Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
April-2017 Volume 15 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2017 Volume 15 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Molecular profile of major growth factors in lumbar intervertebral disc herniation: Correlation with patient clinical and epidemiological characteristics

  • Authors:
    • Alexandros Tsarouhas
    • Giannoula Soufla
    • Konstantinos Tsarouhas
    • Pavlos Katonis
    • Dritan Pasku
    • Antonis Vakis
    • Aristides M. Tsatsakis
    • Demetrios A. Spandidos
  • View Affiliations / Copyright

    Affiliations: Laboratory of Virology, Medical School, University of Crete, Heraklion 71003, Greece, Cardiological Department, University General Hospital of Larissa, Larissa 41110, Greece, Department of Orthopedics and Traumatology, University Hospital of Heraklion, Heraklion 71110, Greece, Department of Neurosurgery, University Hospital of Heraklion, Heraklion 71110, Greece, Department of Forensic Sciences and Toxicology, Faculty of Medicine, University of Crete, Heraklion 71003, Greece
    Copyright: © Tsarouhas et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 2195-2203
    |
    Published online on: February 20, 2017
       https://doi.org/10.3892/mmr.2017.6221
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The involvement of growth factors (GFs) in the pathogenesis of lumbar intervertebral disc (ID) herniation and the spontaneous resorption of herniated ID fragments remains only partially elucidated. A simultaneous assessment of the transcript levels of numerous GFs and their association with clinical and epidemiological profiles of human ID herniation would provide valuable insight into the biology and clinical course of the disease. In the present study, we examined simultaneously the transcript levels of vascular endothelial growth factor (VEGF), transforming growth factor β1 (TGF‑β1), basic fibroblast growth factor 2 (bFGF2), platelet derived growth factor (PDGF) isoforms and receptors, epidermal growth factor (EGF) and insulin growth factor‑1 (IGF‑1) in herniated and control ID specimens and investigated their correlation with the clinicopathological profiles of patients suffering from symptomatic lumbar ID herniation. GF mRNA expression levels were determined by RT-qPCR in 63 surgical specimens from lumbar herniated discs and 10 control ID specimens. Multiple positive correlations were observed between the transcript levels of the GFs examined in the ID herniation group. VEGF mRNA expression was significantly increased in the protruding compared with the extruded discs. Intense and acute pain significantly upregulated the PDGF transcript levels. Significant negative correlations were observed between the patient body mass index and the transcript levels of VEGF and PDGF receptors. Our findings support the hypothesis of the involvement of GFs in the natural history of ID herniation. GFs synergistically act in herniated IDs. Increased VEGF expression possibly induces the neovascularization process in the earliest stages of ID herniation. PDGF‑C and ‑D play a role in the acute phase of radiculopathy in a metabolic response for tissue healing. A molecular effect, in addition to the biomechanical effect of obesity in the pathogenesis of ID herniation is also implied.

Introduction

Intervertebral disc (ID) herniation is a common, yet poorly understood disorder. Behavioral, hereditary and environmental factors cumulatively affect the nutrition and homeostasis of the disc, ultimately resulting in its structural breakdown and in the occurrence of herniation. The incidence of symptomatic lumbar ID herniation in the United States is estimated at 1–2%, for which approximately 200,000 discectomies are performed annually (1). The direct costs for conservative or surgical treatment and he indirect costs deriving from the loss of productivity are enormous (2).

However, ID herniation is considered to present a favorable natural history. Sequential magnetic resonance imaging (MRI) studies have documented that the majority of disc herniations diminish in size (3). Saal et al reported that almost 80% of disc herniations treated non-operatively decreased by >50% in follow-up examinations (4). In addition, a positive correlation has been found between the regression of disc herniation and the remission of symptoms (3,4). Various molecules, such as pro-inflammatory cytokines, growth factors (GFs) and matrix metalloproteinases (MMPs) have been implicated in the mechanisms that regulate ID degradation and herniation, as well as the spontaneous resorption of herniated disc fragments (5).

GFs are polypeptides involved in the modulation of cell growth and differentiation that exert their biologic effects through endocrine, paracrine and autocrine pathways (6). Over 18 different GFs have been identified, including vascular endothelial growth factor (VEGF), transforming growth factor β1 (TGF-β1), basic fibroblast growth factor (bFGF)-2, platelet derived growth factor (PDGF), epidermal growth factor (EGF) and insulin growth factor-1 (IGF-1). The PDGF family in particular is formed by the PDGF-A, -B, -C and -D isoforms that are encoded by four genes located at different chromosomes and may form homodimers, as well as heterodimers. These molecules signal through two cell-surface receptors, PDGF-Rα and β (7).

To date, the expression of various GFs in the degenerate and herniated ID has been investigated in numerous studies. The increased protein expression of IGF-1, FGF-2, VEGF, PDGF and TGF-β has been found by means of immunohistochemistry (8–11). The transcript levels of TGF-β and VEGF have also been examined in human ID herniation specimens (12). Consequently, preliminary studies have examined the effect of administering different GFs on ID physiology and degeneration in vitro and in vivo (13,14). However, a simultaneous assessment of the molecular profile of numerous GFs in human herniated IDs has not been performed to date, at least to the best of our knowledge. In addition, clinical and epidemiological determinants, such as the extent of disc herniation, the duration and intensity of symptoms, age and employment may considerably affect the pathophysiology of ID degeneration and the potential for regression of herniated ID fragments. The association between the clinical, epidemiological and molecular profile of ID herniation would potentially provide valuable insight into the biology and clinical course of the disorder. Therefore, the purpose of the present study was to simultaneously examine the molecular profiles of numerous GFs by means of reverse transcriprtion-quantitative polymerase chain reaction (RT-qPCR), and to investigate potential correlations with the clinical and epidemiological characteristics of patients suffering from lumbar ID herniation.

