International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
MicroRNAs (miRs) are small (20–25 nucleotides) endogenous regulatory non-coding RNAs present in eukaryotes. Previous studies have revealed an important role for miRNAs in oncogenesis and tumor metabolism (1–3). Expression of specific miRNAs (including miR-15a, miR-16-1, miR-155, miR-17-92, miR-0372, miR-373 and Let-7) has been demonstrated in various tumor tissues, and ~50% of these miRNAs are positioned in tumor-related fragile sites of the genome (1–4). Therefore, miRNAs are crucial in the occurrence and development of tumors.
Various tumor-associated specific molecular markers, such as miRs, are important in the early diagnosis of cancer and other diseases (5). miR expression in cancer tissues is dysregulated (2,3,6), and their expression pattern exhibits a certain degree of tissue specificity (7,8). miR-205 is a multi-functional gene located in the 1q32.2 locus of the human genome, and is involved in various physiological and pathological processes, including tumorigenesis, inflammation and immunity (8). miR-205 is abnormally expressed in a variety of malignant tumors and its expression is closely related to the incidence and development of tumors, such as head and neck cancer, ovarian cancer and breast cancer (8–10). Previously, Lebanony et al (11) and the authors (12) both reported that miR-205 expression is significantly increased in non-small cell lung cancer (NSCLC) tissues, and that it is associated with tumor differentiation grade (12). However, the function of miR-205-5p in lung cancer remains poorly understood.
In the present study, the aim was to explore the effects of miR-205-5p on proliferation, apoptosis, and invasion of A549 lung cancer cells. The results of the present study may provide important information about the role of miR-205-5p in the biological functions of lung cancer cells and might provide new potential targets for lung cancer treatment.
A549 human lung carcinoma cells were cultured in RPMI-1640 medium (Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 10% fetal bovine serum (FBS; Thermo Fisher Scientific, Inc.), 100 IU/ml penicillin, and 1 µg/ml streptomycin in 5% CO2 at 37°C. Cells were passaged every 2–3 days. Prior to transfection, cells were seeded in 24-well plates at 1×105 cells/well. Cells were cultured until 90% confluence. hsa-miR-205-5p inhibitor small interfering RNA (5′-AATTCCAGACTCCGGTGGAATGAAGGACGATCAGACTCCGGTGGAATGAAGGAACCGGTCAGACTCCGGTGGAATGAAGGATCACCAGACTCCGGTGGAATGAAGGATTTTTTACCGG-3′; Hibio Technologies Co., Ltd., Hangzhou, China) or miRNA inhibitor scramble negative control (cat. no. A06001; Shanghai GenePharma Co., Ltd., Shanghai, China) were diluted in 100 µl Opti-MEM (Thermo Fisher Scientific, Inc.) and mixed with 1 µl Lipofectamine 2000 (Thermo Fisher Scientific, Inc.) diluted in 100 µl Opti-MEM. The transfection solution (200 µl/well) was added to the 24-well plate. Following 4–6 h, the solution was replaced by only RPMI-1640 medium.
The cells were divided into three groups: control check group (CK; untransfected cells), negative control group (NC; cells transfected with scramble negative control siRNA) and hsa-miR-205-5p siRNA group (siRNA; cells transfected with has-miR-205-5p inhibitor siRNA). At one day prior to transfection, A549 cells, in the logarithmic phase of growth, were diluted to 1×104 cells/ml with RPMI-1640 complete medium and were seeded into 96-cell plates (100 µl/well). The cells were cultured at 37°C with 5% CO2 to obtain a confluence of ~30% at 24 h. The cells were then transfected as described above and cultured for an additional 72 h. At 24, 48 and 72 h post-transfection, 10 µl Cell Counting kit-8 solution (Dojindo Molecular Technologies, Inc., Kumamoto, Japan) was added to each well, and the culture was continued for 1 h. Absorbance was then measured in a ELx800 spectrophotometer (BioTek Instruments, Inc., Winooski, VT, USA) at 450 nm. Cell survival rate (%) was calculated as follows: (OD of each experimental group/OD of the CK group) ×100.
