Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
November-2017 Volume 16 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2017 Volume 16 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Association of SREBP2 gene polymorphisms with the risk of osteonecrosis of the femoral head relates to gene expression and lipid metabolism disorders

  • Authors:
    • Yang Song
    • Zhenwu Du
    • Bingpeng Chen
    • Ming Ren
    • Qiwei Yang
    • Yujie Sui
    • Qingyu Wang
    • Ao Wang
    • Haiyue Zhao
    • Yanguo Qin
    • Guizhen Zhang
  • View Affiliations / Copyright

    Affiliations: Department of Orthopedics of the Second Hospital of Jilin University, Changchun, Jilin 130041, P.R. China, The Engineering Research Center of Molecular Diagnosis and Cellular Treatment for Metabolic Bone Diseases of Jilin Province, Changchun, Jilin 130041, P.R. China
  • Pages: 7145-7153
    |
    Published online on: September 12, 2017
       https://doi.org/10.3892/mmr.2017.7473
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Although lipid metabolism disorders have been recognized as a primary factor of osteonecrosis of the femoral head (ONFH), the molecular pathogenesis remains unclear. Sterol regulatory element‑binding protein 2 (SREBP2) specifically regulates cholesterol and fatty acid metabolism to maintain lipid homeostasis. To explore the roles of the SREBP2 gene in the development of ONFH, the authors analyzed the gene polymorphism and gene expression of three tag single nucleotide polymorphisms of the SREBP2 gene, the serum lipids levels, and their associations with ONFH development in 182 ONFH patients and 179 healthy controls. The results demonstrated that the stage IV proportions of ONFH patients carrying the rs2267439CT or CC genotype were significantly higher and lower than the stage III proportions of ONFH patients (P=0.039), respectively. The serum triglyceride, low‑density lipoprotein (LDL)‑c levels, and LDL‑C/high‑density lipoprotein (HDL)‑C ratio in the ONFH group were significantly increased compared to those in the control group (P=0.01, P=0.005, P=0.0001) while the HDL‑C level of ONFH group was remarkably lower than that of the control group (P=0.0001). Association analysis further revealed that the LDL‑c levels of the rs226744 GG and AG genotype carriers were statistically higher than that of the AA genotype carriers (P=0.039, P=0.05). These results demonstrated that the gene polymorphism of SREBP2 not only significantly associated with the clinical phenotypes of ONFH but also closely related to lipid metabolism disorder. The results indicated that SREBP2 gene polymorphism and function may play key roles in the development of ONFH.

Introduction

Osteonecrosis of the femoral head (ONFH) is a complex disorder caused by interactions between genetic factors and environmental factors (1). It is characterized by a complicated pathological process, is difficult to diagnose in early stage, and eventually requires operation for artificial joint replacement. ONFH incidence has increased in recent decades. It is estimated that 20,000–30,000 new patients in the United States (2) and 150,000 to 200,000 new patients in China are diagnosed with ONFH annually, respectively. It is very important to elaborate the ONFN molecular pathogenesis and to identify its molecular targets to decrease the incidence. The polymorphisms of multiple genes have been suggested to be associated with ONFH risk. These polymorphisms are thought to cause disequilibrium with other genes, affecting ONFH occurrence, or to play a synergistic role in the development of ONFH by interfering with the expression of other genes (3–6) The ONFH patients often occur with a severe lipid metabolism disorder and the adipose accumulation in the impaired bone marrow cavity. Thus, lipid metabolism disorder has generally been regarded as a critical factor in ONFH pathogenesis, but the molecular mechanism of the adipose accumulation remains unclear.

Sterol regulatory element-binding protein 2 (SREBP2), a member of the SREBPs nuclear transcription factor family, binds to the sterol regulator, the promoter/enhancer in the lipid synthetic enzyme gene, to activate the target gene transcription and the genes expression of the cholesterol biosynthesis pathway, playing a key role in lipid homeostasis (7,8). Considering the critical role of the SREBP2 gene in lipid homeostasis, the authors' research selected three Tag SNPs of the SREBP2 gene as molecular targets and investigated their genotypes, haplotypes, the serum SREBP2 expression and lipids level of ONFH patients, and their associations with the clinical phenotypes and the development of ONFH.

