Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
April-2017 Volume 15 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2017 Volume 15 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Molecular characterization of mitochondrial transferRNAGln and transferRNAMet A4401G mutations in a Chinese family with hypertension

  • Authors:
    • Shuai‑Shuai Yu
    • Ji‑Mei Du
    • Zhi‑De Tang
    • Zhi‑Feng He
  • View Affiliations / Copyright

    Affiliations: Department of Biology, School of Laboratory Medicine and Life Science, Wenzhou Medical University, Wenzhou, Zhejiang 325035, P.R. China, Department of Cardiothoracic Surgery, The First Affiliated Hospital, Wenzhou Medical University, Wenzhou, Zhejiang 325035, P.R. China
  • Pages: 1832-1836
    |
    Published online on: February 17, 2017
       https://doi.org/10.3892/mmr.2017.6216
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Mutations in mitochondrial (mt)transfer (t)RNA (mt‑tRNA) have been reported to serve important roles in hypertension. To determine the underlying molecular mechanisms of mt‑tRNA mutations in hypertension, the present study screened for mt‑tRNA mutations in a Chinese family with a high incidence of essential hypertension. Sequence analysis of the mt‑tRNA genes in this family revealed the presence of an A4401G mutation in the glycine‑and methionine‑tRNA genes, and a G5821A mutation in the cysteine‑tRNA (tRNACys) gene. The G5821A mutation was located at a position conserved in various species, and disrupted G6‑C67 base‑pairing. It was hypothesized that the G5821A mutation may decrease the baseline expression levels of tRNACys, and consequently result in failure of tRNA metabolism. The A4401G mutation was reported to cause the mitochondrial dysfunction responsible for hypertension. Thus, the combination of G5821A and A4401G mutations may contribute to the high incidence of hypertension in this family. Mt‑tRNA mutations may serve as potential biomarkers for hypertension.

Introduction

Hypertension is a primary public health problem, affecting ~1 billion individuals worldwide (1). To date, the etiology of hypertension remains to be fully elucidated due to its multi-factorial nature. Hypertension may be due to one or numerous hereditary, environmental and individual factors. A maternal inheritance pattern of hypertension has previously been identified in certain families, suggesting that a mutation in mitochondrial (mt) DNA is a cause of this disease (2–4). Previously, various mtDNA point mutations have been associated with hypertension, including the A4435G mutation in the methionine-transfer RNA (tRNAMet) gene (5), A4295G and A4263G mutations in the isoleucine-tRNA (tRNAIle) gene (6,7), anA1555G mutation in the 12S ribosomal RNA gene (8), a T3308C mutation in the nicotinamide adenine dinucleotide dehydrogenase (ND), subunit 1 gene and a C3303T mutation in the leucine-tRNA, codons UUA/G gene (9,10). Leucine-tRNA, codons CUN A12330G combined with ND, subunit 5 T12338C mutations have previously been reported to associate with hypertension in a Han Chinese family (11).

The present study investigated the involvement of the mitochondrial genome in the pathogenesis of hypertension in the Chinese population. During a systematic and extended mutational screening of mtDNA in a large cohort of subjects admitted to The First Affiliated Hospital of Wenzhou Medical University (Wenzhou, China) with hypertension, a single Chinese family with maternally inherited hypertension was identified. The mutational screening of the mt-tRNA gene led to the identification of a homoplasmic A4401G mutation in the conjunction of glycine-tRNA(tRNAGln) and tRNAMet, and a G5821A mutation in cysteine-tRNA (tRNA-Cys) was additionally identified.

