Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
April-2017 Volume 15 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2017 Volume 15 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Effects of R type and S type ginsenoside Rg3 on DNA methylation in human hepatocarcinoma cells

  • Authors:
    • Siying Teng
    • Yi Wang
    • Pingya Li
    • Jinhua Liu
    • Anhui Wei
    • Haotian Wang
    • Xiangkun Meng
    • Di Pan
    • Xinmin Zhang
  • View Affiliations / Copyright

    Affiliations: School of Pharmaceutical Sciences, Jilin University, Changchun, Jilin 130021, P.R. China
    Copyright: © Teng et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 2029-2038
    |
    Published online on: February 28, 2017
       https://doi.org/10.3892/mmr.2017.6255
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Ginsenoside Rg3, a bioactive constituent isolated from Panax ginseng, exhibits antitumorigenic, antioxidative, antiangiogenic, neuroprotective and other biological activities are associated with the regulation of multiple genes. DNA methylation patterns, particularly those in the promoter region, affect gene expression, and DNA methylation is catalyzed by DNA methylases. However, whether ginsenoside Rg3 affects DNA methylation is unknown. High performance liquid chromatography assay, MspI/HpaII polymerase chain reaction (PCR) and reverse transcription‑quantitative PCR were performed to assess DNA methylation. It was demonstrated that 20(S)‑ginsenoside Rg3 treatment resulted in increased inhibition of cell growth, compared with treatment with 20(R)‑ginsenoside Rg3 in the human HepG2 hepatocarcinoma cell line. It was additionally revealed that treatment with 20(S)‑ginsenoside Rg3 reduced global genomic DNA methylation, altered cystosine methylation of the promoter regions of P53, B cell lymphoma 2 and vascular endothelial growth factor, and downregulated the expression of DNA methyltransferase (DNMT) 3a and DNMT3b more than treatment with 20(R)‑ginsenoside Rg3 in HepG2 cells. These results revealed that the modulation of DNA methylation may be important in the pharmaceutical activities of ginsenoside Rg3.

Introduction

Ginsenoside Rg3, which has the chemical name of 12β, 20-dihydroxydammar-24-en-3β-yl2-O-β-D-glucopyranosyl-β- D-glucopyranoside, and ginsenoside Rg3 exist in two forms, the R type and S type, according to its asymmetric carbon atom (choral carbon atom) C20. Ginsenoside Rg3 has diverse pharmacological effects in vitro and in vivo via the activation or repression of the expression of different genes. Previous studies have reported that ginsenoside Rg3 inhibits cancer cell proliferation and induces apoptosis by decreasing the expression of histone deacetylase 3 (1), epidermal growth factor receptor (2), fucosyltransferase IV (3) and vascular endothelial growth factor (VEGF) (4), and upregulates the protein expression of pro-apoptotic P53 (1), caspase-3, caspase-8 and caspase-9 (5). Ginsenoside Rg3 has been shown to enhance the radiosensitivity of human esophageal carcinoma cells by downregulating the expression of VEGF and hypoxia inducible factor-1α (6), and ginsenoside Rg3 may have a neuroprotective function in the rat hippocampus via the inhibition of hippocampus-mediated N-methyl-D-aspartate receptor activation (7). Additional biological activities associated with gene regulation have also been demonstrated for this molecule (2,8).

5-methyl-cytosine (m5Cyt) is the most investigated epigenetic modification, and alterations in genomic DNA methylation patterns have been confirmed to be associated with the development of pathological processes and diseases, including cancer (9,10). It has also been reported that DNA methylation patterns can be altered by medication, nutrients and chemicals (11–13). DNA methyltransferases (DNMTs) are enzymes responsible for establishing the original methylation patterns of de novo methylases, DNMT3a and DNMT3b, and for maintaining these throughout subsequent cellular divisions (maintenance methylase DNMT1). However, until now, there have been no reports on whether ginsenoside Rg3 affects DNA methylation or the expression of methyltransferases.

Global hypomethylation and promoter hypermethylation have been found in hepatocarcinogenesis (14–16); therefore, the present study investigated the effects of ginsenoside Rg3 on methylation in the HepG2 human hepatocarcinoma cell line. The results showed that ginsenoside Rg3 inhibited HepG2 cell proliferation in a dose-dependent manner, induced a reduction in global DNA methylation, altered methylated cystosines in the promoter regions of specific genes, upregulated the expression of DNMT1, and downregulated the expression of DNMT3a and DNMT 3b. In addition, the different ginsenoside Rg3 epimers exhibited different biological activities.

Materials and methods

Reagents

High performance liquid chromatography (HPLC)-grade standards for 20(S)-ginsenoside Rg3 and 20(R)-ginsenoside Rg3 were purchased from Shanghai Yuanye Biotechnology Co., Ltd. (Shanghai, China) and dissolved at a concentration of 50 mg/ml in dimethyl sulfoxide as a stock solution (stored at −20°C). This solution was then further diluted in cell culture medium to prepare the working concentrations (0, 7.81, 15.63, 31.25, 62.5, 125, 250 and 500 µg/ml). 5-methyl-2′-deoxycytidine (5-MedC) was purchased from United States Biological (Salem, MA, USA), and 2′-deoxyguanosine (dG), thymidine (T), 2′-deoxycytidine (dC) and 2′-deoxyadenosine (dA) were obtained from Sigma-Aldrich; Merck Millipore (Darmstadt, Germany). Sodium acetate, ammonium formate and acetonitrile were supplied by Beijing Chemical Works (Beijing, China). MNase, nuclease P1 and alkaline phosphatase were purchased from Takara Bio, Inc. (Otsu, Japan).