Materials and methods

Patients and ethics statement

A total of 182 unrelated patients with ONFH (126 men, 56 women; age, 53.50±12.63 years) were consecutively enrolled at the Department of Orthopedics of the Second Clinical College of Jilin University (Changchun, China) from March 2014 to June 2015. Patients with ONFH that was caused by direct trauma and patients with ONFH concurrent with cardiovascular diseases (arterial thrombosis and atherosclerosis etc.), congenital diseases, HIV infection, diabetes mellitus or renal dysfunction were excluded. ONFH diagnoses were established by evidence of osteonecrosis using plain radiographs in stages 2, 3 and 4 of the Ficat Classification system (9). According to the detailed disease history and etiological factors of the patients, the ONFH cases were classified into the following subgroups: alcohol-induced (68 cases, 38.42%), idiopathic (67 cases, 37.85%) and steroid-induced osteonecrosis (45 cases, 25.42%). Steroid-induced osteonecrosis was defined by a history of taking a cumulative 2,000 mg prednisolone or an equivalent over 21 days. Alcohol-induced osteonecrosis was defined by the consumption of >900 ml of pure ethanol per week. The disease course of ONFH ranged from 0.5 to 240 months, with an average of 72.45 months. There were 13 cases of stage II ONFH (7.34%), 52 cases of stage III ONFH (29.38%) and 112 cases of stage IV ONFH (63.28%). There were six cases of ONFH patients who failed to undergo the clinical stages or aetiological classification duo to defect plain radiographs or unclear aetiological factors.

In addition, a total of 179 unrelated control subjects (114 men, 65 women; age, 52.58±11.08 yr.) that were age- and sex-matched with the ONFH group were consecutively enrolled at the Health Examination Center of the Second Clinical College of Jilin University (Changchun, China) from October 2014 to December 2014. Control subjects were defined in the following way: They had no hip pain, their fasting serum blood glucose, triglyceride (TG) and total cholesterol (TC) levels were in the normal reference value range, abdominal ultrasound examination and chest X-ray radiography were normal, and they did not have a presence of cardiovascular or cerebrovascular diseases. All participants were of a Han Chinese population from northeast China.

The study was approved by the Ethics Committee of the Second Clinical College of Jilin University (Changchun, China), and conformed to the current ethical principles of the Declaration of Helsinki. All individuals provided written informed consent for their participation in the study. The authors declare that they have no competing financial interest.

Genomic DNA extraction and SNP selection

Genomic DNA was extracted from 2 ml blood using a genomic DNA Extraction kit (DP318; Tiangen Biotech Co., Ltd., Beijing, China) following the manufacturer's protocols. The HapMap database and related literature were used to select tag SNPs in the SREBP2 gene, and the population distributions of the tag SNPs in different countries, nationalities and regions, especially in Asian populations, were analyzed. Three tag SNPs, rs2267439 [C/T], rs1052717 [A/G] and rs2267443 [A/G], in the intron region of the SREBP2 gene were selected as the research targets.

Genotyping

The detection primer, probe sequence and product size following ligase reaction of the rs2267439 [C/T], rs1052717 [A/G] and rs2267443 [A/G] SNPs are presented in Table I. PCR reactions were performed in a buffer containing 1 l DNA, 1.5 µl MgCl2, 0.3 µl dNTPs, 0.15 µl primer mix, and 0.3 µl Taq DNA ligase in a final reaction volume of 15 µl (all reagents from Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The reaction mixture was heated to 94°C for three min for denaturation. Then, the sample was subjected to 35 cycles of 94°C for 15 sec, annealing at 54°C for 15 sec and extension at 72°C for 30 sec, followed by a final extension step at 72°C for 5 min. The specific amplified fragments were used in ligase detection reaction (LDR) to identify the mutations associated with the rs2267439 [C/T], rs1052717 [A/G] and rs2267443 [A/G] SNPs.

Table I.

Primers and probes of target SNPs of SREBP2 with LDR.

Table I.