Materials and methods

Tissue samples

ID tissue samples were collected from a total of 63 patients who underwent posterior open discectomy for lumbar ID herniation in our department during a recruitment period of one year (2008). The patients reported symptoms of radiculopathy prior to surgery. Patients suffering from spinal stenosis, spondylolisthesis, scoliosis or systemic inflammatory disorders were excluded from the study. After excision, an experienced pathologist, in addition to the clinicians present, examined the tissue samples and identified the pulposus sections in order to limit the percentage of end-plates or annulus. Samples were then immediately refrigerated at −80°C until RNA extraction. Ten cadaveric ID tissue samples were also obtained within 12 h of the patient succumbing to the disease, referring to various diseases other than ID herniation. The samples were used as controls of normal growth factor mRNA expression. Donors were aged between 20 and 46 years and were known to have a negative history of lower back pain, spinal trauma or systemic inflammatory disease. All the patients or relatives signed an informed consent form approved by the University Ethics Committee to participate in the present study. The study design was in accordance with the Declaration of Helsinki Guidelines.

Prior to surgery, the patients routinely underwent an MRI examination for the classification of ID herniation. The recommendations of the combined task force from the North American Spine Society, the American Society of Spine Radiology and the American Society of Neuroradiology based on the imaging characterization of Milette (15) were used to determine the type of ID herniation. Pre-operative pain intensity was measured subjectively using the visual analogue scale score (VAS). Patient employment was defined as heavy if it included manual labour with repetitive loading of the spine. A summary of patient and control group baseline data is presented in Table I. There were no significant differences in terms of age, gender, body mass index (BMI), employment and smoking habits between the control and ID herniation groups (minimum P=0.24).

Table I.

Patient clinical characteristics.

Table I.

Patient clinical characteristics.

CharacteristicNo. of patients
ID herniation group Age (years)
  Mean (range)47.3 (27–68)
    20–3927
    40–5923
    >6012
Gender
  Male/female33/30
Body mass index (BMI)
  Mean (range)27.2 (21.07–33.05)
Level of ID herniation
  L3-L411
  L4-L524
  L5-S128
Type of herniation
  Protrusion23
  Extrusion33
  Sequestration  7
Duration of symptoms
  <3 months15
  3–12 months20
  >12 months28
Pain intensity (VAS)
  0–518
  5–714
  8–1031
Employment
  Heavy/light36/27
Smoking Habits
  Smokers/non-smokers26/37
  <10 cig per day  6
  10- 20 cig per day  8
  >20 cig per day12
Control group Age (years)
  Mean (range)36.8 (20–46)
Gender
  Male/female6/4
Body mass index (BMI)
  Mean (range)27.0 (21.9–33.0)
Employment
  Heavy/light7/3
Smoking Habits
  Smokers/non-smokers4/6
RNA extraction and RT-qPCR

Total RNA was isolated from fresh tissue and homogenized with a power homogenizer using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). RNA concentration and purity were determined on a UV spectrophotometer (Hitachi Instruments Inc., San Jose, CA, USA) by absorbance measurements (260 nm absorbance and 260/280 nm absorbance ratio). RNA integrity was examined by 1% agarose gel electrophoresis and ethidium bromide staining.

Reverse transcription reactions for the preparation of first-strand cDNA from 2 µg of total RNA were performed using the AffinityScript™ Multi Temperature cDNA synthesis kit (Stratagene, La Jolla, CA, USA). Random hexamers were used as amplification primers. Quantitative PCR (qPCR) reactions were performed using the Mx3000P real-time PCR system with SYBR®-Green I Master Mix (both from Stratagene). Data were collected and analyzed using the Mx3000P real-time PCR software version 2.00, Build 215 Schema 60 (Stratagene). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control to normalize the mRNA expression levels of the GFs examined. The primer pair sequences used are listed in Table II. PCR products were analyzed by electrophoresis on 2% agarose gels, stained with ethidium bromide and photographed on a UV light transilluminator. GF transcription levels were calculated using the following formula: normalized sample or control = (1 + EGF)−∆∆CqGF/(1 + EGAPDH)−∆∆CqGAPDH. Procedures were repeated with a cDNA template, synthesized three times from the same RNA. The mRNA levels of each sample for each gene tested represent the mean value of data acquired from three independent RT-qPCR experiments. The reproducibility of the RT-qPCR results for the same samples was 99%.

Table II.

Sequences of primers used for RT-qPCR.

Table II.

Sequences of primers used for RT-qPCR.