Analysis of cell viability

Cell proliferation was measured using a Cell Counting Kit-8 (CCK8; Beyotime Institute of Biotechnology, Inc., Jiangsu, China). Briefly, cells of the human hepatocarcinoma cell line HepG2 were cultured in RPMI-1640 supplemented with 10% fetal bovine serum (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and 1% antibiotics-antimycotics in a humidified 5% CO2 atmosphere at 37°C. Exponentially growing cells were seeded in a 96-well plate at a density of 1.0×104 cells/well. The following day, the cells were treated in triplicate with the various concentrations of 20(S)-ginsenoside Rg3 or 20(R)-ginsenoside Rg3 for 24 h at 37°C. Following incubation for 24 h, cell viability was assessed using the CCK8 assay, according to the manufacturer's protocol. Finally, the absorbance value was recorded at an optical density of 450 nm (OD450) using an enzyme-linked immunosorbent assay plate reader (Emax Plus; Molecular Devices, LLC, Sunnyvale, CA, USA). At least three independent experiments were performed, and the experiments involved three groups: Untreated HepG2 cells (not treated with ginsenoside Rg3), HepG2 cells treated with various concentrations of 20(S)-ginsenoside Rg3 or 20(R)-ginsenoside Rg3 as the experimental group, and a blank group of cell culture only. The inhibition rate was calculated using the following formula: [(untreated group OD450-experimental group OD450)/(untreated group OD450-blank group OD450)]x100%.

Measurement of global DNA methylation using HPLC

HPLC analysis was performed on a liquid chromatograph coupled with a Waters 2489 UV/visible detector (Waters Corporation, Milford, MA, USA). Separation was achieved on a Symmetry® C18 (5 µm; 4.6×250) column (Waters Corporation). The mobile phase consisted of solvent A (50 mM ammonium formate; pH 5.4) and solvent B (HPLC-grade acetonitrile). The following gradient program used was: Solvent B 2% at 0 min, solvent B 3% at 18 min, solvent B 27% at 25 min, solvent B 35% at 40 min and solvent B 2% at 45 min. The total duration of analysis was 50 min. The flow rate was set at 0.2 ml/min and the column oven temperature was maintained at 25°C. UV detection was performed at 277 nm.

The concentrations of MedC and dC were calculated from linear regression curves, and the percentage of methylation was then calculated using the following equation: 5-MedC (%)=[5-MedC/(dC+MedC)]x100.

Preparation of standards

The 5-MedC, dC, dA, dT and dG stock standard solutions were prepared by diluting purchased powder in appropriate volumes of HPLC grade water. All stock solutions were then mixed at an appropriate ratio to ensure all components were present at the same concentrations: 0.009765, 0.039625, 0.156250, 0.625000, 2.5 and 10 mM for 5-MedCand dC. All standard solutions were stored at −20°C and used within 1 week.

DNA extraction and hydrolysis

Exponentially growing HepG2 cells were seeded at a density 5.0×105 into 75 cm2 culture flasks and, following a 24 h period, the cells were either left untreated or were treated with 20(S)-ginsenoside Rg3 or 20(R)-ginsenoside Rg3, in accordance with the cell viability assessment. The cells were then collected, and DNA was purified using a Qiagen DNAeasy® blood and tissue kit (Qiagen GmbH, Hilden, Germany).

Cryonase™ cold-active nuclease (Takara Bio, Inc.), micrococcal nuclease (Takara Bio, Inc.) and digestion buffer comprising 20 mM Tris-HCl, 5 mM NaCl and 2.5 mM CaCl2 (pH 8.0) were added to the purified DNA and incubated at 37°C overnight. Alkaline phosphatase (calf intestine; 1 unit/pmol; Takara Bio, Inc.) was added to the samples, and incubation was continued for an additional 4 h. The hydrolyzed DNA was then centrifuged at 18,000 × g for 20 min at 4°C and adjusted to an appropriate concentration (~4 mM) in HPLC grade water for analysis using HPLC.

MspI/HpaII polymerase chain reaction (PCR) assay

The MspI/HpaII PCR assay was performed as follows: Purified genomic DNA (2 µg) from the control and ginsenoside Rg3-treated samples were digested with 20 units of methylation-sensitive enzymes (MspI or HpaII) in a 20-µl reaction volume using the buffers supplied by the manufacturer (Takara Bio, Inc.). The reaction mixtures were incubated overnight at 37°C. The digested DNA samples were purified with phenol:chloroform:isoamyl alcohol (25:24:1) and chloroform extraction, followed by ethanol precipitation.

PCR was performed with the undigested and digested DNA from the control and ginsenoside Rg3-treated samples. A total of 40 primers were designed based on the sequences of the promoter regions of Homo sapiens B cell lymphoma 2 (Bcl2; NIH accession no. EU119400; www.ncbi.nlm.nih.gov/nuccore/EU119400), Homo sapiens VEGF gene (NIH accession no. AF095785; www.ncbi.nlm.nih.gov/nuccore/AF095785) and Homo sapiens tumor protein P53 (TP53; NIH accession no. NG_017013; www.ncbi.nlm.nih.gov/nuccore/NG_017013). Each set of primers spanned one or more CCGG sites of the target gene. The primer names, primer sequences and positions of the CCGG sequence for each gene are listed in Table I. Each reaction mixture contained 1 µl DNA (~10 ng), 10 µl Premix Taq™ DNA Polymerase Hot-Start (Takara Bio, Inc.), 1 µl DNA primer (0.5 µM) and 7 µl ddH2O. The reaction was denatured at 95°C for 5 min, followed by 40 cycles of 95°C for 15 sec, 55°C for 45 sec and 72°C for 1 min, with a final incubation step at 72°C for 5 min. Following agarose gel electrophoretic separation and staining with ethidium bromide, the amplified products were visualized under UV irradiation. Images were captured for further analysis.

Table I.

Primers.

Table I.

Primers.