Following transfection for 24, 48 and 72 h, cells were dissociated using EDTA-free trypsin, centrifuged at 252 × g rpm for 5 min at 4°C, and the medium was discarded. Cells were rinsed twice with cooled PBS and suspended in 400 µl 1x binding buffer, as per the kit's instructions (Alexa Fluor 488 Annexin V/Dead Cell Apoptosis kit; Thermo Fisher Scientific, Inc.). Annexin V-Alexa Fluor 488 (5 µl) and propidium iodide (1 µl) were then added and cells were analyzed using a BD FACSVerse flow cytometer (BD Biosciences) and BD FACSuite software (version 1.0.0.1477; BD Biosciences, Franklin Lakes, NJ, USA).
Matrigel was liquefied at 4°C and diluted with cooled serum-free RPMI-1640 medium. Then, 100 µl diluted gel was added to the upper chamber of a 24-well Transwell plate, and incubated at 37°C overnight in order to solidify. Following incubation, the gel was gently washed with serum-free RPMI-1640 medium. Cells were dissociated following transfection for 24, 48 and 72 h, and diluted to 1×105 cells/ml in 1% FBS/RPMI-1640. The cells (200 µl) were then added to the upper chamber of the Transwell and 10% FBS/RPMI-1640 medium was added to the lower chamber as a chemoattractant. Following 24 h, the non-invaded cells on the upper side of the chamber filters were removed with cotton swabs, and filters were air-dried. Finally, filters were stained with 0.1% crystal violet. Invaded cells were calculated as cells/field by imaging four random fields (magnification, ×200).
Total RNA was extracted using TRIzol (Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. Purity was determined using the A260/A280 and A260/A230 ratios. RNA quality with A260/A280 of 1.8–2.0 was determined adequate for RT-qPCR. Reverse transcription was performed using 10 µl total RNA, 4 µl 5X reaction buffer, 1 µl RiboLock RNase inhibitor (Thermo Fisher Scientific, Inc.), 2 µl 10 mM dNTP, 1 µl RevertAid reverse transcriptase (Thermo Fisher Scientific, Inc.), and 1 µl 10 µM primers. cDNA was stored at −70°C. RT-qPCR was performed using 12.5 µl iQ SYBR-Green Supermix (Bio-Rad Laboratories, Inc., Hercules, CA, USA), 1 µl 10 µM primers, and 10.5 µl cDNA in a Real-time PCR ABI Prism 7500 system (Applied Biosystems; Thermo Fisher Scientific, Inc.). PCR parameters were: 50°C for 3 min and 95°C for 3 min, followed by 40 cycles of 95°C for 10 sec, 65°C for 20 sec, 72°C for 15 sec, and a final step of 76°C for 5 sec. Primer sequences were: miR-205-5p stem-loop, 5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGCCAATA-3′; miR-205-5p (accession no. MIMAT0000069; product size 66 bp), forward 5′-TATCCAGTGCAGGGTCCGAGGTAT-3′ and reverse 5′-CGGCGGTAGCAGCACGTAAATAT-3′; RNU6B (internal reference), forward 5′-CTCGCTTCGGCAGCACA-3′ and reverse 5′-AACGCTTCACGAATTTGCGT-3′. For erb-B2 receptor kinase 3 (erbB3), zinc finger E-box binding homeobox 2 (ZEB2), clathrin heavy chain (CLTC) and mediator complex subunit 1 (MED1), the following primers were used: GAPDH (internal reference; Genbank ID 2597; product size 258 bp), forward 5′-AGAAGGCTGGGGCTCATTTG-3′ and reverse 5′-AGGGGCCATCCACAGTCTTC-3′; erbB-3 (Genbank ID 2065; product size 225 bp), forward 5′-TGCTGAGAACCAATACCAGACA-3′ and reverse 5′-GCAAACTTCCCATCGTAGACC-3′; ZEB2 (Genbank ID 9839; product size 283 bp), forward 5′-CGTACTCGCAGCACATGAATC-3′ and reverse 5′-TCCTCCTCGAACTCCTCGTC-3′; CLTC (Genbank ID 1213; product size 111 bp), forward 5′-TCCAGAACCTGGGTATCAACC-3′ and reverse 5′-TTACCACCTGGGCCTGCTC-3′; and MED1 (Genbank ID 5469; product size 123 bp), forward 5′-GTGGCTCTTCCATGTCATCCT-3′ and reverse 5′-TGGTGACAACCCCATGCTTC-3′.