GenePrimer pair sequence (5′→3′)Annealing temperature (°C)Product size (bp)
IGF-1 CCTCCTCGCATCTCTTCTACCTGC60166
TGCTGGAGCCATACCCTGTG
FGF-2 CTGGCTATGAAGGAAGATGGA55149
TGCCCAGTTCGTTTCAGTG
TGF-Β AAGGACCTCGGCTGGAAGTGC62137
CCGGGTTATGCTGGTTGTA
VEGF ATGACGAGGGCCTGGAGTGTG60  91
CCTATGTGCTGGCCTTGGTGAG
PDGF-A ACACGAGCAGTGTCAAGTGC55  76
CCTGACGTATTCCACCTTGG
PDGF-B AGATCGAGATTGTGCGGAAG52  94
CAGCTGCCACTGTCTCACAC
PDGF-C GCCAGGTTGTCTCCTGGTTA52  86
TGCTTGGGACACATTGACAT
PDGF-D CCCAGGAATTACTCGGTCAA52105
ACAGCCACAATTTCCTCCAC
PDGF rec-A TGGGAGTTTCCAAGAGATGG52  78
TGTTCCTTCAACCACCTTCC
PDGF rec-B GTGCTCACCATCATCTCCCT52  85
ACTCAATCACCTTCCATCGG
GAPDH GGAAGGTGAAGGTCGGAGTCA60101
GTCATTGATGGCAACAATATCCACT
Statistical analysis

The one-sample Kolmogorov-Smirnov test was used to assess the normality of the distribution of the mRNA expression values for the genes studied. Accordingly, the mRNA expression levels of the GFs examined in the control and herniated groups were compared using parametric and non-parametric procedures, respectively. Differences in GF expression between herniated and control IDs and between subgroups of different clinical characteristics were examined using parametric (one-way and repeated measures ANOVA) and non-parametric (Kruskal-Wallis and Mann-Whitney) tests accordingly. Pairwise comparisons were performed to further explore the interaction. Categorical variables were compared with the use of χ2 test. The Spearman rank correlation test (non-parametric) was also employed to examine pair-wise correlations in growth factor mRNA expression in control and herniated discs. The significance level was set at P<0.05. Statistical calculations were performed using SPSS software, version 15 (SPSS, Inc., Chicago, IL, USA).

Results

GF mRNA levels in normal and herniated discs

The transcript levels of the GFs examined were not significant between the control and ID herniation groups (minimum P=0.26, Mann-Whitney test, Table III). With the exception of EGF that was not expressed in neither of the 2 groups, all the GFs examined were expressed in the two study groups. Specifically, the mRNA expression status (expressed or not) of the genes examined ranged from 40 to 100% in the controls and 35 to 100% in the ID herniation groups (Table III). PDGF-C and -D mRNA expression was observed in all the herniated IDs, while IGF was the least commonly expressed in the same group (34.9%).

Table III.

Growth factor mRNA expression.

Table III.

Growth factor mRNA expression.

Expressed GeneControl discs (n=10)Herniated discs (n=63) P-valueaControl discs (n=10)Herniated discs (%) (n=63) P-valueb
IGF1.2637±0.961 11256.0652±1.12NS5/1022/63 (34.9)NS
FGF0.0431±0.03246.0385±38.749NS4/1030/63 (47.6)NS
TGF1.1329±0.61636.8798±13.531NS9/1056/63 (88.8)NS
VEGF0.0003±0.0019.9859±9.7546NS5/1033/63 (52.3)NS
PDGF-A0.6554±0.61324.7222±10.603NS4/1031/63 (49.2)NS
PDGF-B4.5424±2.39565.3348±52.903NS10/1062/63 (98.4)NS
PDGF-C1.7382±0.427 121.2165±68.593NS10/1063/63 (100)NS
PDGF-D3.2749±0.969 153.5597±97.695NS10/1063/63 (100)NS
PDGF rec-A0.1241±0.05225.8371±13.227NS6/1032/63 (50.7)NS
PDGF rec-B0.0823±0.05312.5163±5.361NS4/1029/63 (46)NS

a Mann-Whitney test

b χ2 NS, non-significant. Quantitative data are presented as the means ± SEM, and are based on the expression status (expressed or not) in the control and herniated lumbar discs.

Pair-wise GF mRNA co-expression analysis

Pair-wise correlations between the genes examined in the ID herniation groups and the controls are presented in Tables IV and V, respectively (Spearman correlations). Compared with the controls, an increased number of positive correlations was observed in the ID herniation group between most of the genes examined.

Table IV.

Spearman correlation tables demonstrating the co-expression profile of GFs in the group of herniated lumbar discs.

Table IV.

Spearman correlation tables demonstrating the co-expression profile of GFs in the group of herniated lumbar discs.

FactorMethod   bFGFIGFPDGF-APDGF-BPDGF-CPDGF-DPDGFRAPDGFRBTGF-bVEGF
bFGFSpearman's rho1.000
Sig. 2-tailed.
IGFSpearman's rho0.6441.000
Sig. 2-tailed0.000.
PDGF-ASpearman's rho0.1360.1811.000
Sig. 2-tailed0.2940.159.
PDGF-BSpearman's rho−0.175−0.1320.0381.000
Sig. 2-tailed0.1710.3010.767.
PDGF-CSpearman's rho−0.119−0.050−0.1010.5461.000
Sig. 2-tailed0.3540.7000.4360.000.
PDGF-DSpearman's rho−0.151−0.069−0.0910.5360.7281.000
Sig. 2-tailed0.2390.5900.4800.0000.000.
PDGFRASpearman's rho0.7440.5720.155−0.0310.002−0.0821.000
Sig. 2-tailed0.0000.0000.2290.8070.9870.524.
PDFGRBSpearman's rho0.8450.6540.212−0.095−0.057−0.1990.8221.000
Sig. 2-tailed0.0000.0000.0980.4570.6550.1180.000.
TGF-bSpearman's rho0.3760.3250.1640.0600.2010.1680.2870.3651.000
Sig. 2-tailed0.0020.0090.2020.6380.1130.1880.0220.003.
VEGFSpearman's rho0.8860.5570.077−0.2630.005−0.0540.6800.7700.4771.000
Sig. 2-tailed0.0000.0000.5520.0390.9670.6760.0000.0000.000.