PrimerPrimer sequence (3′-5′)Position (bp)GeneNCBI accession no.
XZ-82 cagagtcacctgtcttcacag1617–1637BCL2EU119400
XZ-83 tctagccgtgtatgagagtgtg1750–1772BCL2EU119400
XZ-84 acacactctcatacacggctag1750–1751BCL2EU119400
XZ-85 cgccatgaaaacaagggctg1915–1934BCL2EU119400
XZ-86 cagcccttgttttcatggcg1915–1934BCL2EU119400
XZ-87 gccttctgctcaggcctg2060–2077BCL2EU119400
XZ-88 caggcctgagcagaaggc2060–2077BCL2EU119400
XZ-89 gcccgctccgctgcgc2154–2169BCL2EU119400
XZ-90 gcgcagcggagcgggc2154–2169BCL2EU119400
XZ-91 gttaaaggcgccgcggcag2250–2268BCL2EU119400
XZ-94 gaaccgtgtgacgttacgcac2344–2364BCL2EU119400
XZ-95 caccttcgctggcagcg2528–2544BCL2EU119400
XZ-96 caggaggaggagaaagggtg2647–2666BCL2EU119400
XZ-97 ggatgactgctacgaagttctc2724–2745BCL2EU119400
XZ-98 gcttctagcgctcggcac2828–2845BCL2EU119400
XZ-99 gacggaggcaggaatcctc2926–2944BCL2EU119400
XZ-100 gaggattcctgcctccgtc2926–2944BCL2EU119400
XZ-101 gcacaggcatgaatctctatccac3006–3028BCL2EU119400
XZ-102 gtggatagagattcatgcctgtg3006–3028BCL2EU119400
XZ-103 gcggcggcagatgaattac3109–3127BCL2EU119400
XZ-104 tctcgagctcttgagatctc3144–3163BCL2EU119400
XZ-105 gattcccagacttctgcttcac3194–3215BCL2EU119400
XZ-106 gccagactccacagtgcatac1370–1390VEGFAF095785
XZ-107 ctgagaacgggaagctgtgtg1442–1462VEGFAF095785
XZ-108 ccattccctctttagccagag1743–1763VEGFAF095785
XZ-109 cattcacccagcttccctgtg1806–1826VEGFAF095785
XZ-110 cactccaggattccaacagatc1930–1951VEGFAF095785
XZ-111 gagccgttccctctttgctag2017–2037VEGFAF095785
XZ-112 acgtaacctcactttcctgctc2053–2074VEGFAF095785
XZ-113 ccaccaaggttcacagcctg2142–2161VEGFAF095785
XZ-114 caggcttcactgggcgtc2199–2216VEGFAF095785
XZ-115 agcctcagcccctccacac2240–2258VEGFAF095785
XZ-116 tgtggaggggctgaggctc2241–2259VEGFAF095785
XZ-117 gatcctccccgctaccag2347–2364VEGFAF095785
XZ-118 ctggtagcggggaggatc2347–2364VEGFAF095785
XZ-119 gaatatcaaattccagcaccgag2483–2505VEGFAF095785
XZ-120 cggtgctggaatttgatattcattg2485–2509VEGFAF095785
XZ-121 aagccgtcggcccgattc2606–2623VEGFAF095785
XZ-162 ctccatttcctttgcttcctc4908–4928P53NG_017013
XZ-163 ctggcacaaagctggacagtc4964–4984P53NG_017013
XZ-164 cttctcaaaagtctagagccac5058–5079P53NG_017013
XZ-165 gcgtgtcaccgtcgtggaaag5141–5161P53NG_017013
XZ-166 tggagctttggggaaccttgag5422–5443P53NG_017013
XZ-167 gatgtgcaaagaagtacgctttag5449–5472P53NG_017013
XZ-168 ctaaagcgtacttctttgcacatc5449–5472P53NG_017013
XZ-169 cagacctcaatgctttgtgcatc5510–5532P53NG_017013
XZ-170 tcctagtgaaaactggggctc5592–5612P53NG_017013
XZ-171 gttgtgggaccttagcagcttg5651–5672P53NG_017013
XZ-172 caagctgctaaggtcccacaac5651–5672P53NG_017013
XZ-173 atcgctccaggaaggacaaaggtc5678–5701P53NG_017013
XZ-174 gacctttgtccttcctggagcgat5678–5701P53NG_017013
XZ-175 ctggtttagcacttctcacttccac5761–5785P53NG_017013
XZ-176 gtggaagtgagaagtgctaaaccag5761–5785P53NG_017013
XZ-177 ggcagaaatgtaaatgtggagc5853–5874P53NG_017013
XZ-48 acaaagaccaggatgagaag333–352DNMT1AF180682
XZ-49 cttctcatctttctcgtctc576–595DNMT1AF180682
XZ-52 cagaagcgggcaaagaacag659–676DNMT3aAF331856
XZ53 cttgcgcttgctgatgtagtag802–823DNMT3aAF331856
XZ-56 cagagtatcaggatgggaag965–984DNMT3bAF331857
XZ-57 agtttgtctgcagagacctc1132–1151DNMT3bAF331857
XZ-60 gacctcaactacatggtttac175–195GAPDHM33197
XZ-61 tgatgggatttccattgatg264–283GAPDHM33197
XZ-62 aggtgcatgtttgtgcctgtc875–895P53AB082923
XZ-63 tcttgcggagattctcttcctc916–937P53AB082923
XZ-64 gctgggatgcctttgtggaac2039–2059BCL2M13994
XZ-65 tgagcagagtcttcagagacag2102–2122BCL2M13994
XZ-66 ccaacatcaccatgcagattatg315–337VEGFAY047581
XZ-67 Tgctgtaggaagctcatctctc369–390VEGFAY047581

[i] BCL2, B cell lymphoma 2, VEGF, vascular endothelial growth factor; DNMT, DNA methyltransferase.

Reverse transcription-quantitative PCR (RT-qPCR) analysis

Total RNA was isolated from the cultured cells using the RNeasy® Mini kit (Qiagen GmbH) according to the manufacturer's protocol. cDNA was synthesized using a ReverTrace qPCR RT kit (Toyobo Co., Ltd., Osaka, Japan) using an oligo-dT primer, and qPCR was then performed using SYBR®-Green Realtime PCR Master mix (Toyobo Co., Ltd.) with forward and reverse primers for each gene. The sequences of the qPCR primers are listed in Table I. To avoid DNA contamination, at least one primer in each set spanned two exons. Each qPCR reaction mixture contained 1 µl cDNA, 10 µl SYBR® Green Real-Time PCR Master Mix (Toyobo Co., Ltd.), 1 µl DNA primer (0.5 µM) and 7 µl ddH2O. The PCR was performed in a StepOnePlus™ (Applied Biosystems; Thermo Fisher Scientific, Inc.) with the following thermal cycling protocol: 95°C for 5 min, followed by 40 cycles at 95°C for 15 sec and then at 60°C for 40 sec. The relative expression level of each targeted gene was normalized to the expression of GAPDH calculated using the 2−ΔΔCq quantification method (17).