Materials and methods

Subjects

As part of genetic screening program for hypertension, a Han Chinese family (Fig. 1) was recruited from The First Affiliated Hospital of Wenzhou Medical University (Wenzhou, China). Informed consent, blood samples and clinical evaluations were obtained from all participating family members, under protocols approved by the ethics committee of Wenzhou Medical University. A total of 300 control DNA samples were obtained from a panel of unaffected Han Chinese individuals from the same area. Members of this family were interviewed and evaluated to determine personal and medical histories, including hypertension and other clinical abnormalities. In addition, a physical examination, laboratory assessment of cardiovascular disease risk factors and routine electrocardiography were performed. A physician measured the systolic and diastolic blood pressures of subjects using a mercury column sphygmomanometer, following a standard protocol. The first and the fifth Korotkoff sounds were measured as indicators of systolic and diastolic blood pressure, respectively. Hypertension was defined according to the recommendation of the Joint National Committee on Detection, Evaluation and Treatment of High Blood Pressure and the World Health Organization International Society of Hypertension as a systolic blood pressure of ≥140 mm Hg and/or a diastolic blood pressure of ≥90 mm Hg (12,13).

Figure 1.

Pedigree of hypertension inheritance patterns in a three-generation Han Chinese family. Individuals with hypertension are represented by filled symbols. The proband is indicated by the arrow. Squares, males; circles, females.

Genotype analysis of mt-tRNA mutations

Genomic DNA was isolated from the whole blood of subjects using a Gentra Puregene Blood kit (Qiagen, Inc., Valencia, CA, USA). DNA fragments spanning the mt-tRNA genes were amplified by polymerase chain reaction (PCR) using oligodeoxynucleotides, as previously described (14) (Table I). Each fragment was purified and subsequently analyzed by direct sequencing using the ABI PRISM®3700 Genetic Analyzer (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and BigDye Terminator version 3.1 Cycle Sequencing kit (Thermo Fisher Scientific, Inc.). The resultant sequence data were compared with the updated Cambridge Reference Sequence (GenBank accession no. NC_012920).

Table I.

Primers for polymerase chain reaction amplification of the mt-tRNA genes.

Table I.

Primers for polymerase chain reaction amplification of the mt-tRNA genes.

Target genePrimer namePrimer sequence (5′-3′)Product size (bp)
tRNAPheMT-1F CTCCTCAAAGCAATACACTG802
MT-1R TGCTAAATCCACCTTCGACC
tRNAValMT-2F CGATCAACCTCACCACCTCT802
MT-2R TGGACAACCAGCTATCACCA
tRNALeu(UUR)MT-4F AAATCTTACCCCGCCTGTTT887
MT-4R AGGAATGCCATTGCGATTAG
tRNAIleMT-6F TGGCTCCTTTAACCTCTCCA898
tRNAGln
tRNAMetMT-6R AAGGATTATGGATGCGGTTG814
tRNAAlaMT-8F CTAACCGGCTTTTTGCCC
tRNAAsn
tRNACysMT-8R ACCTAGAAGGTTGCCTGGCT987
tRNASer(UCN)MT-11F ACGCCAAAATCCATTTCACT
tRNAAspMT-11R CGGGAATTGCATCTGTTTTT
tRNALysMT-12F ACGAGTACACCGACTACGGC900
MT-12R TGGGTGGTTGGTGTAAATGA
tRNAGlyMT-15F TCTCCATCTATTGATGAGGGTCT891
tRNAArgMT-15R AATTAGGCTGTGGGTGGTTG
tRNAHisMT-18F TATCACTCTCCTACTTACAG866
tRNASer(AGY)
tRNALeu(CUN)MT-18R AGAAGGTTATAATTCCTACG938
tRNAGluMT-21F GCATAATTAAACTTTACTTC
MT-21R AGAATATTGAGGCGCCATTG
tRNAThrMT-22F TGAAACTTCGGCTCACTCCT1,162
tRNAProMT-22R GAGTGGTTAATAGGGTGATAG

[i] F, forward; R, reverse; mt, mitochondrial; t, transfer; Leu, leucine; UUR, codons UUR; Phe, phenylalanine; Val, valine; Ile, isoleucine; Gln, glutamine; Met, methionine; Ala, alanine; Asn, asparagine; Cys, cysteine; Ser, serine; UCN, codons UCN; AGY, codons AGY; Asp, aspartic acid; Lys, lysine; His, histidine; Thr, threonine; Pro, proline; CUN, codons CUN.

