly reduced compared with the negative control (Fig. 4B). Furthermore, 48 h following transfection with miR-200a in CNE2 cells, the expression level of IκBα was reduced by 56%. However, when miR-200a was inhibited in CNE2 cells, the expression level of IκBα was increased by almost 1-fold (Fig. 4C). A luciferase reporter assay was used to investigate the effect of miR-200a on the 3′-UTR of IκBα, and indicated that miR-200a significantly reduced IκBα-3′-UTR-luciferase reporter activity (Fig. 4D). These data indicated that miR-200a induced NF-κB activation, predominantly by targeting IκBα in the human NPC cells.

Figure 4

miR-200a targets IκBα in CNE2 cells. (A) Immunofluorescence analysis of NF-κB expression in CNE2 cells following transfection with miR-200a inhibitors or the negative control. (B) Western blot analysis of IκBα, following transfection of CNE2 cells with (B) miR-200a mimics, (C) miR-200a inhibitors and the negative control. (D) A luciferase reporter assay was used to investigate the effect of miR-200a on IκBα-3′-UTR. Data are presented as the mean ± standard error, n=3 independent experiments. *P<0.05 vs. control. miR-200a, microRNA-200a; IκB, inhibitory κB; NF-κB, nuclear factor-κB; UTR, untranslated region; NC, negative control, NKRF, NF-κB repressing factor.

Discussion

MicroRNAs have been widely demonstrated to regulate various cellular processes, in particular cancer development and progression (21). NPC is common in men and women and several studies have indicated abnormal miRNA levels in NPC (22,23). The current study reported that miR-200a was upregulated in CNE2 human NPC cells and suggests an oncogenic role for miR-200a in NPC progression.

In order to investigate the association between miR-200a and human NPC, the relative levels of miR-200a were measured in human NPC cells and tissue samples. This indicated that miR-200a was upregulated in human NPC. Furthermore, the MTT assay demonstrated that miR-200a is able to activate CNE2 cell proliferation. TNF-α treatment was observed to induce increased expression of miR-200a, with a 4-fold increase in CNE2 cells. In addition, NF-κB was activated when CNE2 cells were transfected with miR-200a mimics for 48 h, and upregulation of the downstream regulators of NF-κB signaling was observed, including that of VCAM, ICAM and MCP-1. The activation of the NF-κB signaling pathway was further validated via the investigation of the relative levels of IκBα using western blotting and a luciferase reporter assay. Together, these data indicated that miR-200a induced NF-κB activation through the targeting IκBα.

Dysregulation of the NF-κB signaling pathway is well characterized in cancer cell proliferation, angiogenesis, migration and invasion (24,25); NF-κB signaling has been observed to be significantly activated in glioma, and the NF-κB pathway has been reported to significantly induce cancer cell proliferation and invasion in thyroid cancer. The current study provided further evidence of NF-κB activation in human NPC and investigated the association with miR-200a. These data indicated that NF-κB and its downstream regulator proteins were positively regulated by miR-200a. In addition, the current study demonstrated that IκBα is a target gene for miR-200a. IκBα has been demonstrated to repress NF-κB translation through binding with specific negative regulatory elements (26).

In conclusion, increased levels of miR-200a were observed in the current study in human NPC tissue samples and cell lines. In addition, miR-200a was demonstrated to enhance the proliferation of CNE2 cells. Furthermore, miR-200a activated the NF-κB signaling pathway through targeting IκBα, a negative regulator of NF-κB.

Acknowledgments

This study was supported by grants from the National Natural Science Foundation of Ningbo (grant nos. 2013A610215 and 2014A610230).

References

1 

Xu ZJ, Zheng RS, Zhang SW, Zou XN and Chen WQ: Nasopharyngeal carcinoma incidence and mortality in China in 2009. Chin J Cancer. 32:453–460. 2013. View Article : Google Scholar : PubMed/NCBI

2 

Zhou W, Feng X, Ren C, Jiang X, Liu W, Huang W, Liu Z, Li Z, Zeng L, Wang L, et al: Overexpression of BCAT1, a c-Myc target gene, induces cell proliferation, migration and invasion in nasopharyngeal carcinoma. Mol Cancer. 12:532013. View Article : Google Scholar

3 

Burkitt MD, Williams JM, Duckworth CA, O'Hara A, Hanedi A, Varro A, Caamaño JH and Pritchard DM: Signaling mediated by the NF-κB sub-units NF-κB1, NF-κB2 and c-Rel differentially regulate Helicobacter felis-induced gastric carcinogenesis in C57BL/6 mice. Oncogene. 32:5563–5573. 2013. View Article : Google Scholar : PubMed/NCBI

4 

Chung GT, Lou WP, Chow C, To KF, Choy KW, Leung AW, Tong CY, Yuen JW, Ko CW, Yip TT, et al: Constitutive activation of distinct NF-κB signals in EBV-associated nasopharyngeal carcinoma. J Pathol. 231:311–322. 2013. View Article : Google Scholar : PubMed/NCBI