[i] Numbers in bold refer to statistically significant findings (correlations, 2-tailed). bFGF, basic fibroblast growth factor; IGF, insulin growth factor; PDGF, platelet derived growth factor; TGF, transforming growth factor; VEGF, vascular endothelial growth factor.

Table V.

Spearman correlation tables demonstrating the co- expression profile of GFs in the group of control lumbar discs.

Table V.

Spearman correlation tables demonstrating the co- expression profile of GFs in the group of control lumbar discs.

FactorMethodbFGFIGFPDGF-APDGF-BPDGF-CPDGF-DPDGFRAPDGFRBVEGFTGF-b
bFGFSpearman's rho1.000
Sig. 2-tailed.
IGFSpearman's rho−0.0761.000
Sig. 2-tailed0.886.
PDGF-ASpearman's rho−0.2710.9811.000
Sig. 2-tailed0.6040.001.
PDGF-BSpearman's rho−0.4750.3880.4691.000
Sig. 2-tailed0.3410.4470.348.
PDGF-CSpearman's rho−0.6360.6440.7490.6321.000
Sig. 2-tailed0.1750.1680.0870.178.
PDGF-DSpearman's rho−0.860.0070.1780.6310.7451.000
Sig. 2-tailed0.0270.9890.7350.1790.089.
PDGFRASpearman's rho0.378−0.422−0.482−0.677−0.394−0.3101.000
Sig. 2-tailed0.4600.4050.3330.1400.4400.550.
PDFGRBSpearman's rho0.338−0.252−0.308−0.422−0.057−0.0650.8841.000
Sig. 2-tailed0.5120.6300.5530.4050.9140.9030.020.
VEGFSpearman's rho0.096−0.360−0.367−0.462−0.214−0.0750.9350.8091.000
Sig. 2-tailed0.8570.4830.4740.3560.6830.8870.0060.051.
TGF-bSpearman's rho−0.2380.9680.9820.5800.7890.237−0.504−0.263−0.3921.000
Sig. 2-tailed0.6500.0020.0000.2270.0620.6520.3070.6140.442.

[i] Numbers in bold refer to statistically significant findings (correlations, 2-tailed). bFGF, basic fibroblast growth factor; IGF, insulin growth factor; PDGF, platelet derived growth factor; VEGF, vascular endothelial growth factor; TGF, transforming growth factor.

Correlation of transcript levels with clinicopathological characteristics
Age and gender

Age did not significantly affect the mRNA expression levels of the genes examined (minimum P=0.07, Kruskal-Wallis test). Male patients exhibited increased mRNA expression levels of PDGF-C and -D compared with female patients (P=0.007 and 0.024, respectively, Mann-Whitney test) (absolute values not shown).

BMI

Significant negative correlations were observed between the patient BMI values and the transcript levels of VEGF, PDGFRA and PDGFRB (P=0.036, 0.037 and 0.02, respectively, Spearman correlation).

Duration of symptoms

The transcript levels of PDGF-C and -D were significantly affected by the duration of patient symptoms (P=0.02 and 0.05, respectively, Kruskal-Wallis test). Specifically, patients suffering from acute pain (<3 months) exhibited an increased mRNA expression of PDGF-C compared with those suffering for 3–10 months and for >10 months (P=0.04 and 0.01, respectively, Mann-Whitney test). Similarly, the PDGF-D expression levels were also significantly higher in patients suffering from acute (<3 months) compared with chronic pain (P=0.017, Mann-Whitney test, Fig. 1).

Figure 1.

Normalized transcript levels of: (A) PDGF-C and (B) PDGF-D in regard to the duration of patient symptoms. PDGF, platelet derived growth factor.

Pain intensity

The intensity of patient pain significantly affected the expression levels of PDGF-B, -C and -D (P=0.044, 0.024 and 0.05, Kruskal-Wallis test). Specifically, patients experiencing moderate pain (VAS 5–7) exhibited an increased mRNA expression of PDGF-B, -C and -D compared with those with low intensity pain (VAS 0–4) (P=0.01, 0.018 and 0.05, respectively, Mann-Whitney test). In addition, patients with intense pain (VAS 8–10) also exhibited a significantly increased expression of PDGF-C and -D compared with those with low intensity pain (P=0.026 and 0.03, respectively, Mann-Whitney test, Fig. 2).

Figure 2.

Normalized transcript levels of: (A) PDGF-B; (B) PDGF-C and (C) PDGF-D in regard to the intensity of pain experienced by the patients. PDGF, platelet derived growth factor; VAS, visual analogue scale.

Type of ID herniation

The transcript levels of VEGF significantly correlated with the type of ID herniation (P=0.023, Kruskal-Wallis test). Specifically, ID herniation samples with protrusion exhibited an increased mRNA expression of VEGF compared with the extruded IDs (P=0.019, Mann-Whitney test, Fig. 3).

Figure 3.