Assigning pathogenicity to the mt-tRNA mutation

The pathogenicity classifications of the A4401G and G5821A mutations were assigned using an updated version of a previously validated scoring system (15). This pathogenicity scoring system uses weighted criteria covering a variety of molecular and genetic data, from which an overall pathogenicity score was obtained. The scoring system for variants was as follows: ≥11 points, ‘definitely pathogenic’; 7–10, ‘possibly pathogenic’ and <6, ‘neutral polymorphism’.

Results

Clinical features

The proband (II-6) was a 59-year-old woman from Wenzhou, Zhejiang. She began to suffer from hypertension at age 50. Her blood pressure was 145/95 mmHg and she attended The First Affiliated Hospital of Wenzhou Medical University for treatment. A physical examination revealed the absence of other clinical abnormalities, including diabetes mellitus, loss of vision or deafness. As presented in Fig. 1, the family of the proband exhibited a typical pattern of maternally-inherited hypertension, with a penetrance of 80%. The clinical features of this Han Chinese family are listed in Table II.

Table II.

Clinical features of the Han Chinese family with essential hypertension.

Table II.

Clinical features of the Han Chinese family with essential hypertension.

SubjectGenderAge at onsetAge when assessedSystolic pressure (mm/Hg)Diastolic pressure (mm/Hg)
I-2Female708314595
II-6Female505914085
II-3Male515715095
III-4Female333514090
mt-tRNA analysis

The maternal inheritance pattern of hypertension suggested the involvement of mitochondria; therefore, the mitochondrial genome of matrilineal relatives was investigated. As mt-tRNA genes have previously been demonstrated to be hotspots for pathogenic mutations associated with hypertension (16), the present study focused on mt-tRNA variants. As presented in Table I, 11 primers that spanned the entire mt-tRNA genome were designed. Following this, putative mt-tRNA mutations were screened; the comparison of the resultant sequences with the reversed Cambridge consensus sequences identified two candidate tRNA mutations: The A4401G mutation in the conjunction of tRNAGln and tRNAMet and a mutation G5821A in the tRNACys gene (Figs. 2 and 3). These tRNA mutations were further assessed by phylogenetic analysis of sequences from other organisms, including mouse (17), bovine (18) and Xenopus Laevis (19). The present study identified that these mutations are highly evolutionarily conserved and may therefore possess significant functions.

Figure 2.

Identification of A4401G and G5821A mutations in the mitochondrial genome. Partial sequence chromatograms of mitochondrial genes from the affected proband (II-6) and a control (II-5). Arrows indicate the location of base changes at positions 4401 and 5821.

Figure 3.

Cloverleaf structures of tRNAMet, tRNAGln and tRNACys. Arrows indicate the positions of the 4401C and 4401G mutations. tRNACys is localized in the light chain of the mitochondrial genome, thus the G5821A mutation is also known as the C5821T mutation, as indicated in red. tRNA, transfer RNA.

Pathogenicity scoring of the A4401G and G5821A mutations

According to the pathogenicity scoring system (15), the present study classified the A4401G mutation as ‘definitely pathogenic’ with a total score of 15 points, whereas the G5821A mutation was identified to be ‘possibly pathogenic’ with a total score of 8 points (Table III).

Table III.

Pathogenicity scoring system for the A4401 and G5821A mutations.

Table III.

Pathogenicity scoring system for the A4401 and G5821A mutations.