The hsa-miR-205-5 sequences were acquired from miRBase (http://www.mirbase.org; hsa-miR-205-5p; MIMAT0000 266) (13). The hsa-miR-205-5p target genes were predicted using three network platforms: TargetScan (http://www.targetscan.org/vert_61/) (14), 416 loci of conservative target sequences; PicTar (http://pictar.mdc-berlin.de/) (15), 274 loci of conservative target sequences; and miRDB (http://mirdb.org/miRDB/) (16), 421 loci of conservative target sequences.
Using miRDB and TargetScan2, there were 157 common sequences. Using TargetScan2 and PicTar, there were 70 common sequences. Using TargetScan2, PicTar, and miRDB, there were 33 common sequences. The predicted target genes were analyzed using the Gene Ontology Consortium (17–18) and Mas 3.0 Molecule Annotation System (http://bioinfo.capitalbio.com/mas3/) (18). Finally, 16 genes were analyzed, and the miRDB and TargetScan2 common sequences were considered as references.
Cells were dissociated with trypsin and centrifuged at 600 × g at 4°C for 5 min. Cells were resuspended in PBS and centrifuged a second time. RIPA lysis buffer (Applygen Technologies, Inc., Beijing, China) was then added. Following lysis, samples were centrifuged at 16, 099 × g at 4°C for 10 min. The supernatant was transferred to a new centrifuge tube and stored at −70°C. Protein concentration was determined using the bicinchoninic acid assay method (Applygen Technologies, Inc.). Protein samples (20 µg) were diluted with sample buffer and denatured at 95°C for 5 min. Proteins were separated using 10% SDS-PAGE at 25 mA for 30 min and then at 30 mA for 2 h. Proteins were transferred to a polyvinylidene fluoride membrane at 200 mA overnight. Membranes were blocked with 5% non-fat milk or bovine serum albumin at room temperature overnight. The membranes were incubated at room temperature for 2 h with the following primary antibodies: TRAP220/MED1 (1:1,000 dilution; cat. no. ab64695; Abcam, Cambridge, MA, USA), Smad Interacting Protein 1 (1:2,000 dilution; cat. no. ab25837; Abcam), HER3/ErbB3 (1:1,000 dilution; cat. no. 4754S; Cell Signaling Technology, Inc., Danvers, MA, USA), clathrin heavy chain (P1663) antibody (1:2,000 dilution; 2410S; Cell Signaling Technology, Inc.) and β-actin (1:1,000 dilution; cat. no. SC-47778; Santa Cruz Biotechnology, Inc., Dallas, TX, USA). The membranes were rinsed thrice for 15 min each time. Membranes were incubated with the secondary antibody (goat anti-rabbit immunoglobulin G-horseradish peroxidase; 1:5,000 dilution; cat. no. BS13278; Bioworld Technology Inc., Louis Park, MN, USA) for 45 min at room temperature and rinsed thrice. Membranes were developed using an enhanced chemiluminescence kit (Pierce; Thermo Fisher Scientific, Inc.). The relative band intensity was acquired using the Quantity One software version 4.4 (Bio-Rad Laboratories, Inc.).
Statistical analysis was performed using SPSS software (version, 12.0; SPSS. Inc., Chicago, IL, USA). Data were expressed as mean ± standard deviation and analyzed using analysis of variance with Tukey's post-hoc test. P<0.05 was considered to indicate a statistically significant difference.
Firstly, the efficiency of silencing miR-205-5p expression by siRNA transfection was validated. There were no differences in miR-205-5p expression levels between the CK and NC groups (P>0.05), while miR-205-5p expression levels were significantly reduced in the miR-205-5p siRNA group compared with the CK and NC group (P<0.01; Fig. 1).
Next, the effect of silencing miR-205-5p expression on cell viability was assessed in A549 cells. The relative survival rates at 24, 48 and 72 h post-siRNA transfection in the NC group were 100.0±2.6, 100.0±5.6 and 89.2±7.7%, respectively, while those in the miR-205-5p siRNA group were 78.1±3.0, 93.9±3.8 and 76.0±13.0%, respectively (P<0.01 for 24 h and P<0.05 for 48 h; Fig. 2). However, there were no significant differences between the NC and CK groups, suggesting that the negative control scramble siRNA had no effect on cell viability (P>0.05; Fig. 2).