Normalized transcript levels of VEGF in regard to the type of ID herniation. ID herniation samples with protrusion exhibited an increased mRNA expression of VEGF compared with extruded discs (P=0.019, Mann-Whitney test). VEGF, vascular endothelial growth factor; ID, intervertebral disc.

Employment

The transcript levels of the genes examined did not differ significantly between patients with either light or heavy employment (minimum P=0.15, Mann-Whitney test) (absolute values not shown).

Smoking

The mRNA expression levels of the GFs examined did not differ significantly between smoking and non-smoking patients (minimum P=0.087, Mann-Whitney test). Accordingly, the amount of cigarette smoking did not significantly affect the transcript levels of any of the genes studied (minimum P=0.29, Kruskal-Wallis test) (absolute values not shown).

Discussion

The current study examined the molecular profiles of numerous GFs by means of RT-qPCR in surgically resected lumbar ID herniation specimens and matched controls. Correlations of GF transcript levels with the patient clinical and epidemiological characteristics were also explored. Multiple positive correlations between the GFs were identified in the group of herniated discs. The VEGF transcript levels were significantly higher in protruding compared with the extruded discs. The duration and intensity of patient symptoms significantly affected the PDGF transcript levels. BMI exhibited significant negative correlations with the transcript levels of VEGF and both PDGF-receptor isotypes (data not shown).

There have been limited reports in the literature examining the molecular profiles of GFs in ID herniation. In lumbar herniated IDs, Ahn et al detected TGF-β mRNA expression in 5 out of 10 specimens examined (16), whereas Kontinnen et al found a decreased mRNA expression of the same factor (12). Control groups were not included in these studies. Kontinnen et al also failed to identify the mRNA or protein expression of EGF, which they attributed to the reduced anabolic potential of the disc. The findings of the present study did not identify any differences in the mRNA expression of GFs in a substantial number of herniated and control ID specimens. By contrast, immunohistochemistry, has produced more variable results. Specchia et al reported stronger staining for IGF-1 in chondrocytes of herniated compared with control discs (10). Similarly, Tolonen et al observed significantly stronger staining for PDGF and TGF-β in human herniated ID tissue (8,9). Given that no differences in GF expression are evident at the mRNA level compared with the controls, these findings suggest that post-transcriptional modifications may occur in the setting of ID herniation.

The transcript levels of the GFs examined significantly correlated with each other in herniated IDs. In vitro experiments have demonstrated a synergistic effect of VEGF and TGF-β1 in the induction of angiogenesis (17). In addition, PDGF has been found to upregulate VEGF in mural cells, thereby further enhancing angiogenesis (18). IGF-I has also been shown to induce VEGF mRNA and protein expression in cultured colorectal carcinoma cells (19). Most of these GFs are also under the regulatory effect of inflammatory cytokines, such as interleukin-1 (IL-1) and tumor necrosis factor-α (TNF-α). Both TNF-α and IL-1 have been shown to interact with numerous GFs in human degenerated discs and trigger a sequence of macrophage and MMP activation that potentiates the spontaneous resorption of herniated ID fragments (20–22). Multiple positive correlations between numerous MMPs have also been demonstrated in human ID herniation (5). Our findings, therefore, confirm a synergistic activation of GFs in ID herniation as part of a metabolic cascade that ultimately promotes the regression process of herniated discs.

Our results demonstrated that the transcript levels of VEGF were significantly higher in protruding compared with extruded IDs. VEGF is a potent mitogen for vascular endothelial cells. It induces new vessel formation through cell proliferation and luminal formation and has also been found to increase blood vessel permeability (23). Using immunohistochemistry, Tolonen et al and Koike et al confirmed the expression of VEGF in extruded and sequestrated human IDs (9,24). A significant correlation was also observed between the expression of VEGF and the presence of vascular endothelial cells (24). Protruding ID herniation samples were not included in these studies. Ozaki et al reported the presence of small blood vessels in 73.4% of herniated ID tissues examined histopathologically, regardless of hernia type (25). They also suggested that neovascularization was present in the outermost annulus layers, even in protruding herniations. To the best of our knowledge, the present study is the first to confirm the expression of VEGF in protruding hernias at the mRNA level, thereby supporting the hypothesis that VEGF upregulation plays a key role even in the earliest stages of the neovascularization process that follows ID herniation.

PDGF is considered a key mediator in the tissue repair process. It stimulates mitogenicity and chemotaxis of neutrophils and macrophages in a variety of mesenchymal-derived cells, such as osteoblasts, chondrocytes and fibroblasts (7). It has been shown that PDGF exerts its effect on the repair process, not by altering its normal sequence, but by increasing its rate (26). It has been hypothesized that PDGF induces the production of extracellular matrix components and cellular proliferation in the ID in a similar mechanism as in the articular cartilage (9). It has also been shown to participate in the resorption process of herniated ID fragments by upregulating MMP expression (22). The findings of the present study indicated that the PDGF transcript levels were significantly higher in patients suffering from intense and acute pain. These findings support the role of PDGF as a key modulator of the repair process of damaged connective tissue, and indicate that it is primarily expressed in the acute phase of sciatica, during which it participates in a metabolic attempt to repair the herniated ID tissue.