Statistical analysis

All data were analyzed using descriptive one-way analysis of variance using the SPSS (version 16.0) software package (SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference. All data are presented as the mean ± standard deviation.

Results

Antiproliferative effects of 20(S)-ginsenoside Rg3 are more marked, compared with those of 20(R)-ginsenoside Rg3

Ginsenoside Rg3 can exist as either the R type or S type according to its asymmetric carbon atom (Fig. 1). It has been reported that the antiproliferative effects of the different ginsenoside Rg3 epimers are cell line-dependent. Wu et al (18) showed that the tumor inhibition rate achieved by 20(R)-ginsenoside Rg3 was significantly higher, compared with that by 20(S)-ginsenoside Rg3 in hepatoma (H22)-bearing mice. Kim et al (19) found that the antiproliferative effect of 20(S)-ginsenoside Rg3 was higher, compared with that of 20(R)-ginsenoside Rg3 in A549 cells at the same concentration. Park et al (20) reported that 20(S)-ginsenoside Rg3 reduced human gastric cancer cellular proliferation, whereas 20(R)-ginsenoside Rg3 had no effect. Cheong et al (21) showed that 20(S)-ginsenoside Rg3 had higher cytotoxic potency, compared with the 20(R) epimer in HepG2 cells.

Figure 1.

Chemical structure and HPLC chromatogram of 20(R)-ginsenoside Rg3 and 20(S)-ginsenoside Rg3. The X-axis shows the retention time and the Y-axis shows the voltage. The position of the asymmetric carbon atom in ginsenoside Rg3 is marked with a red circle. From the HPLC chromatograms of standards, the 20(R)-ginsenoside Rg3 retention time was ~11.5 min, compared with the 20(S)-ginsenoside Rg3 retention time of 10.5 min. (A) R type; (B) S type. HPLC, high performance liquid chromatography.

The present study confirmed the antiproliferative effects of 20(R)-ginsenoside Rg3 and 20(S)-ginsenoside Rg3 on the growth of HepG2 cells using a CCK8 assay, which offers higher sensitivity, compared with an MTT assay. The results (Fig. 2A) showed that treatment of cells with 20(S)-ginsenoside Rg3 over a concentration range of 15.63–500 µg/ml resulted in the inhibition of cellular proliferation, and the antiproliferative effect of 20(R)-ginsenoside Rg3 was observed over a concentration range of 31.25–500 µg/ml. Thus, the two epimers inhibited cellular proliferation in a concentration-dependent manner. As shown in Fig. 2B, the linear regression equation for 20(S)-ginsenoside Rg3 was Y=4.1296X-5.1012 (R2=0.9801) and the linear regression equation for 20(R)-ginsenoside Rg3 was Y=3.2054X-7.9504 (R2=0.9714). From these values, the LD50 of 20(S)-ginsenoside Rg3 was 178.03 µg/ml, whereas that of 20(R)-ginsenoside Rg3 was 326.84 µg/ml. Therefore, treatment with 20(S)-ginsenoside Rg3 resulted in more marked inhibition of cell growth, compared with treatment with 20(R)-ginsenoside Rg3. The doses selected for the treatment of cells in the subsequent experiments were 326.84 µg/ml 20(R)-ginsenoside Rg3 or 178.03 µg/ml 20(S)-ginsenoside Rg3.

Figure 2.

Inhibitory effect of ginsenoside Rg3 on HepG2 cell proliferation. (A) Growth inhibition curve for HepG2 cells treated with ginsenoside Rg3. HepG2 cells were treated with various concentrations (0, 7.81, 15.63, 31.25, 62.5, 125, 250 and 500 µg/ml) of ginsenoside Rg3 using a doubling dilution every 48 h, and cell viability was measured using a Cell Counting Kit-8 assay. (B) Linear regression equation of logarithm (base 10) concentration and inhibition ratio. The X-axis shows the logarithm (base 10) concentration of ginsenoside Rg3, and the Y-axis shows the mean value of the inhibition ratio.

Ginsenoside Rg3 induces alterations in DNA methylation globally and in the promoter regions of specific genes

The HPLC method used in the present study was modified from that of Fragou et al (22). In the present study, solvent B was changed from methanamide to acetonitrile, as acetonitrile was found to be more effective. From the HPLC chromatogram of standards, it was found that the C retention time was ~9 min and the 5-MedC retention time was ~16 min (Fig. 3A). The linear regression equation for C was Y=508781X+4356.14 (R2=0.99997; Fig. 3B), and the linear regression equation for MedC was Y=190820X+782.35 (R2=0.99999; Fig. 3B).

Figure 3.

Chromatogram and curve for standard dC and 5-MedC. (A) Chromatogram of standard nucleotide mixture. The same concentrations of a mixture of 5-MedC, dG, dT, dC and dA were diluted into various concentrations and detected using high performance liquid chromatography. dC and MedC are marked on the chart. The X-axis shows retention time and the Y-axis shows the voltage. (B) Linear regression curves for the dC and MedC. The X-axis shows the concentration of dC and MedC, and the Y-axis shows the peak area value. 5-MedC, 5-methyl-2′-deoxycytidine; dC, 2′-deoxycytidine.