Primers and probes of target SNPs of SREBP2 with LDR.

dbSNP namePrimersaProbebProduct sizec
rs2267439Sense: AGCAGTTTTATTCAATTAG TC:TTTTTTTTAATTGTCCGTATCCTTCTGGA68/C, 71/T
[C/T]AACTTCTC
Antisense:TGTTCAACAGGTACAC TT:TTTTTTTTTTTAATTGTCCGTATCCTTCT
AGGTGGGATTCTT
TR:P-GTCTGAACATTGCTTATCTGCGTACTT
TTTTTT-FAM-
rs1052717Sense: TGAAGATTGGTTCAGCAA TA:TTTTTTTTTTTTTGAAGGTATTTATTGGG75/A, 78/G
[A/G]TAGCCATCTTGTA
Antisense:CTCTGTAGCTTGGCAA TG:TTTTTTTTTTTTTTTTGAAGGTATTTATT
AGGCACGGGCATCTTGTG
TR:P-TTGATCACAGCACTGTGAATCCAGAT
TTTTTTTTTT-FAM-
rs2267443Sense: AGTATCCAGTATCAACAC TA:AAGCTGCTTTGAGATTATGAGTA47/A, 51/G
[A/G]TGGT TG:TATAAGCTGCTTTGAGATTATGAGTG
Antisense:ATAGCACTGTCAGAGT TR:P-TGTGTCTATAGAACAGGTTGTTT-FAM-
GCCACT

a Primers to amplify the gene fragment of target dbSNP site

b Probe to discriminate the target SNPs genotype

c Product size indicating the size of the product from a ligase reaction for each SNP genotype. SNP, single nucleotide polymorphism; SREBP2, sterol regulatory element-binding protein 2; LDR, ligase detection reaction.

The LDR assay was performed in a reaction volume of 10 µl that contained 3 µl PCR product, 1 µl 10X ligase reaction buffer, 0.125 µl (40 U/µl) Taq DNA ligase and 0.01 µl probe (10 p)/each probe; deionized H2O was added to a final volume of 10 µl. The ligation reaction was performed using a GeneAmp PCR System 9700 (Applied Biosystems Inc.; Thermo Fisher Scientific, Inc.) with the following temperature program: 2 min at 95°C and 30 cycles of 30 sec at 94°C and 3 min at 56°C. The products were analyzed using an ABI PRISM 3730×l DNA sequencer (Applied Biosystems Inc.; Thermo Fisher Scientific, Inc.). Chromas software version 2.6.4 (Technelysium Pty Ltd., South Brisbane, Australia) was used to analyze the sequencing peak chart.

Serum SREBP2 protein expression

Serum SOX9 protein expression was detected using an ELISA kit (DRE12665; Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) according to the manufacturer's protocols. Briefly, the assay range of SREBP2 was 5–300 pg/ml. The SREBP2 densities of standards wells on the ELISA plates were 300, 200, 100, 50 and 25 pg/ml, respectively. Blank wells [without sample or horseradish peroxidase (HRP)-conjugate reagent] were kept separately. Then, 40 µl sample dilution and 10 µl serum were added to the testing sample wells 40 µl sample dilution and 10 µl serum (final dilution of sample, 5-fold). These was incubated for 30 min at 37°C, before being washed with PBS five times. The HRP-conjugate reagent (50 µl) was added and was incubated for 30 min at 37°C. Following this, it was washed five times, and Chromogen Solutions A and B (50 µl each) were added separately and kept in a dark place for 15 min at 37°C. The Stop Solution (50 µl) was added to each well. Within 15 min, the blank well was taken as zero, and absorbance was read at 450 nm using a multi-wavelength microplate reader (Varioskan; Thermo Fisher Scientific, Inc.).