Notably, PDGF isoforms -C and -D were the ones principally upregulated in patients with intense and acute pain. Among the PDGF isoforms, PDGF-BB is considered ‘universal’, mainly due to its ability to bind to both known forms of PDGF-receptor isotypes. In the musculoskeletal system, recombinant human PDGF-BB injection therapy has already been employed in experimental and clinical studies to promote fracture healing and foot and ankle fusion rates (27,28). It is considered important in upregulating cytokines that enhance osseous and soft-tissue healing and regeneration. However, novel information on the biological actions of PDGF-C and -D isoforms has recently been added. PDGF-D was found to strongly attract macrophages to its expression sites and to inhibit the vascular leakage that results from growth factor-induced angiogenesis. When co-expressed with VEGF-E, it promotes the in vitro stability of the newly generated vessels induced by VEGF-E alone, leading to enlarged and less leaky vessels (29). Both neovascularization and subsequent macrophage infiltration are critical stages of the acute repair response following ID herniation. Our findings therefore suggest a more favorable effect of PDGF-CC and -DD isoforms in the acute phase of disc herniation and potentially provide an alternative target for growth factor therapy research. PDGF-CC isoform is known to bind to PDGF-R A/A and A/B dimers, whereas PDGF-DD binds to B/B dimers. B-receptor expression was found to be low in connective tissue cells and to increase during inflammation (30). In the present study, the expression of each receptor isotype was detected in approximately 50% of the herniated specimens. However, it was not significant compared with the controls.

BMI exhibited significant negative correlations with the transcript levels of VEGF and both PDGF-receptor isotypes. To the best of our knowledge, there is a paucity of data available on patient BMI in studies evaluating the molecular mechanisms implicated in ID herniation. As a consequence, BMI has not been previously associated with the expression of GFs in ID herniation. In a recent histo-morphological study, Weiler et al correlated histological disc alterations in surgical lumbar ID specimens with patient BMI, suggesting an accelerated course of ID degeneration in obese individuals (31). Occupational and lifestyle factors, including obesity, have been implicated in the pathogenesis of ID herniation, mainly on a biomechanical basis focusing on increased loading and structural failure of the disc (32,33). However, a metabolic pathway may also exist. The findings of this study indicated that, in the obese population, a decrease in the expression of GFs directly associated with the acute repair process and regression of herniated IDs through peripheral neovascularization and chemotaxis. A previous study demonstrated the overexpression of TNF-α in the adipose tissue of obese individuals, as well as a consequent decrease with weight loss (34). In the ID, TNF-α has been shown to play a central signaling role in the metabolic cascade that regulates the natural history of degeneration and herniation by promoting the expression of other cytokines, MMPs and various GFs (16). Although a clear association cannot be established solely on the available evidence, these findings imply a molecular effet, in addition to the biomechanical effect of obesity in the pathogenesis and natural history of ID herniation.

In conclusion, the present study provides evidence of the simultaneous molecular profile of numerous GFs in herniated lumbar ID surgical specimens supporting the hypothesis of growth factor involvement in the natural history of ID herniation. GFs synergistically act in herniated IDs. Increased VEGF expression possibly induces the neovascularization process in the earliest stages of ID herniation. PDGF isoforms -C and -D potentially play a role in the acute phase of radiculopathy in a metabolic response for tissue healing. A molecular effect, in addition to the biomechanical effect of obesity in the pathogenesis and natural history of ID herniation is also suggested.

References

1 

Taylor VM, Deyo RA, Cherkin DC and Kreuter W: Low back pain hospitalization. Recent United States trends and regional variations. Spine. 19:1207–1212; discussion 13. 1994. View Article : Google Scholar : PubMed/NCBI

2 

Katz JN: Lumbar disc disorders and low-back pain: Socioeconomic factors and consequences. J Bone Joint Surg Am. 88:21–24. 2006. View Article : Google Scholar : PubMed/NCBI

3 

Komori H, Shinomiya K, Nakai O, Yamaura I, Takeda S and Furuya K: The natural history of herniated nucleus pulposus with radiculopathy. Spine. 21:225–229. 1996. View Article : Google Scholar : PubMed/NCBI

4 

Saal JA, Saal JS and Herzog RJ: The natural history of lumbar intervertebral disc extrusions treated nonoperatively. Spine. 15:683–686. 1990. View Article : Google Scholar : PubMed/NCBI

5 

Tsarouhas A, Soufla G, Katonis P, Pasku D, Vakis A and Spandidos DA: Transcript levels of major MMPs and ADAMTS-4 in relation to the clinicopathological profile of patients with lumbar disc herniation. Eur Spine J. 20:781–790. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Masuda K, Oegema TR Jr and An HS: Growth factors and treatment of intervertebral disc degeneration. Spine. 29:2757–2769. 2004. View Article : Google Scholar : PubMed/NCBI

7 

Alvarez RH, Kantarjian HM and Cortes JE: Biology of platelet-derived growth factor and its involvement in disease. Mayo Clin Proc. 81:1241–1257. 2006. View Article : Google Scholar : PubMed/NCBI

8 

Tolonen J, Grönblad M, Virri J, Seitsalo S, Rytömaa T and Karaharju E: Transforming growth factor beta receptor induction in herniated intervertebral disc tissue: An immunohistochemical study. Eur Spine J. 10:172–176. 2001. View Article : Google Scholar : PubMed/NCBI

9 

Tolonen J, Grönblad M, Virri J, Seitsalo S, Rytömaa T and Karaharju EO: Platelet-derived growth factor and vascular endothelial growth factor expression in disc herniation tissue: And immunohistochemical study. Eur Spine J. 6:63–69. 1997. View Article : Google Scholar : PubMed/NCBI