5 

Hamoudi RA, Appert A, Ye H, Ruskone-Fourmestraux A, Streubel B, Chott A, Raderer M, Gong L, Wlodarska I, DeWolf-Peeters C, et al: Differential expression of NF-kappaB target genes in MALT lymphoma with and without chromosome translocation: Insights into molecular mechanism. Leukemia. 24:1487–1497. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Colangelo T, Fucci A, Votino C, Sabatino L, Pancione M, Laudanna C, Binaschi M, Bigioni M, Maggi CA, Parente D, Forte N, et al: MicroRNA-130b promotes tumor development and is associated with poor prognosis in colorectal cancer. Neoplasia. 15:1086–1099. 2013. View Article : Google Scholar : PubMed/NCBI

7 

Fitzgerald TL, Lertpiriyapong K, Cocco L, Martelli AM, Libra M, Candido S, Montalto G, Cervello M, Steelman L, Abrams SL and McCubrey JA: Roles of EGFR and KRAS and their downstream signaling pathways in pancreatic cancer and pancreatic cancer stem cells. Adv Biol Regul. 59:65–81. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Dang K and Myers KA: The role of hypoxia-induced miR-210 in cancer progression. Int J Mol Sci. 16:6353–6372. 2015. View Article : Google Scholar : PubMed/NCBI

9 

Taganov KD, Boldin MP, Chang KJ and Baltimore D: NF-kappaB-dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. Proc Natl Acad Sci USA. 103:12481–12486. 2006. View Article : Google Scholar : PubMed/NCBI

10 

Dai L, Gu L and Di W: MiR-199a attenuates endometrial stromal cell invasiveness through suppression of the IKKβ/NF-κB pathway and reduced interleukin-8 expression. Mol Hum Reprod. 18:136–145. 2012. View Article : Google Scholar :

11 

Zhen Q, Liu J, Gao L, Liu J, Wang R, Chu W, Zhang Y, Tan G, Zhao X and Lv B: MicroRNA-200a Targets EGFR and c-Met to Inhibit Migration, Invasion, and Gefitinib Resistance in Non-Small Cell Lung Cancer. Cytogenet Genome Res. 146:1–8. 2015. View Article : Google Scholar : PubMed/NCBI

12 

Tsouko E, Wang J, Frigo DE, Aydodu E and Williams C: miR-200a inhibits migration of triple-negative breast cancer cells through direct repression of the EPHA2 oncogene. Carcinogenesis. 36:1051–1060. 2015. View Article : Google Scholar : PubMed/NCBI

13 

Hong MH, Mai HQ, Min HQ, Ma J, Zhang EP and Cui NJ: A comparison of the Chinese 1992 and fifth-edition International Union Against Cancer staging systems for staging nasopharyngeal carcinoma. Cancer. 89:242–247. 2000. View Article : Google Scholar : PubMed/NCBI

14 

Guo J, Li M, Meng X, Sui J, Dou L, Tang W, Huang X, Man Y, Wang S and Li J: MiR-291b-3p induces apoptosis in liver cell line NCTC1469 by reducing the level of RNA-binding protein HuR. Cell Physiol Biochem. 33:810–822. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Kan R, Shuen WH, Lung HL, Cheung AK, Dai W, Kwong DL, Ng WT, Lee AW, Yau CC, Ngan RK, Tung SY and Lung ML: NF-κB p65 Subunit Is Modulated by Latent Transforming Growth Factor-β Binding Protein 2 (LTBP2) in Nasopharyngeal Carcinoma HONE1 and HK1 Cells. PLoS One. 10:e01272392015. View Article : Google Scholar

16 

Astarci E, Sade A, Cimen I, Savaş B and Banerjee S: The NF-κB target genes ICAM-1 and VCAM-1 are differentially regulated during spontaneous differentiation of Caco-2 cells. FEBS J. 279:2966–2986. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Lu Z and Li Y, Takwi A, Li B, Zhang J, Conklin DJ, Young KH, Martin R and Li Y: miR-301a as an NF-κB activator in pancreatic cancer cells. EMBO J. 30:57–67. 2011. View Article : Google Scholar :

18 

Bao C, Li Y, Huan L, Zhang Y, Zhao F, Wang Q, Liang L, Ding J, Liu L, Chen T, Li J, Yao M, Huang S and He X: NF-κB signaling relieves negative regulation by miR-194 in hepatocellular carcinoma by suppressing the transcription factor HNF–1α. Sci Signal. 8:ra752014. View Article : Google Scholar

19 

Ding J, Huang S, Wang Y, Tian Q, Zha R, Shi H, Wang Q, Ge C, Chen T, Zhao Y, Liang L, Li J and He XP: Genome-wide screening reveals that miR-195 targets the TNF-α/NF-κB pathway by down-regulating IκB kinase alpha and TAB3 in hepatocellular carcinoma. Hepatology. 58:654–666. 2013. View Article : Google Scholar : PubMed/NCBI