The alterations in DNA methylation in the untreated HepG2 cells and HepG2 cells treated with ginsenoside Rg3 are shown in Fig. 4. The data showed that the average DNA methylation was 3.56±0.125% in the untreated cells, 3.36±0.082% in the 20(R)-ginsenoside Rg3-treated cells (P=0.115, vs. untreated group) and 2.66±0.111% in 20(S)-ginsenoside Rg3-treated cells (P=0.0115). The difference between DNA methylation in the 20(R)-ginsenoside Rg3 and 20(S)-ginsenoside Rg3 groups was also statistically significant (P=0.0327).

Figure 4.

Alterations in DNA methylation in HepG2 cells treated with ginsenoside Rg3. HepG2 cells were left untreated, or were treated with 326.84 µg/ml 20(R)-ginsenoside Rg3 or 178.03 µg/ml 20(S)-ginsenoside Rg3, and the DNA was purified and hydrolyzed prior to detection using high performance liquid chromatography. The percentage of cytosine methylation was calculated, and the values in the treatment groups were compared with those in the untreated group. *P<0.05, vs. control.

20(R)-ginsenoside Rg3 is known to induce the global hypermethylation of DNA; therefore, the present study examined whether 20(R)-ginsenoside Rg3 affected the methylation of the promoter region of a specific gene. Zhou et al (23) showed that ginsenoside Rg3 can inhibit HepG2 cell proliferation by downregulating the expression of VEGF. Yuan et al (24) reported that the protein expression of anti-apoptotic Bcl2 was downregulated and the protein expression of pro-apoptotic P53 was upregulated by 20(S)-ginsenoside Rg3 in HT-29 colon cancer cells. The present study obtained similar results, which showed that P53 was upregulated, and BCL2 and VEGF were downregulated by treatment of the HepG2 cells with ginsenoside Rg3 (Fig. 5A). Therefore, the present study examined whether the altered gene expression levels were associated with the methylation status of the promoter. The primers used are listed in Table I.

Figure 5.

Effect of ginsenoside Rg3 on the gene expression and promoter region DNA methylation of P53, BCL2 and VEGF. (A) Effect of ginsenoside Rg3 on the mRNA expression of Bcl2, p53 and VEGF. The values in the treated groups were compared with those in the untreated control group (*P<0.05 and **P<0.01). (B) Example of the effect of ginsenoside Rg3 on DNA methylation at the promoter region of Bcl2. (C) Example of the effect of ginsenoside Rg3 on DNA methylation at the promoter region of VEGF. (D) Example of the effect of ginsenoside Rg3 on the DNA methylation at the promoter region of P53. BCL2, B cell lymphoma 2; VEGF, vascular endothelial growth factor; L, DNA ladder; U, undigested; M, digested with MspI; H, digested with HpaII.

The results of the MspI/HpaII PCR analysis of DNA methylation alterations in BCL2, VEGF and P53 genes induced by ginsenoside Rg3 treatment are shown in Fig. 5. Alterations in DNA methylation at the CCGG sequence (2371–2374 bp) were identified in the promoter of BCL2 induced by ginsenoside Rg3, compared with the untreated control. As shown in Fig. 5B, no significant amplification band was detected in the 20(R)-ginsenoside Rg3-treated sample digested by HpaII or MspI, or in the 20(S)-ginsenoside Rg3-treated sample digested by MspI. However, a weak specific band was observed in the 20(S)-ginsenoside Rg3-treated sample digested by HpaII. These data indicated that the cytosine demethylation at this site was induced by ginsenoside Rg3, and that 20(R)-ginsenoside Rg3 had a higher potential to induce methylation at this site, compared with 20(S)-ginsenoside Rg3. Alterations in DNA methylation at the CCGG sequence (1,981–1,984 bp) in the VEGF promoter are shown in Fig. 5C. No significant differences were found in the amplification profiles among the three groups, which indicated that the DNA methylation status was not altered following ginsenoside Rg3 treatment. Alterations in DNA methylation at the CCGG sequence (5,641–5,644 bp) in the P53 promoter are shown in Fig. 5D, and an amplification band was found in the untreated control and 20(R)-ginsenoside Rg3-treated sample digested by HpaII, however, no band was observed for the 20(S)-ginsenoside Rg3-treated sample digested by HpaII. These data indicated that DNA methylation was decreased upon treatment with 20(S)-ginsenoside Rg3 at this site, whereas the DNA methylation status remained unchanged (Table II). If the band patterns remained unchanged, compared with those of the untreated control group, it was scored 0. If the patterns showed that cytosine methylation was increased, it was scored 1. If the patterns showed that cytosine methylation was decreased, it was scored 2. The results of the MspI/HpaII PCR analysis showed that the percentages of CCGG sites remaining unchanged were 52 and 64% following treatment with 20(R)-ginsenoside Rg3 and 20(S)-ginsenoside Rg3, respectively. The percentages of methylated bands were 24 and 16% in the 20(R)-ginsenoside Rg3 and 20(S)-ginsenoside Rg3-treated groups, whereas the percentages of demethylated bands were 24 and 20% in the 20(R)-ginsenoside Rg3- and 20(S)-ginsenoside Rg3-treated group, respectively. From the data in Table II, it was found that the level of DNA methylation was decreased at the promoter region of P53 and BCL2 in cells treated with 20(S)-ginsenoside Rg3, and that the gene expression of P53 was increased, whereas that of BCL2 was decreased. The level of DNA methylation was increased in the promoter region of VEGF and decreased in that of P53 upon treatment with 20(R)-ginsenoside Rg3. In addition, the gene expression of VEGF was decreased, whereas that of P53 was increased. These results indicated that gene expression was not only associated with the level of DNA methylation, but was also associated with specific sites in the promoter region of the gene.

Table II.

MspI/HpaII polymerase chain reaction assay.

Table II.

MspI/HpaII polymerase chain reaction assay.