Statistical analysis

Shesis software platform (http://analysis.bio-x.cn/SHEsisMain.htm) was used to analyze the Hardy-Weinberg equilibrium and haplotypes between the ONFH and control groups. Logistical regression analyses were used to calculated the odds ratios (OR), 95% confidence intervals (CI), and corresponding p-values of each SNP, controlling for age and sex as covariates. The genetic models of dominant, recessive, and codominant were considered, and the genotypes were given codes of 0, 1, and 2; 0, 1, and 1; or 0, 0, and 1 in the codominant, dominant and recessive models, respectively. SPSS software (version, 10.0; SPSS, Inc., Chicago, IL, USA) was used to analyze the differences in serum SOX9 protein expression between the ONFH and control groups and the associations of protein expression with genotypes and clinical phenotypes using the Student's t-test, ANOVA and χ2 test, respectively. Shesis software (haplotype analysis) was also used to analyze the correlation of the haplotype with the clinical phenotypes. Data were presented as mean ± standard deviation and P<0.05 was considered to indicate a statistically significant difference.

Results

The genotypes, allele frequencies and haplotypes of rs1052717 (A/G), rs2267439 (C/T) and rs2267443 (A/G) of the SREBP2 gene

SREBP2 genotypes and allele frequencies are presented in Table II. Logistical regression analysis indicated that although possessing no statistical significance, the co-dominant model of rs2267443 exhibited a higher tendency (P=0.058). There are eight haplotypes (A-T-A, A-T-G, G-C-G, G-T-A, G-T-G, G-C-A, A-C-A and A-C-G) among rs1052717, rs2267439 and rs2267443. Although the haplotypes between ONFH and control groups failed to show a statistical difference, the frequencies of the A-T-G (8.0%) and G-T-A (4.7%) haplotypes in the ONFH group were higher and lower tendency, respectively, than those of the control group (4.6, 7.9%; P=0.063, P=0.076), as presented in Table III. The other three haplotypes were not statistically analyzed due to low population frequencies.

Table II.

The genotypes and allele frequencies of SREBP2 between ONFH and control groups.

Table II.

The genotypes and allele frequencies of SREBP2 between ONFH and control groups.

Genotype (n)

dbSNP IDPositionGroup111222MAFHWEaCo-dominants (11 vs. 12 vs. 22) OR (95%CI) P-valueDominants 12+22 vs. 11 OR (95%CI) P-valueRecessives 22 vs. 11+12 OR (95%CI) P-valueAllele 2 vs. 1 OR (95%CI) P-value
rs1052717Intron 10 GGGAAA
(G>A) Control8379170.3160.7731.312 (0.806–2.135)1.123 (0.902–1.399)0.846 (0.577–1.243)1.066 (0.780–1.457)
Case7790150.3300.1100.2750.3000.3950.686
rs2267439Intron 1 TTCTCC
(T>C) Control5983370.4390.2991.123 (0.764–1.651)0.974 (0.770–1.234)0.978 (0.739–1.294)0.939 (0.699–1.261)
Case6482360.3960.4350.5540.8300.8750.939
rs2267443Intron 10 GGGAAA
(G>A) Control7485200.3490.5480.629 (0.389–1.016)0.922 (0.740–1.150)0.860 (0.593–1.248)0.828 (0.607–1.131)
Case8582150.3080.4370.0580.4720.4720.236

a P-values of deviation from Hardy-Weinberg equilibrium between the ONFH group and control group. 11, homozygotes for the major allele; 12, heterozygotes; 22, homozygotes for the minor allele. Logistic regression analyses were used for calculations. MAF, minor allele frequencies; HWE, Hardy-Weinberg equilibrium. SNP, single nucleotide polymorphism; CI, confidence interval; OR, odds ratio; SREBP2, sterol regulatory element-binding protein 2; ONFH, osteonecrosis of the femoral head.

Table III.

Haplotype frequencies of SREBP2 SNPs between ONFH and control groups.

Table III.

Haplotype frequencies of SREBP2 SNPs between ONFH and control groups.