The effect of silencing miR-205-5p expression was then examined on cell apoptosis in A549 cells. At 24, 48 and 72 h following transfection with miR-205-5p siRNA, the % of apoptotic cells in the total cell population in the miR-205-5p siRNA group were 12.6±2.5, 9.3±1.7 and 2.4±0.2%, respectively, while in the NC group, these were 3.1±0.8, 1.1±0.3, and 0.6±0.2%, respectively (P<0.01; Fig. 3).
The effect of silencing miR-205-5p expression on cell invasion of A549 cells was examined. The average number of invaded cells per field at 24 and 48 h following transfection with miR-205-5p siRNA were 93±20 and 91±18 in miR-205-5p siRNA group, respectively, while those in the NC group were 131±17 and 135±26, respectively (P<0.05; Fig. 4).
In order to explore the pathways involved in the effects of miR-205-5p, the potential target genes of miR-205-5p were predicted by bioinformatics analysis, using miRDB, TargetScan and PicTar web-based software (data not shown). Bioinformatics analysis revealed 16 candidate miR-205-5p target genes (Table I). Based on to the annotated functions for these genes, erbB3 (involved in cell proliferation), ZEB2 (promoter of metastasis), CLTC (promoter of tumor growth and angiogenesis) and MED1 (involved in proliferation, differentiation and metabolism) were speculated to be the major potential target genes of miR-205-5p.
In order to confirm that the predicted target genes were indeed regulated by miR-205-5p, the mRNA expression levels of erbB3, ZEB2, CTLC and MED1 were assessed in A549 cells using RT-qPCR following miR-205-5p silencing. The results demonstrated that erbB3 mRNA expression in NC and miR-205-5p siRNA groups was 0.594±0.185 and 0.831±0.269, respectively (P>0.05; Fig. 5). ZEB2 mRNA expression in the NC and siRNA groups was 0.616±0.046 and 1.337±0.372, respectively (P<0.05; Fig. 5). CLTC mRNA expression in the NC and siRNA groups was 0.421±0.117 and 0.470±0.105, respectively (P>0.05; Fig. 5). MED1 mRNA expression in the NC and siRNA groups was 0.461±0.052 and 0.524±0.298, respectively (P>0.05; Fig. 5). Therefore, out of the four genes tested, only ZEB2 exhibited a significant increase in mRNA expression following miR-205-5p silencing (Fig. 5).
In order to confirm the results obtained for the mRNA expression levels, protein expression levels were also examined by western blotting (Fig. 6). The results demonstrated that erbB3 protein expression in the NC and siRNA groups was 0.283±0.042 and 0.130±0.009, respectively (P<0.01; Fig. 6). ZEB2 protein expression in the NC and siRNA groups was 0.335±0.025 and 0.465±0.031, respectively (P<0.01; Fig. 6). CLTC and MED1 protein expressions in the NC and siRNA groups were 0.905±0.090 and 0.914±0.052, and 1.029±0.025 and 0.913±0.198, respectively (P>0.05; Fig. 6). Therefore, miR-205-5p silencing resulted in a significant decrease of erbB3 and a significant increase of ZEB2 protein expression levels compared with control cells (Fig. 6).
The aim of present study was to explore the effects of miR-205-5p on viability, apoptosis and invasion of lung cancer A549 cells. Results demonstrated that cell viability and cell invasion were significantly decreased, while apoptosis was significantly increased in miR-205-5p siRNA group compared with the control group. Bioinformatics analysis speculated that erbB3, ZEB2, CLTC and MED1 may be potential target genes of miR-205-5p. Reduced expression of miR-205-5p significantly increased the expression levels of ZEB2 mRNA and protein, while it decreased the expression of erbB3 protein, suggesting that ZEB2 and erbB3 are indeed target genes of miR-205-5p in A549 cells. No significant effect was observed on the expression of CLTC and MED1 following miR-205-5p silencing.