Methylation score

GenePrimers usedPosition of CCGG site (bp)R-Rg3S-Rg3
Bcl2XZ-82/XZ-831701–1704; 1715–171800
Bcl2XZ-84/XZ-851903–190600
Bcl2XZ-86/XZ-871977–1980; 1982–1985; 2000–200311
Bcl2XZ-88/XZ-892141–214400
Bcl2XZ-90/XZ-912176–2179; 2181–2184; 2198–2199; 2225–222802
Bcl2XZ-94/XZ-952371–237420
Bcl2XZ-96/XZ-972673–2676; 2689–269200
Bcl2XZ-98/XZ-992844–294700
Bcl2XZ-100/XZ-1012946–294912
Bcl2XZ-102/XZ-1033095–309800
Bcl2XZ-104/XZ-1053163–316620
Bcl2 total 1: 18%1: 9%
2: 18%2: 18%
VEGFXZ-106/XZ-1071435–143821
VEGFXZ-110/XZ-1111981–198400
VEGFXZ-112/XZ-1132120–212310
VEGFXZ-114/XZ1152225–222800
VEGFXZ-116/XZ-1172275–2278; 2285–2288; 2299–230211
VEGFXZ-118/XZ-1192384–238510
VEGFXZ-120/XZ-1212512–251522
VEGF total 1: 42%1: 29%
2: 29%2: 14%
P53XZ-162/XZ1634928–493101
P53XZ-164/XZ-1655108–511122
P53XZ-168/XZ-1695476–547910
P53XZ-170/XZ-1715641–564402
P53XZ-172/XZ-1735675–567820
P53XZ-174/XZ-1755717–572000
P53XZ-176-XZ-1775831–583400
P53 total 1: 14%1: 14%
2: 29%2: 29%
Overall total 1: 24%1: 16%
2: 24%2: 20%

[i] 0, unchanged; 1, methylation; 2, demethylation; Bcl2, B cell lymphoma 2, VEGF, vascular endothelial growth factor.

DNMT1 is upregulated, and DNMT3a and DNMT3b are downregulated by ginsenoside Rg3

The expression levels of DNMTs are closely linked to DNA methylation patterns. To investigate the molecular mechanism of cytosine methylation induced by ginsenoside Rg3, the mRNA levels of DNMT1, DNMT3a and DNAMT3b were measured using RT-qPCR analysis following the treatment of HepG2 cells with ginsenoside Rg3 for 24 h. As shown in Fig. 6, the exposure of HepG2 cells to ginsenosides Rg3 significantly increased the mRNA expression of DNMT1, compared with that in the untreated cells (P<0.001). However, the mRNA expression levels of DNMT3a and DNMT3b showed significant decreases following exposure to ginsenoside Rg3 (P<0.001), compared with the untreated cells, particularly the mRNA level of DNMT3a, which was reduced to <0.25% of that in the untreated cells. Therefore, 20(S)-ginsenoside Rg3 treatment differentially regulated the expression of DNMT, possibly resulting in a decrease of global demethylation.

Figure 6.

Effect of ginsenoside Rg3 on the expression of DNMT1 and DNMT3. *P<0.05 and **P<0.01, vs. untreated control. DNMT, DNA methyltransferase.

Discussion

Several reports have demonstrated that ginsenoside Rg3 has pharmacological actions through regulating gene expression (25). In the present study, the CCK8 data showed that the ability of 20(S)-ginsenoside Rg3 to inhibit HepG2 cell growth was more marked, compared with that of 20(R)-ginsenoside Rg3. The HPLC assay also demonstrated that 20(S)-ginsenoside Rg3 induced a more marked reduction in global DNA methylation, compared with 20(R)-ginsenoside Rg3. DNA hypomethylation has been reported in hepatocellular carcinoma and hypomethylation is associated with DNA damage, the promotion of carcinogenesis and activation of tumor suppressor genes (16). Thus, DNA hypomethylation induced by ginsenoside Rg3, particularly 20(S)-ginsenoside Rg3, may be responsible for the inhibition of HepG2 cell proliferation.

The present study further investigated the effect of ginsenoside Rg3 on the methylation of the promoter regions of specific genes. In total, three genes were selected, which are closely associated with tumor angiogenesis, growth and apoptosis. P53 is important in apoptosis, genomic stability and the inhibition of angiogenesis, and its expression is increased by ginsenoside-Rg3 treatment (26). VEGF stimulates vasculogenesis and angiogenesis. The overexpression of VEGF can cause vascular disease and the development of cancer. A decrease in its expression is induced by 20-ginsenoside Rg3 (23). Bcl2 inhibits cell apoptosis and is classified as an oncogene. The expression was increased by 20-ginsenoside Rg3 (5). Classically, hypermethylation of the promoter region is associated with gene silencing, and hypomethylation of the promoter region is correlated with gene activation. In the present study study, it was found that hypomethylation of the promoter region of P53 was consistent with gene activation. DNA methylation of the promoter regions of BCL2 were unchanged or decreased, however, the methylated sites of the promoter region and the gene expression were altered, suggesting that the DNA methylation level and the specific methylated site of the promoter region may be important for gene expression.

DNMTs are responsible for continued and de novo DNA methylation. DNMT1 maintains the DNA methylation status by maintaining the transfer of methyl groups to the newly synthesized DNA strands during DNA replication. DNMT3a and DNMT3b introduce the novel methylated cytosine site to the unmodified cytosine residues. Oh et al (27) reported that the DNA methylation and expression of DNMT1, DNMT3a and DNMT3b were higher in hepatocellular carcinoma, compared with those in normal liver tissue. In the present study, it was found that treatment with ginsenoside Rg3 increased the relative mRNA levels of DNMT1, but significantly reduced the levels of DNMT3a and DNMT3b. Therefore, low expression levels of DNMT3a and DNMT3b may account for decreased methylation, although high levels of DNMT1 expressed during DNA replication maintained the methylation pattern.