Scoring criteriaA4401G mutationScore/20G5821AmutationScore/20
More than one independent reportYes  2Yes2
Evolutionary conservation of the base pairNo changes  2No changes2
Variant heteroplasmyNo  0No0
Segregation of the mutation with diseaseYes  2Yes2
Histochemical evidence of mitochondrial diseaseStrong evidence  2No evidence0
Biochemical defect in complex I, III or IVYes  2No0
Evidence of mutation segregation with biochemical defect from single-fiber studiesNo  0No0
Mutant mt-tRNA steady-state level or evidence of pathogenicity in trans-mitochondrial cybrid studiesStrong evidence  5Weak evidence2
Maximum scoreDefinitely pathogenic15Possibly pathogenic8

[i] Scoring system classification: ≥11 points, definitely pathogenic; 7–10 points, possibly pathogenic; ≤6 points, neutral polymorphisms.

Discussion

The present study conducted clinical, genetic and molecular analysis of a three-generation Han Chinese family with a high incidence of essential hypertension. Hypertension, with no accompanying conditions, was identified in matrilineal relatives of this family, suggesting that mtDNA mutations were the underlying molecular basis. The age-of-onset of hypertension varied from 33 to 70 years, with an average of 51 years, whereas matrilineal relatives exhibited early-onset hypertension, suggesting that mitochondrial sequence variants may be the risk factor for this disease.

Screening for mt-tRNA mutations identified homoplasmic mutations in the A4401G and G5821A genes. The absence of A4401G and G5821A mutations in the 300 healthy controls indicated that these mutations may be involved in the pathogenesis of hypertension. Notably, the A to G transition at position 4401 was located at the 5′ end of the tRNAMet and tRNAGln genes (20,21). A at the 4401 position is highly conserved among various primates. In addition, this mutation was present only in matrilineal relatives of this family but not in healthy controls, indicating that it may contribute to the pathogenesis of essential hypertension. The A4401G mutation was first described in a patient with left ventricular hypertrophy (22). Functional analysis demonstrated that cytoplasmic hybrid cells containing the A4401G mutation have a 30% reduction in tRNAMet and tRNAGln expression levels. The reduced levels of tRNAMet and tRNAGln in cells with the A4401G mutation potentially results from a defect in the processing of tRNAMet and tRNAGln precursors at the 5′ end. Therefore, A4401G may be regarded as a pathogenic mutation associated with cardiovascular diseases.

Sequence analysis of the mt-tRNA genes identified the presence of a homoplasmic G5821A mutation in the tRNACys gene. The G5821A mutation was located in extremely conserved nucleotides in the acceptor arm of tRNACys, and disrupted the highly conserved base-pairing (G6-C67). A failure in tRNACys function may aggravate the mitochondrial dysfunction caused by the A4401G mutation. A decrease in tRNAMet, tRNAGln and tRNACys may result in reduced mitochondrial protein synthesis, decreased activities of the mitochondrial respiration chain, and consequently a reduction of adenosine triphosphate production and an increase of reactive oxygen species generation. In conclusion, the results of the present study suggested that the tRNACys G5821A gene mutation may regulate the phenotypic expression of hypertension-associated A4401G mutations in tRNAMet and tRNAGln. mt-tRNA gene mutations may therefore be useful biomarkers for the molecular detection or prevention of maternally inherited hypertension. Further studies involving the use of additional samples are required to verify this conclusion.

References

1 

Gu D, Reynolds K, Wu X, Chen J, Duan X, Muntner P, Huang G, Reynolds RF, Su S, Whelton PK, et al: Prevalence, awareness, treatment, and control of hypertension in China. Hypertension. 40:920–927. 2002. View Article : Google Scholar : PubMed/NCBI

2 

Brandão AP, Brandão AA, Araújo EM and Oliveira RC: Familial aggregation of arterial blood pressure and possible genetic influence. Hypertension. 19 Suppl 2:II214–II217. 1992. View Article : Google Scholar : PubMed/NCBI

3 

Wallace DC: Mitochondrial defects in cardiomyopathy and neuromuscular disease. Am Heart J. 139 Suppl:S70–S85. 2000. View Article : Google Scholar : PubMed/NCBI