Proliferation, abnormal apoptosis, invasion and metastasis are important features of malignant tumors, and metastasis is the primary cause of death in cancer patients (19,20). In the present study, miR205-5p silencing led to decreased A549 cell invasion, suggesting that knocking down expression of miR-205-5p in A549 cells may reduce the invasive properties of tumor cells. Similar results were previously observed in breast cancer cells following miR-205-5p silencing (21). TargetScan is a web-based bioinformatics tool used to predict target genes of miRNAs (14). PicTar is a bioinformatics tool mainly focused on identifying target genes containing single miRNA binding sites (15,22,23). Target gene predictions in nematodes using the PicTar software have been confirmed to correspond to several verified miRNA target genes (23). miRDB is a software used for prediction and functional annotation of miRNA targets, which performs target predictions for mature miRNA using a support vector machine algorithm (16,24). Since each prediction software has its limitations, and since there is a lack of high complementarity between miRNAs and their target mRNAs, a miRNA is often associated with hundreds of target genes, leading to a number of false positive predictions (25). Therefore, a cross prediction of miRNA target genes using several prediction programs is likely to greatly improve accuracy. In the present study, prediction of miR-205-5p target genes was performed using three different prediction bioinformatics tools: TargetScan2, PicTar and miRDB, and 16 miR-205-5p candidate target genes were identified (SBF2, RAB11FIP1, erbB3, PLCB1, PHC2, MED1, LRP1, LAMC1, KLF12, ZEB2, HS3ST1, FRK, CLTC, BTBD3, ADAMTS9 and ACSL1; Table I). Among these, four genes were selected to be examined further in A549 cells: MED1 as a verified target of miR-205-5p in human trophoblasts (26), erbB3 as a major regulator of cell proliferation (27), ZEB2 as a promoter of metastasis (28) and CLTC as a promoter of tumor growth and angiogenesis (29). RT-qPCR and western blot analyses were used to determine the expression of these four genes at the mRNA and protein level respectively, following transfection with miR-205-5p-targeting siRNA. The results demonstrated that ZEB2 and erbB3 expression were significantly affected by miR-205-5p silencing.
ERBB family members are involved in cell proliferation and differentiation. Members of the ERBB family are dysregulated in breast, lung, ovarian, prostate and gastrointestinal tumors (30). The present study demonstrated that, although silencing miR-205-5p expression in A549 cells did not significantly change the mRNA expression of erbB3, expression of the erbB3 protein levels were significantly reduced compared with control cells. This result indicated that high miR-205-5p expression in NSCLC might enhance the activation of downstream signal pathways through increasing erbB3 expression to promote cell proliferation and malignant transformation.
Epithelial mesenchymal transition (EMT) serves an important role in invasion and metastasis of tumor cells (31,32). E-cadherin maintains the epithelial cell integrity and epithelial cell polarity, and its downregulation is an important feature of EMT. Neural cadherin is another member of the cadherin family, and its upregulation leads to downregulation of E-cadherin and increased cell invasion (32,33). ZEB2 inhibits E-cadherin expression and induces EMT (34). ZEB2 has been confirmed to promote ovarian cancer, breast cancer and gastric cancer cell metastasis, and its upregulation is significantly correlated with poor prognosis in head and neck cancer (35–38). However, there is little information concerning the role of ZEB2 in lung cancer. Oztas et al (39) reported that ZEB2 is not expressed in normal lung tissue, but it is upregulated in up to 70% of lung cancer tissues. Miura et al (34) observed ZEB2 overexpression in up to 58.4% of lung cancer tissues. Previous studies have demonstrated that ZEB2 upregulation is negatively correlated with E-cadherin expression and positively correlated with N-cadherin expression in NSCLC, suggesting that ZEB2 may promote EMT in NSCLC (37,38,40). The present study demonstrated that silencing miR-205-5p expression in A549 cells significantly increased mRNA and protein expression of ZEB2, suggesting that miR-205-5p likely regulates expression of ZEB2 through degrading its mRNA. In addition, this result indicated that high miR-205-5p expression may lead to decreased mRNA and protein expression of ZEB2, as previously reported by Liu et al (41) in melanoma cells.