20(S)-Ginsenoside Rg3 and 20(R)-ginsenoside Rg3 have exhibited stereo-specific effects in several studies. For example, Kim et al (19) showed that 20(R)-ginsenoside Rg3 regulates the expression of multiple genes during the initiation of the transforming growth factor-β1-induced epithelial-mesenchymal transition and suppresses lung cancer development, whereas 20(S)-ginsenoside Rg3 does not. Park et al (20) showed that 20(S)-ginsenoside Rg3 has more potent anticancer activity, compared with 20(R)-ginsenoside Rg3 in inducing human gastric cancer cell apoptosis. In the present study, 20(S)-ginsenoside Rg3 exhibited more potent antiproliferative effects on HepG2 cells and induced a more marked reduction in the methylation of global DNA and CpG islands, compared with 20(R)-ginsenoside Rg3, and reduced the expression levels of DNMT3a and DNMT3b. Thus, the different ginsenoside Rg3 epimers exhibit different stereo-specific effects in different types of cell, and selection of the appropriate epimer is required for treating different diseases.

In conclusion, data obtained in the present study indicated that ginsenoside Rg3 inhibited HepG2 cell proliferation in a dose-dependent manner, induced a reduction in the methylation of global genomic DNA and, for a promoter region of a specific gene, upregulated the expression of DNMT1 and downregulated the expression of DNMT3a and DNMT3b. In addition, 20(S)-ginsenoside Rg3 exhibited superior biological activity, compared with 20(S)-ginsenoside Rg3. These data indicated that 20(S)-ginsenoside Rg3 may offer increased potential, compared with 20(R)-ginsenoside Rg3, as an adjuvant treatment for hepatocellular carcinoma.

Acknowledgements

The authors would like to thank the National Natural Science Foundation of China (grant no. 31200953) and the China Postdoctoral Science Foundation Funded Project (grant no. 2013M530977) for financial support.

References

1 

Shan X, Fu YS, Aziz F, Wang XQ, Yan Q and Liu JW: Ginsenoside Rg3 inhibits melanoma cell proliferation through down-regulation of histone deacetylase 3 (HDAC3) and increase of p53 acetylation. PLoS One. 9:e1154012014. View Article : Google Scholar : PubMed/NCBI

2 

Joo EJ, Chun J, Ha YW, Ko HJ, Xu MY and Kim YS: Novel roles of ginsenoside Rg3 in apoptosis through downregulation of epidermal growth factor receptor. Chem Biol Interact. 233:25–34. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Shan X, Tian LL, Zhang YM, Wang XQ, Yan Q and Liu JW: Ginsenoside Rg3 suppresses FUT4 expression through inhibiting NF-κB/p65 signaling pathway to promote melanoma cell death. Int J Oncol. 47:701–709. 2015.PubMed/NCBI

4 

Zeng D, Wang J, Kong P, Chang C and Li J and Li J: Ginsenoside Rg3 inhibits HIF-1α and VEGF expression in patient with acute leukemia via inhibiting the activation of PI3K/Akt and ERK1/2 pathways. Int J Clin Exp Pathol. 7:2172–2178. 2014.PubMed/NCBI

5 

Luo Y, Zhang P, Zeng HQ, Lou SF and Wang DX: Ginsenoside Rg3 induces apoptosis in human multiple myeloma cells via the activation of Bcl-2-associated X protein. Mol Med Rep. 12:3557–3562. 2015.PubMed/NCBI

6 

Ge X, Zhen F, Yang B, Yang X, Cai J, Zhang C, Zhang S, Cao Y, Ma J, Cheng H and Sun X: Ginsenoside Rg3 enhances radiosensitization of hypoxic oesophageal cancer cell lines through vascular endothelial growth factor and hypoxia inducible factor 1α. J Int Med Res. 42:628–640. 2014. View Article : Google Scholar : PubMed/NCBI

7 

Kim JH, Cho SY, Lee JH, Jeong SM, Yoon IS, Lee BH, Lee JH, Pyo MK, Lee SM, Chung JM, et al: Neuroprotective effects of ginsenoside Rg3 against homocysteine-induced excitotoxicity in rat hippocampus. Brain Res. 1136:190–199. 2007. View Article : Google Scholar : PubMed/NCBI

8 

Yoon SJ, Park JY, Choi S, Lee JB, Jung H, Kim TD, Yoon SR, Choi I, Shim S and Park YJ: Ginsenoside Rg3 regulates S-nitrosylation of the NLRP3 inflammasome via suppression of iNOS. Biochem Biophys Res Commun. 463:1184–1189. 2015. View Article : Google Scholar : PubMed/NCBI

9 

Paska AV and Hudler P: Aberrant methylation patterns in cancer: A clinical view. Biochem Med (Zagreb). 25:161–176. 2015. View Article : Google Scholar : PubMed/NCBI

10 

Poke FS, Qadi A and Holloway AF: Reversing aberrant methylation patterns in cancer. Curr Med Chem. 17:1246–1254. 2010. View Article : Google Scholar : PubMed/NCBI

11 

Price RJ, Lillycrop KA and Burdge GC: Folic acid supplementation in vitro induces cell type-specific changes in BRCA1 and BRCA 2 mRNA expression, but does not alter DNA methylation of their promoters or DNA repair. Nutr Res. 35:532–544. 2015. View Article : Google Scholar : PubMed/NCBI

12 

Gadgil MS, Joshi KS, Naik SS, Pandit AN, Otiv SR and Patwardhan BK: Association of homocysteine with global DNA methylation in vegetarian Indian pregnant women and neonatal birth anthropometrics. J Matern Fetal Neonatal Med. 27:1749–1753. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Sie KK, Li J, Ly A, Sohn KJ, Croxford R and Kim YI: Effect of maternal and postweaning folic acid supplementation on global and gene-specific DNA methylation in the liver of the rat offspring. Mol Nutr Food Res. 57:677–685. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Sceusi EL, Loose DS and Wray CJ: Clinical implications of DNA methylation in hepatocellular carcinoma. HPB (Oxford). 13:369–376. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Komatsu Y, Waku T, Iwasaki N, Ono W, Yamaguchi C and Yanagisawa J: Global analysis of DNA methylation in early-stage liver fibrosis. BMC Med Genomics. 5:52012. View Article : Google Scholar : PubMed/NCBI

16 

Nishida N and Kudo M: Alteration of epigenetic profile in human hepatocellular carcinoma and its clinical implications. Liver Cancer. 3:417–427. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