10 

Specchia N, Pagnotta A, Toesca A and Greco F: Cytokines and growth factors in the protruded intervertebral disc of the lumbar spine. Eur Spine J. 11:145–151. 2002. View Article : Google Scholar : PubMed/NCBI

11 

Tolonen J, Grönblad M, Virri J, Seitsalo S, Rytömaa T and Karaharju E: Basic fibroblast growth factor immunoreactivity in blood vessels and cells of disc herniations. Spine. 20:271–276. 1995. View Article : Google Scholar : PubMed/NCBI

12 

Konttinen YT, Kemppinen P, Li TF, Waris E, Pihlajamäki H, Sorsa T, Takagi M, Santavirta S, Schultz GS and Humphreys-Beher MG: Transforming and epidermal growth factors in degenerated intervertebral discs. J Bone Joint Surg Br. 81:1058–1063. 1999. View Article : Google Scholar : PubMed/NCBI

13 

Thompson JP, Oegema TR Jr and Bradford DS: Stimulation of mature canine intervertebral disc by growth factors. Spine. 16:253–260. 1991. View Article : Google Scholar : PubMed/NCBI

14 

Masuda K: Biological repair of the degenerated intervertebral disc by the injection of growth factors. Eur Spine J (Suppl 17). 4:441–451. 2008. View Article : Google Scholar

15 

Milette PC: Classification, diagnostic imaging, and imaging characterization of a lumbar herniated disk. Radiol Clin North Am. 38:1267–1292. 2000. View Article : Google Scholar : PubMed/NCBI

16 

Ahn SH, Cho YW, Ahn MW, Jang SH, Sohn YK and Kim HS: mRNA expression of cytokines and chemokines in herniated lumbar intervertebral discs. Spine. 27:911–917. 2002. View Article : Google Scholar : PubMed/NCBI

17 

Pepper MS, Ferrara N, Orci L and Montesano R: Potent synergism between vascular endothelial growth factor and basic fibroblast growth factor in the induction of angiogenesis in vitro. Biochem Biophys Res Commun. 189:824–831. 1992. View Article : Google Scholar : PubMed/NCBI

18 

Guo P, Hu B, Gu W, Xu L, Wang D, Huang HJ, Cavenee WK and Cheng SY: Platelet-derived growth factor-B enhances glioma angiogenesis by stimulating vascular endothelial growth factor expression in tumor endothelia and by promoting pericyte recruitment. Am J Pathol. 162:1083–1093. 2003. View Article : Google Scholar : PubMed/NCBI

19 

Warren RS, Yuan H, Matli MR, Ferrara N and Donner DB: Induction of vascular endothelial growth factor by insulin-like growth factor 1 in colorectal carcinoma. J Biol Chem. 271:29483–29488. 1996. View Article : Google Scholar : PubMed/NCBI

20 

Kato T, Haro H, Komori H and Shinomiya K: Sequential dynamics of inflammatory cytokine, angiogenesis inducing factor and matrix degrading enzymes during spontaneous resorption of the herniated disc. J Orthop Res. 22:895–900. 2004. View Article : Google Scholar : PubMed/NCBI

21 

Pratsinis H, Constantinou V, Pavlakis K, Sapkas G and Kletsas D: Exogenous and autocrine growth factors stimulate human intervertebral disc cell proliferation via the ERK and Akt pathways. J Orthop Res. 30:958–964. 2012. View Article : Google Scholar : PubMed/NCBI

22 

Smith RJ, Justen JM, Sam LM, Rohloff NA, Ruppel PL, Brunden MN and Chin JE: Platelet-derived growth factor potentiates cellular responses of articular chondrocytes to interleukin-1. Arthritis Rheum. 34:697–706. 1991. View Article : Google Scholar : PubMed/NCBI

23 

Ferrara N and Davis-Smyth T: The biology of vascular endothelial growth factor. Endocr Rev. 18:4–25. 1997. View Article : Google Scholar : PubMed/NCBI

24 

Koike Y, Uzuki M, Kokubun S and Sawai T: Angiogenesis and inflammatory cell infiltration in lumbar disc herniation. Spine. 28:1928–1933. 2003. View Article : Google Scholar : PubMed/NCBI

25 

Ozaki S, Muro T, Ito S and Mizushima M: Neovascularization of the outermost area of herniated lumbar intervertebral discs. J Orthop Sci. 4:286–292. 1999. View Article : Google Scholar : PubMed/NCBI

26 

Heldin CH and Westermark B: Mechanism of action and in vivo role of platelet-derived growth factor. Physiol Rev. 79:1283–1316. 1999.PubMed/NCBI

27 

Digiovanni CW, Baumhauer J, Lin SS, Berberian WS, Flemister AS, Enna MJ, Evangelista P and Newman J: Prospective, randomized, multi-center feasibility trial of rhPDGF-BB versus autologous bone graft in a foot and ankle fusion model. Foot Ankle Int. 32:344–354. 2011. View Article : Google Scholar : PubMed/NCBI

28 

Hee CK, Dines JS, Dines DM, Roden CM, Wisner-Lynch LA, Turner AS, McGilvray KC, Lyons AS, Puttlitz CM and Santoni BG: Augmentation of a rotator cuff suture repair using rhPDGF-BB and a type I bovine collagen matrix in an ovine model. Am J Sports Med. 39:1630–1639. 2011. View Article : Google Scholar : PubMed/NCBI