CLTC is involved in the cell cycle and spread of viruses (42,43). CLTC promotes tumor growth and angiogenesis by regulating hypoxia-inducible factor 1-α and vascular endothelial growth factor expression (29). CLTC may be associated with lymphoma (44). In the present study, bioinformatics analysis revealed that CLTC may be a potential target gene of miR-205-5p. However, the results did not support that CLTC is a target of miR-205-5p, as its expression was not affected by miR-205-5p silencing. MED1 binds to various nuclear receptors (including peroxisome proliferator-activated receptor-α, peroxisome proliferator-activated receptor-γ and retinoid X receptor) and transcription factors (including p53, GATA and CCAAT/enhancer binding protein β), serving an important regulatory role in proliferation, differentiation and metabolism of cells (45–47). In the present study, bioinformatics analysis predicted that MED1 may be a potential target gene of miR-205-5p, but miR-205-5p silencing did not alter MED1 mRNA or protein expression levels in A549 cells.
In summary, the present study demonstrated that reduced expression of miR-205-5p promoted apoptosis, and inhibited viability and invasion in lung cancer A549 cells through upregulation of ZEB2 and downregulation of erbB3. The present results suggested that increased miR-205-5p expression in NSCLC tissues may promote proliferation and invasion of lung cancer cells and thus disease progression. Further studies are necessary in order to determine the exact role of miR-205-5p in lung cancer and to assess whether it may be a useful target for the development of novel NSCLC treatments.
The study was supported by the Natural Science Foundation of Jiangxi Province (grant no. 20142BAB205012) and the 555 project of Jiangxi Province Gan Po Excellence and Post-Graduate Innovation Project of Nanchang University (grant nos. cx2015176 and cx2016355).
|
Zhang B, Pan X, Cobb GP and Anderson TA: microRNAs as oncogenes and tumor suppressors. Dev Biol. 302:1–12. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Calin GA and Croce CM: MicroRNA signatures in human cancers. Nat Rev Cancer. 6:857–866. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Esquela-Kerscher A and Slack FJ: Oncomirs-microRNAs with a role in cancer. Nat Rev Cancer. 6:259–269. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Zhu XL, Wen SY, Ai ZH, Wang J, Xu YL and Teng YC: Screening for characteristic microRNAs between pre-invasive and invasive stages of cervical cancer. Mol Med Rep. 12:55–62. 2015.PubMed/NCBI | |
|
Hui A, How C, Ito E and Liu FF: Micro-RNAs as diagnostic or prognostic markers in human epithelial malignancies. BMC Cancer. 11:5002011. View Article : Google Scholar : PubMed/NCBI | |
|
Lee HY, Han SS, Rhee H, Park JH, Lee JS, Oh YM, Choi SS, Shin SH and Kim WJ: Differential expression of microRNAs and their target genes in non-small-cell lung cancer. Mol Med Rep. 11:2034–2040. 2015.PubMed/NCBI | |
|
Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, Peck D, Sweet-Cordero A, Ebert BL, Mak RH, Ferrando AA, et al: MicroRNA expression profiles classify human cancers. Nature. 435:834–838. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Wu H and Mo YY: Targeting miR-205 in breast cancer. Expert Opin Ther Targets. 13:1439–1448. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Tran N, McLean T, Zhang X, Zhao CJ, Thomson JM, O'Brien C and Rose B: MicroRNA expression profiles in head and neck cancer cell lines. Biochem Biophys Res Commun. 358:12–17. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Iorio MV, Visone R, Di Leva G, Donati V, Petrocca F, Casalini P, Taccioli C, Volinia S, Liu CG, Alder H, et al: MicroRNA signatures in human ovarian cancer. Cancer Res. 67:8699–8707. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Lebanony D, Benjamin H, Gilad S, Ezagouri M, Dov A, Ashkenazi K, Gefen N, Izraeli S, Rechavi G, Pass H, et al: Diagnostic assay based on hsa-miR-205 expression distinguishes squamous from nonsquamous non-small-cell lung carcinoma. J Clin Oncol. 27:2030–2037. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Jiang M, Zhang P, Hu G, Xiao Z, Xu F, Zhong T, Huang F, Kuang H and Zhang W: Relative expressions of miR-205-5p, miR-205-3p, and miR-21 in tissues and serum of non-small cell lung cancer patients. Mol Cell Biochem. 383:67–75. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ: miRBase: MicroRNA sequences, targets and gene nomenclature. Nucleic Acids Res. 34:(Database issue). D140–D144. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Lewis BP, Burge CB and Bartel DP: Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell. 120:15–20. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Krek A, Grün D, Poy MN, Wolf R, Rosenberg L, Epstein EJ, MacMenamin P, da Piedade I, Gunsalus KC, Stoffel M and Rajewsky N: Combinatorial microRNA target predictions. Nat Genet. 37:495–500. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Wong N and Wang X: miRDB: An online resource for microRNA target prediction and functional annotations. Nucleic Acids Res. 43:(Database issue). D146–D152. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Gene Ontology Consortium: Gene ontology consortium: Going forward. Nucleic Acids Res. 43:(Database issue). D1049–D1056. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, et al: Gene ontology: Tool for the unification of biology. The gene ontology consortium. Nat Genet. 25:25–29. 2000. View Article : Google Scholar : PubMed/NCBI | |
|
Geiger TR and Peeper DS: Metastasis mechanisms. Biochim Biophys Acta. 1796:293–308. 2009.PubMed/NCBI | |
|
Hedley BD and Chambers AF: Tumor dormancy and metastasis. Adv Cancer Res. 102:67–101. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Elgamal OA, Park JK, Gusev Y, Azevedo-Pouly AC, Jiang J, Roopra A and Schmittgen TD: Tumor suppressive function of mir-205 in breast cancer is linked to HMGB3 regulation. PLoS One. 8:e764022013. View Article : Google Scholar : PubMed/NCBI | |
|
Sahoo S and Albrecht AA: Ranking of microRNA target prediction scores by Pareto front analysis. Comput Biol Chem. 34:284–292. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Witkos TM, Koscianska E and Krzyzosiak WJ: Practical aspects of microRNA target prediction. Curr Mol Med. 11:93–109. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Wang X: miRDB: A microRNA target prediction and functional annotation database with a wiki interface. RNA. 14:1012–1017. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Hofacker IL: How microRNAs choose their targets. Nat Genet. 39:1191–1192. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Mouillet JF, Chu T, Nelson DM, Mishima T and Sadovsky Y: MiR-205 silences MED1 in hypoxic primary human trophoblasts. FASEB J. 24:2030–2039. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Jullien N, Dieudonné FX, Habel N, Marty C, Modrowski D, Patino A, Lecanda F, Sévère N and Marie PJ: ErbB3 silencing reduces osteosarcoma cell proliferation and tumor growth in vivo. Gene. 521:55–61. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Dai YH, Tang YP, Zhu HY, Lv L, Chu Y, Zhou YQ and Huo JR: ZEB2 promotes the metastasis of gastric cancer and modulates epithelial mesenchymal transition of gastric cancer cells. Dig Dis Sci. 57:1253–1260. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Tung KH, Lin CW, Kuo CC, Li LT, Kuo YH, Lin CW and Wu HC: CHC promotes tumor growth and angiogenesis through regulation of HIF-1α and VEGF signaling. Cancer Lett. 331:58–67. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Yano T, Doi T, Ohtsu A, Boku N, Hashizume K, Nakanishi M and Ochiai A: Comparison of HER2 gene amplification assessed by fluorescence in situ hybridization and HER2 protein expression assessed by immunohistochemistry in gastric cancer. Oncol Rep. 15:65–71. 2006.PubMed/NCBI | |
|