18 

Wu R, Ru Q, Chen L, Ma B and Li C: Stereospecificity of ginsenoside Rg3 in the promotion of cellular immunity in hepatoma H22-bearing mice. J Food Sci. 79:H1430–H1435. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Kim YJ, Choi WI, Jeon BN, Choi KC, Kim K, Kim TJ, Ham J, Jang HJ, Kang KS and Ko H: Stereospecific effects of ginsenoside 20-Rg3 inhibits TGF-β1-induced epithelial-mesenchymal transition and suppresses lung cancer migration, invasion and anoikis resistance. Toxicology. 322:23–33. 2014. View Article : Google Scholar : PubMed/NCBI

20 

Park EH, Kim YJ, Yamabe N, Park SH, Kim HK, Jang HJ, Kim JH, Cheon GJ, Ham J and Kang KS: Stereospecific anticancer effects of ginsenoside Rg3 epimers isolated from heat-processed American ginseng on human gastric cancer cell. J Ginseng Res. 38:22–27. 2014. View Article : Google Scholar : PubMed/NCBI

21 

Cheong JH, Kim H, Hong MJ, Yang MH, Kim JW, Yoo H, Yang H, Park JH, Sung SH, Kim HP and Kim J: Stereoisomer-specific anticancer activities of ginsenoside Rg3 and Rh2 in HepG2 cells: Disparity in cytotoxicity and autophagy-inducing effects due to 20(S)-epimers. Biol Pharm Bull. 38:102–108. 2015. View Article : Google Scholar : PubMed/NCBI

22 

Fragou D, Zanos P, Kouidou S, Njau S, Kitchen I, Bailey A and Kovatsi L: Effect of chronic heroin and cocaine administration on global DNA methylation in brain and liver. Toxicol Lett. 218:260–265. 2013. View Article : Google Scholar : PubMed/NCBI

23 

Zhou B, Wang J and Yan Z: Ginsenoside Rg3 attenuates hepatoma VEGF overexpression after hepatic artery embolization in an orthotopic transplantation hepatocellular carcinoma rat model. Onco Targets Ther. 7:1945–1954. 2014. View Article : Google Scholar : PubMed/NCBI

24 

Yuan HD, Quan HY, Zhang Y, Kim SH and Chung SH: 20(S)-Ginsenoside Rg3-induced apoptosis in HT-29 colon cancer cells is associated with AMPK signaling pathway. Mol Med Rep. 3:825–831. 2010.PubMed/NCBI

25 

Lü JM, Yao Q and Chen C: Ginseng compounds: An update on their molecular mechanisms and medical applications. Curr Vasc Pharmacol. 7:293–302. 2009. View Article : Google Scholar : PubMed/NCBI

26 

Zhang F, Li M, Wu X, Hu Y, Cao Y, Wang X, Xiang S, Li H, Jiang L, Tan Z, et al: 20(S)-ginsenoside Rg3 promotes senescence and apoptosis in gallbladder cancer cells via the p53 pathway. Drug Des Devel Ther. 9:3969–3987. 2015.PubMed/NCBI

27 

Oh BK, Kim H, Park HJ, Shim YH, Choi J, Park C and Park YN: DNA methyltransferase expression and DNA methylation in human hepatocellular carcinoma and their clinicopathological correlation. Int J Mol Med. 20:65–73. 2007.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Teng S, Wang Y, Li P, Liu J, Wei A, Wang H, Meng X, Pan D and Zhang X: Effects of R type and S type ginsenoside Rg3 on DNA methylation in human hepatocarcinoma cells. Mol Med Rep 15: 2029-2038, 2017.
APA
Teng, S., Wang, Y., Li, P., Liu, J., Wei, A., Wang, H. ... Zhang, X. (2017). Effects of R type and S type ginsenoside Rg3 on DNA methylation in human hepatocarcinoma cells. Molecular Medicine Reports, 15, 2029-2038. https://doi.org/10.3892/mmr.2017.6255
MLA
Teng, S., Wang, Y., Li, P., Liu, J., Wei, A., Wang, H., Meng, X., Pan, D., Zhang, X."Effects of R type and S type ginsenoside Rg3 on DNA methylation in human hepatocarcinoma cells". Molecular Medicine Reports 15.4 (2017): 2029-2038.
Chicago
Teng, S., Wang, Y., Li, P., Liu, J., Wei, A., Wang, H., Meng, X., Pan, D., Zhang, X."Effects of R type and S type ginsenoside Rg3 on DNA methylation in human hepatocarcinoma cells". Molecular Medicine Reports 15, no. 4 (2017): 2029-2038. https://doi.org/10.3892/mmr.2017.6255
Copy and paste a formatted citation
x
Spandidos Publications style
Teng S, Wang Y, Li P, Liu J, Wei A, Wang H, Meng X, Pan D and Zhang X: Effects of R type and S type ginsenoside Rg3 on DNA methylation in human hepatocarcinoma cells. Mol Med Rep 15: 2029-2038, 2017.
APA
Teng, S., Wang, Y., Li, P., Liu, J., Wei, A., Wang, H. ... Zhang, X. (2017). Effects of R type and S type ginsenoside Rg3 on DNA methylation in human hepatocarcinoma cells. Molecular Medicine Reports, 15, 2029-2038. https://doi.org/10.3892/mmr.2017.6255
MLA
Teng, S., Wang, Y., Li, P., Liu, J., Wei, A., Wang, H., Meng, X., Pan, D., Zhang, X."Effects of R type and S type ginsenoside Rg3 on DNA methylation in human hepatocarcinoma cells". Molecular Medicine Reports 15.4 (2017): 2029-2038.
Chicago
Teng, S., Wang, Y., Li, P., Liu, J., Wei, A., Wang, H., Meng, X., Pan, D., Zhang, X."Effects of R type and S type ginsenoside Rg3 on DNA methylation in human hepatocarcinoma cells". Molecular Medicine Reports 15, no. 4 (2017): 2029-2038. https://doi.org/10.3892/mmr.2017.6255
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team