Frequency

Gene dpSNPsHaplotypeControls, n (%)Patients, n (%)OR (95%CI) P-valuea
Hap1A-T-A93.86 (26.2)90.83 (25.0)0.936 (0.670–1.307)0.697
SREBP2Hap2A-T-G16.64 (4.6)29.16 (8.0)1.787 (0.961–3.324)0.063
rs1052717 (A/G)Hap3G-C-G153.22 (42.8)150.08 (41.2)0.938 (0.698–1.260)0.670
rs2267439 (C/T)Hap4G-T-A28.45 (7.9)17.25 (4.7)0.576 (0.311–1.068)0.076
rs2267443 (A/G)Hap5G-T-G62.06 (17.3)72.76 (20.0)1.191 (0.819–1.734)0.358
Hap6G-C-A1.28 (0.4)3.91 (1.1)––
Hap7A-C-A1.41 (0.04)0.01 (0.00)––
Hap8A-C-G1.09 (0.03)0.00 (0.00)––

{ label (or @symbol) needed for fn[@id='tfn5-mmr-16-05-7145'] } SREBP2, sterol regulatory element-binding protein 2; SNPs, single nucleotide polymorphisms; ONFH, osteonecrosis of the femoral head; OR, odds ratio; CI, confidence interval.

a χ2 test. Those with a frequency <0.03 were not analyzed.

Associations of the genotypes and haplotypes of rs1052717, rs2267439 and rs2267443 with the clinical phenotypes of ONFH

Correlation analysis of the SREBP2 genotypes with the disease course, etiological classification, unilateral or bilateral hip lesions, and clinical staging of ONFH demonstrated that the rs2267439 genotypes demonstrated a significant association with the clinical stages of ONFH. The proportions of stage IV patients carrying the rs2267439CT (50.9%) or CC (13.4%) genotype were significantly higher and lower, respectively, compared with those of stage III patients (32.7, 26.9%, P=0.039), as indicated in Table IV. The correlation analysis between the SREBP2 haplotypes and the clinical stages or the unilateral and bilateral hip lesions of ONFH patients showed no significant differences, as presented in Tables V and VI.

Table IV.

Association of SREBP2 genotypes with the clinical phenotypes of ONFH.

Table IV.

Association of SREBP2 genotypes with the clinical phenotypes of ONFH.

χ2 test Etiological classification, n (%)a χ2 testInvolved lesions scope n (%) χ2 testClinical stage n (%) χ2 test




dbSNPGenotypeMen, n (%)Women, n (%)Disease course (months) ANOWY testAlcaSteraIdioaUnilateralBilateralII stageIII stageIV stage
rs1052717AA12 (9.5)3 (5.4)61.07+71.216 (8.8)3 (6.9)6 (9.0)7 (8.9)8 (7.8)1 (7.7)5 (9.6)8 (7.1)
GA66 (52.4)24 (42.9)72.24+69.0531 (45.6)26 (57.8)32 (47.8)42 (53.2)48 (47.1)4 (30.8)24 (46.2)62 (55.4)
GG48 (38.1)29 (51.8)75.59+72.7731 (45.6)16 (35.6)29 (43.2)30 (38.0)46 (45.1)8 (61.5)23 (44.2)42 (37.5)
P-value0.197 0.782 0.438 0.629
rs2267439CC22 (17.5)14 (25.0)78.51+74.1615 (22.1)6 (13.3)14 (20.9)14 (17.7)21 (20.6)2 (15.4)14 (26.9)15 (13.4)
CT60 (47.6)22 (39.3)71.92+67.9030 (44.1)21 (46.7)30 (44.8)33 (41.8)49 (48.0)7 (53.8)17 (32.7)57 (50.9)
TT44 (34.9)20 (35.7)69.82+72.6623 (33.8)18 (40.0)23 (34.3)32 (40.5)32 (31.4)4 (30.8)21 (40.4)40 (35.7)
P-value0.423 0.817 0.444 0.056
(0.039)b
rs2267443AA11 (8.7)4 (7.1)79.10+74.435 (7.4)5 (11.1)4 (6.0)7 (8.9)8 (8.5)1 (7.7)5 (9.6)8 (7.1)
AG58 (46.0)24 (42.9)66.52+66.8926 (38.2)25 (55.6)31 (46.3)37 (46.8)45 (44.1)5 (38.5)24 (46.2)53 (47.3)
GG57 (45.3)28 (50.0)67.63+68.4737 (54.4)15 (33.3)32 (47.8)35 (44.3)49 (48.0)7 (53.8)23 (44.2)51 (45.5)
P-value0.821 0.254 0.877 0.953

a Alc, alcohol-induced; Ster, steroid-induced; Idio, idiopathic

b II vs. III vs. IV, P=0.056, III vs. IV, P=0.039. SREBP2, sterol regulatory element-binding protein 2; ONFH, osteonecrosis of the femoral head; SNP, single nucleotide polymorphism.