20 

Olarerin-George AO, Anton L, Hwang YC, Elovitz MA and Hogenesch JB: A functional genomics screen for microRNA regulators of NF-kappaB signaling. BMC Biol. 11:192013. View Article : Google Scholar : PubMed/NCBI

21 

Croce CM: Causes and consequences of microRNA dysregulation in cancer. Nat Rev Genet. 10:704–714. 2009. View Article : Google Scholar : PubMed/NCBI

22 

Liu N, Cui RX, Sun Y, Guo R, Mao YP, Tang LL, Jiang W, Liu X, Cheng YK, He QM, et al: A four-miRNA signature identified from genome-wide serum miRNA profiling predicts survival in patients with nasopharyngeal carcinoma. Int J Cancer. 134:1359–1368. 2014. View Article : Google Scholar

23 

Zhao Y, Chen X, Jing M, Du H and Zeng Y: Expression of miRNA-146a in nasopharyngeal carcinoma is upregulated by Epstein-Barr virus latent membrane protein 1. Oncol Rep. 28:1237–1242. 2012.PubMed/NCBI

24 

Song L, Liu L, Wu Z, Li Y, Ying Z, Lin C, Wu J, Hu B, Cheng SY, Li M and Li J: TGF-β induces miR-182 to sustain NF-κB activation in glioma subsets. J Clin Invest. 122:3563–3578. 2012. View Article : Google Scholar : PubMed/NCBI

25 

Pozdeyev N, Berlinberg A, Zhou Q, Wuensch K, Shibata H, Wood WM and Haugen BR: Targeting the NF-κB pathway as a combination therapy for advanced thyroid cancer. PLoS One. 10:e01349012015. View Article : Google Scholar

26 

Nourbakhsh M, Oumard A, Schwarzer M and Hauser H: NRF, a nuclear inhibitor of NF-kappaB proteins silencing interferon-beta promoter. Eur Cytokine Netw. 11:500–501. 2000.

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Shi Z, Hu Z, Chen D, Huang J, Fan J, Zhou S, Wang X, Hu J and Huang F: MicroRNA‑200a mediates nasopharyngeal carcinoma cell proliferation through the activation of nuclear factor‑κB. Mol Med Rep 13: 1732-1738, 2016.
APA
Shi, Z., Hu, Z., Chen, D., Huang, J., Fan, J., Zhou, S. ... Huang, F. (2016). MicroRNA‑200a mediates nasopharyngeal carcinoma cell proliferation through the activation of nuclear factor‑κB. Molecular Medicine Reports, 13, 1732-1738. https://doi.org/10.3892/mmr.2015.4738
MLA
Shi, Z., Hu, Z., Chen, D., Huang, J., Fan, J., Zhou, S., Wang, X., Hu, J., Huang, F."MicroRNA‑200a mediates nasopharyngeal carcinoma cell proliferation through the activation of nuclear factor‑κB". Molecular Medicine Reports 13.2 (2016): 1732-1738.
Chicago
Shi, Z., Hu, Z., Chen, D., Huang, J., Fan, J., Zhou, S., Wang, X., Hu, J., Huang, F."MicroRNA‑200a mediates nasopharyngeal carcinoma cell proliferation through the activation of nuclear factor‑κB". Molecular Medicine Reports 13, no. 2 (2016): 1732-1738. https://doi.org/10.3892/mmr.2015.4738
Copy and paste a formatted citation
x
Spandidos Publications style
Shi Z, Hu Z, Chen D, Huang J, Fan J, Zhou S, Wang X, Hu J and Huang F: MicroRNA‑200a mediates nasopharyngeal carcinoma cell proliferation through the activation of nuclear factor‑κB. Mol Med Rep 13: 1732-1738, 2016.
APA
Shi, Z., Hu, Z., Chen, D., Huang, J., Fan, J., Zhou, S. ... Huang, F. (2016). MicroRNA‑200a mediates nasopharyngeal carcinoma cell proliferation through the activation of nuclear factor‑κB. Molecular Medicine Reports, 13, 1732-1738. https://doi.org/10.3892/mmr.2015.4738
MLA
Shi, Z., Hu, Z., Chen, D., Huang, J., Fan, J., Zhou, S., Wang, X., Hu, J., Huang, F."MicroRNA‑200a mediates nasopharyngeal carcinoma cell proliferation through the activation of nuclear factor‑κB". Molecular Medicine Reports 13.2 (2016): 1732-1738.
Chicago
Shi, Z., Hu, Z., Chen, D., Huang, J., Fan, J., Zhou, S., Wang, X., Hu, J., Huang, F."MicroRNA‑200a mediates nasopharyngeal carcinoma cell proliferation through the activation of nuclear factor‑κB". Molecular Medicine Reports 13, no. 2 (2016): 1732-1738. https://doi.org/10.3892/mmr.2015.4738
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team