4 

Hirano M, Davidson M and DiMauro S: Mitochondria and the heart. Curr Opin Cardiol. 16:201–210. 2001. View Article : Google Scholar : PubMed/NCBI

5 

Liu Y, Li R, Li Z, Wang XJ, Yang L, Wang S and Guan MX: Mitochondrial transfer RNAMet 4435A>G mutation is associated with maternally inherited hypertension in a Chinese pedigree. Hypertension. 53:1083–1090. 2009. View Article : Google Scholar : PubMed/NCBI

6 

Li Z, Liu Y, Yang L, Wang S and Guan MX: Maternally inherited hypertension is associated with the mitochondrial tRNA(Ile) A4295G mutation in a Chinese family. Biochem Biophys Res Commun. 367:906–911. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Wang S, Li R, Fettermann A, Li Z, Qian Y, Liu Y, Wang X, Zhou A, Mo JQ, Yang L, et al: Maternally inherited essential hypertension is associated with the novel 4263A>G mutation in the mitochondrial tRNAIle gene in a large Han Chinese family. Circ Res. 108:862–870. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Chen H, Zheng J, Xue L, Meng Y, Wang Y, Zheng B, Fang F, Shi S, Qiu Q, Jiang P, et al: The 12S rRNA A1555G mutation in the mitochondrial haplogroup D5a is responsible for maternally inherited hypertension and hearing loss in two Chinese pedigrees. Eur J Hum Genet. 20:607–612. 2012. View Article : Google Scholar : PubMed/NCBI

9 

Liu Y, Li Z, Yang L, Wang S and Guan MX: The mitochondrial ND1 T3308C mutation in a Chinese family with the secondary hypertension. Biochem Biophys Res Commun. 368:18–22. 2008. View Article : Google Scholar : PubMed/NCBI

10 

Palecek T, Tesarova M, Kuchynka P, Dytrych V, Elleder M, Hulkova H, Hansikova H, Honzik T, Zeman J and Linhart A: Hypertrophic cardiomyopathy due to the mitochondrial DNA mutation m.3303C>T diagnosed in an adult male. Int Heart J. 53:383–387. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Teng L, Zheng J, Leng J and Ding Y: Clinical and molecular characterization of a Han Chinese family with high penetrance of essential hypertension. Mitochondrial DNA. 23:461–465. 2012. View Article : Google Scholar : PubMed/NCBI

12 

Whitworth JA: World Health Organization, International Society of Hypertension Writing Group: 2003 world health organization (WHO)/international society of hypertension (ISH) statement on management of hypertension. J Hypertens. 21:1983–1992. 2003. View Article : Google Scholar : PubMed/NCBI

13 

Arima H, Tanizaki Y, Kiyohara Y, Tsuchihashi T, Kato I, Kubo M, Tanaka K, Ohkubo K, Nakamura H, Abe I, et al: Validity of the JNC VI recommendations for the management of hypertension in a general population of Japanese elderly: The Hisayama study. Arch Intern Med. 163:361–366. 2003. View Article : Google Scholar : PubMed/NCBI

14 

Rieder MJ, Taylor SL, Tobe VO and Nickerson DA: Automating the identification of DNA variations using quality-based fluorescence re-sequencing: Analysis of the human mitochondrial genome. Nucleic Acids Res. 26:967–973. 1998. View Article : Google Scholar : PubMed/NCBI

15 

Yarham JW, Al-Dosary M, Blakely EL, Alston CL, Taylor RW, Elson JL and McFarland R: A comparative analysis approach to determining the pathogenicity of mitochondrial tRNA mutations. Hum Mutat. 32:1319–1325. 2011. View Article : Google Scholar : PubMed/NCBI

16 

Ding Y, Xia B, Yu J, Leng J and Huang J: Mitochondrial DNA mutations and essential hypertension (Review). Int J Mol Med. 32:768–774. 2013.PubMed/NCBI