29 

Uutela M, Wirzenius M, Paavonen K, Rajantie I, He Y, Karpanen T, Lohela M, Wiig H, Salven P, Pajusola K, et al: PDGF-D induces macrophage recruitment, increased interstitial pressure, and blood vessel maturation during angiogenesis. Blood. 104:3198–3204. 2004. View Article : Google Scholar : PubMed/NCBI

30 

Rubin K, Tingström A, Hansson GK, Larsson E, Rönnstrand L, Klareskog L, Claesson-Welsh L, Heldin CH, Fellström B and Terracio L: Induction of B-type receptors for platelet-derived growth factor in vascular inflammation: Possible implications for development of vascular proliferative lesions. Lancet. 1:1353–1356. 1988. View Article : Google Scholar : PubMed/NCBI

31 

Weiler C, Lopez-Ramos M, Mayer HM, Korge A, Siepe CJ, Wuertz K, Weiler V, Boos N and Nerlich AG: Histological analysis of surgical lumbar intervertebral disc tissue provides evidence for an association between disc degeneration and increased body mass index. BMC Res Notes. 4:4972011. View Article : Google Scholar : PubMed/NCBI

32 

Pye SR, Reid DM, Adams JE, Silman AJ and O'Neill TW: Influence of weight, body mass index and lifestyle factors on radiographic features of lumbar disc degeneration. Ann Rheum Dis. 66:426–427. 2007. View Article : Google Scholar : PubMed/NCBI

33 

Hangai M, Kaneoka K, Kuno S, Hinotsu S, Sakane M, Mamizuka N, Sakai S and Ochiai N: Factors associated with lumbar intervertebral disc degeneration in the elderly. Spine J. 8:732–740. 2008. View Article : Google Scholar : PubMed/NCBI

34 

Kern PA, Saghizadeh M, Ong JM, Bosch RJ, Deem R and Simsolo RB: The expression of tumor necrosis factor in human adipose tissue. Regulation by obesity, weight loss, and relationship to lipoprotein lipase. J Clin Invest. 95:2111–2119. 1995. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Tsarouhas A, Soufla G, Tsarouhas K, Katonis P, Pasku D, Vakis A, Tsatsakis AM and Spandidos DA: Molecular profile of major growth factors in lumbar intervertebral disc herniation: Correlation with patient clinical and epidemiological characteristics. Mol Med Rep 15: 2195-2203, 2017.
APA
Tsarouhas, A., Soufla, G., Tsarouhas, K., Katonis, P., Pasku, D., Vakis, A. ... Spandidos, D.A. (2017). Molecular profile of major growth factors in lumbar intervertebral disc herniation: Correlation with patient clinical and epidemiological characteristics. Molecular Medicine Reports, 15, 2195-2203. https://doi.org/10.3892/mmr.2017.6221
MLA
Tsarouhas, A., Soufla, G., Tsarouhas, K., Katonis, P., Pasku, D., Vakis, A., Tsatsakis, A. M., Spandidos, D. A."Molecular profile of major growth factors in lumbar intervertebral disc herniation: Correlation with patient clinical and epidemiological characteristics". Molecular Medicine Reports 15.4 (2017): 2195-2203.
Chicago
Tsarouhas, A., Soufla, G., Tsarouhas, K., Katonis, P., Pasku, D., Vakis, A., Tsatsakis, A. M., Spandidos, D. A."Molecular profile of major growth factors in lumbar intervertebral disc herniation: Correlation with patient clinical and epidemiological characteristics". Molecular Medicine Reports 15, no. 4 (2017): 2195-2203. https://doi.org/10.3892/mmr.2017.6221
Copy and paste a formatted citation
x
Spandidos Publications style
Tsarouhas A, Soufla G, Tsarouhas K, Katonis P, Pasku D, Vakis A, Tsatsakis AM and Spandidos DA: Molecular profile of major growth factors in lumbar intervertebral disc herniation: Correlation with patient clinical and epidemiological characteristics. Mol Med Rep 15: 2195-2203, 2017.
APA
Tsarouhas, A., Soufla, G., Tsarouhas, K., Katonis, P., Pasku, D., Vakis, A. ... Spandidos, D.A. (2017). Molecular profile of major growth factors in lumbar intervertebral disc herniation: Correlation with patient clinical and epidemiological characteristics. Molecular Medicine Reports, 15, 2195-2203. https://doi.org/10.3892/mmr.2017.6221
MLA
Tsarouhas, A., Soufla, G., Tsarouhas, K., Katonis, P., Pasku, D., Vakis, A., Tsatsakis, A. M., Spandidos, D. A."Molecular profile of major growth factors in lumbar intervertebral disc herniation: Correlation with patient clinical and epidemiological characteristics". Molecular Medicine Reports 15.4 (2017): 2195-2203.
Chicago
Tsarouhas, A., Soufla, G., Tsarouhas, K., Katonis, P., Pasku, D., Vakis, A., Tsatsakis, A. M., Spandidos, D. A."Molecular profile of major growth factors in lumbar intervertebral disc herniation: Correlation with patient clinical and epidemiological characteristics". Molecular Medicine Reports 15, no. 4 (2017): 2195-2203. https://doi.org/10.3892/mmr.2017.6221
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team