Chang ZG, Wei JM, Qin CF, Hao K, Tian XD, Xie K, Xie XH and Yang YM: Suppression of the epidermal growth factor receptor inhibits epithelial-mesenchymal transition in human pancreatic cancer PANC-1 cells. Dig Dis Sci. 57:1181–1189. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Rhodes LV, Tate CR, Segar HC, Burks HE, Phamduy TB, Hoang V, Elliott S, Gilliam D, Pounder FN, Anbalagan M, et al: Suppression of triple-negative breast cancer metastasis by pan-DAC inhibitor panobinostat via inhibition of ZEB family of EMT master regulators. Breast Cancer Res Treat. 145:593–604. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Gheldof A and Berx G: Cadherins and epithelial-to-mesenchymal transition. Prog Mol Biol Transl Sci. 116:317–336. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Miura N, Yano T, Shoji F, Kawano D, Takenaka T, Ito K, Morodomi Y, Yoshino I and Maehara Y: Clinicopathological significance of Sip1-associated epithelial mesenchymal transition in non-small cell lung cancer progression. Anticancer Res. 29:4099–4106. 2009.PubMed/NCBI | |
|
Elloul S, Elstrand MB, Nesland JM, Tropé CG, Kvalheim G, Goldberg I, Reich R and Davidson B: Snail, Slug, and Smad-interacting protein 1 as novel parameters of disease aggressiveness in metastatic ovarian and breast carcinoma. Cancer. 103:1631–1643. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Rosivatz E, Becker I, Specht K, Fricke E, Luber B, Busch R, Höfler H and Becker K: Differential expression of the epithelial-mesenchymal transition regulators snail, SIP1, and twist in gastric cancer. Am J Pathol. 161:1881–1891. 2002. View Article : Google Scholar : PubMed/NCBI | |
|
Zhou C, Liu J, Tang Y, Zhu G, Zheng M, Jiang J, Yang J and Liang X: Coexpression of hypoxia-inducible factor-2α, TWIST2, and SIP1 may correlate with invasion and metastasis of salivary adenoid cystic carcinoma. J Oral Pathol Med. 41:424–431. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Sakamoto K, Imanishi Y, Tomita T, Shimoda M, Kameyama K, Shibata K, Sakai N, Ozawa H, Shigetomi S, Fujii R, et al: Overexpression of SIP1 and downregulation of E-cadherin predict delayed neck metastasis in stage I/II oral tongue squamous cell carcinoma after partial glossectomy. Ann Surg Oncol. 19:612–619. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Oztas E, Avci ME, Ozcan A, Sayan AE, Tulchinsky E and Yagci T: Novel monoclonal antibodies detect Smad-interacting protein 1 (SIP1) in the cytoplasm of human cells from multiple tumor tissue arrays. Exp Mol Pathol. 89:182–189. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Xia M, Hu M, Wang J, Xu Y, Chen X, Ma Y and Su L: Identification of the role of Smad interacting protein 1 (SIP1) in glioma. J Neurooncol. 97:225–232. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Liu S, Tetzlaff MT, Liu A, Liegl-Atzwanger B, Guo J and Xu X: Loss of microRNA-205 expression is associated with melanoma progression. Lab Invest. 92:1084–1096. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Dodge GR, Kovalszky I, McBride OW, Yi HF, Chu ML, Saitta B, Stokes DG and Iozzo RV: Human clathrin heavy chain (CLTC): Partial molecular cloning, expression, and mapping of the gene to human chromosome 17q11-qter. Genomics. 11:174–178. 1991. View Article : Google Scholar : PubMed/NCBI | |
|
Humphries AC, Dodding MP, Barry DJ, Collinson LM, Durkin CH and Way M: Clathrin potentiates vaccinia-induced actin polymerization to facilitate viral spread. Cell Host Microbe. 12:346–359. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
De Paepe P, Baens M, van Krieken H, Verhasselt B, Stul M, Simons A, Poppe B, Laureys G, Brons P, Vandenberghe P, et al: ALK activation by the CLTC-ALK fusion is a recurrent event in large B-cell lymphoma. Blood. 102:2638–2641. 2003. View Article : Google Scholar : PubMed/NCBI | |
|
Zhu Y, Qi C, Jain S, Rao MS and Reddy JK: Isolation and characterization of PBP, a protein that interacts with peroxisome proliferator-activated receptor. J Biol Chem. 272:25500–25506. 1997. View Article : Google Scholar : PubMed/NCBI | |
|
Drané P, Barel M, Balbo M and Frade R: Identification of RB18A, a 205 kDa new p53 regulatory protein which shares antigenic and functional properties with p53. Oncogene. 15:3013–3024. 1997. View Article : Google Scholar : PubMed/NCBI | |
|
Crawford SE, Qi C, Misra P, Stellmach V, Rao MS, Engel JD, Zhu Y and Reddy JK: Defects of the heart, eye, and megakaryocytes in peroxisome proliferator activator receptor-binding protein (PBP) null embryos implicate GATA family of transcription factors. J Biol Chem. 277:3585–3592. 2002. View Article : Google Scholar : PubMed/NCBI |