17 

Bibb MJ, Van Etten RA, Wright CT, Walberg MW and Clayton DA: Sequence and gene organization of mouse mitochondrial DNA. Cell. 26:167–180. 1981. View Article : Google Scholar : PubMed/NCBI

18 

Gadaleta G, Pepe G, De Candia G, Quagliariello C, Sbisà E and Saccone C: The complete nucleotide sequence of the Rattus norvegicus mitochondrial genome: Cryptic signals revealed by comparative analysis between vertebrates. J Mol Evol. 28:497–516. 1989. View Article : Google Scholar : PubMed/NCBI

19 

Roe BA, Ma DP, Wilson RK and Wong JF: The complete nucleotide sequence of the Xenopus laevis mitochondrial genome. J Biol Chem. 260:9759–9774. 1985.PubMed/NCBI

20 

Ojala D, Montoya J and Attardi G: tRNA punctuation model of RNA processing in human mitochondria. Nature. 290:470–474. 1981. View Article : Google Scholar : PubMed/NCBI

21 

Andrews RM, Kubacka I, Chinnery PF, Lightowlers RN, Turnbull DM and Howell N: Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA. Nat Genet. 23:1471999. View Article : Google Scholar : PubMed/NCBI

22 

Zhu HY, Wang SW, Liu L, Li YH, Chen R, Wang L and Holliman CJ: A mitochondrial mutation A4401G is involved in the pathogenesis of left ventricular hypertrophy in Chinese hypertensives. Eur J Hum Genet. 17:172–178. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yu SS, Du JM, Tang ZD and He ZF: Molecular characterization of mitochondrial transferRNAGln and transferRNAMet A4401G mutations in a Chinese family with hypertension. Mol Med Rep 15: 1832-1836, 2017.
APA
Yu, S., Du, J., Tang, Z., & He, Z. (2017). Molecular characterization of mitochondrial transferRNAGln and transferRNAMet A4401G mutations in a Chinese family with hypertension. Molecular Medicine Reports, 15, 1832-1836. https://doi.org/10.3892/mmr.2017.6216
MLA
Yu, S., Du, J., Tang, Z., He, Z."Molecular characterization of mitochondrial transferRNAGln and transferRNAMet A4401G mutations in a Chinese family with hypertension". Molecular Medicine Reports 15.4 (2017): 1832-1836.
Chicago
Yu, S., Du, J., Tang, Z., He, Z."Molecular characterization of mitochondrial transferRNAGln and transferRNAMet A4401G mutations in a Chinese family with hypertension". Molecular Medicine Reports 15, no. 4 (2017): 1832-1836. https://doi.org/10.3892/mmr.2017.6216
Copy and paste a formatted citation
x
Spandidos Publications style
Yu SS, Du JM, Tang ZD and He ZF: Molecular characterization of mitochondrial transferRNAGln and transferRNAMet A4401G mutations in a Chinese family with hypertension. Mol Med Rep 15: 1832-1836, 2017.
APA
Yu, S., Du, J., Tang, Z., & He, Z. (2017). Molecular characterization of mitochondrial transferRNAGln and transferRNAMet A4401G mutations in a Chinese family with hypertension. Molecular Medicine Reports, 15, 1832-1836. https://doi.org/10.3892/mmr.2017.6216
MLA
Yu, S., Du, J., Tang, Z., He, Z."Molecular characterization of mitochondrial transferRNAGln and transferRNAMet A4401G mutations in a Chinese family with hypertension". Molecular Medicine Reports 15.4 (2017): 1832-1836.
Chicago
Yu, S., Du, J., Tang, Z., He, Z."Molecular characterization of mitochondrial transferRNAGln and transferRNAMet A4401G mutations in a Chinese family with hypertension". Molecular Medicine Reports 15, no. 4 (2017): 1832-1836. https://doi.org/10.3892/mmr.2017.6216
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team