Table V.

The association of SREBP2 haplotypes with the unilateral and bilateral hips lesions of ONFH.

Table V.

The association of SREBP2 haplotypes with the unilateral and bilateral hips lesions of ONFH.

HaplotypesUnilateral, n (%)Bilateral, n (%)χ2P-valueOR (95% CI)
40.58 (25.7)50.15 (24.3)0.0810.7750.933 (0.577–1.506)
SREBP215.41 (9.8)13.84 (6.7)1.1060.2930.667 (0.313–1.424)
58.63 (37.1)91.60 (44.5)1.5560.2121.312 (0.856–2.010)
rs1052717(A/G)8.05 (5.1)9.45 (4.6)0.0500.8230.896 (0.342–2.351)
rs2267439(C/T)32.95 (20.9)39.56 (19.2)0.1470.7010.904 (0.538–1.517)
rs2267443(A/G)2.37 (1.5)1.41 (0.7)–––
0.00 (0.0)0.01 (0.0)–––
1.09 (0.03)0.00 (0.00)

[i] Those with a frequency <0.03 were not analyzed. SREBP2, sterol regulatory element-binding protein 2; ONFH, osteonecrosis of the femoral head; OR, odds ratio; CI, confidence interval.

Table VI.

The association of SREBP2 haplotypes with clinical stages of ONFH patients.

Table VI.

The association of SREBP2 haplotypes with clinical stages of ONFH patients.

HaplotypesStage IV, n (%)Stage III, n (%)χ2P-valueOR (95% CI)
SREBP2A-T-A56.54 (25.2)27.30 (26.3)0.0370.8460.949 (0.557–1.615)
A-T-G21.45 (9.6)6.70 (6.4)0.8950.3441.541 (0.626–3.793)
rs105271(A/G)G-CG84.22 (37.6)43.76 (42.1)0.5980.4390.829 (0.515–1.334)
rs2267439(C/T)G-T-A9.68 (4.3)5.46 (5.2)0.1370.7110.816 (0.278–2.394)
rs2267443(A/G)G-T-G49.32 (22.0)19.54 (18.8)0.4510.5021.222 (0.680–2.195)
G-C-A2.77 (1.2)1.24 (1.2)–––
A-C-A0.01 (0.0)0.00 (0.0)–––
A-C-G1.09 (0.03)0.00 (0.00)–––

[i] All those with a frequency <0.03 were not analyzed. SREBP2, sterol regulatory element-binding protein 2; ONFH, osteonecrosis of the femoral head; OR, odds ratio; CI, confidence interval.

Serum levels of TC, TG, high-density lipoprotein (HDL)-c, low-density lipoprotein (LDL)-c, LDL-C/HDL-C ratios and their association with SREBP2 gene polymorphism

The serum TG, LDL-C levels and LDL-C/HDL-C ratios of the ONFH group were significantl y higher than those of the control group (P=0.01, P=0.005 and P=0.0001 respectively), while the HDL-C levels in the ONFH group was statistically lower, compared with that of the control group (P=0.0001), as presented in Fig. 1. The correlation analysis between the rs1052717, rs226743 and, rs2267443 genotypes and serum lipid levels indicated that the serum LDL-C levels of ONFH patients carrying the rs2267443 GG or AG genotypes were significantly increased than those of patients carrying the AA genotype (P=0.039, P=0.05), as presented in Fig. 1.

Figure 1.

The serum lipid levels between the ONFH and control groups, and the association of SREBP2 genotypes with the serum lipid levels of ONFH patients. (A) The serum levels of TC, TG, HDL-c, and, LDL-c between the ONFH and control groups. *P<0.01, ∆P<0.005, #P<0.0001 vs. control. (B) The association of SREBP2 genotypes with the serum lipid levels of the ONFH group. *P<0.05 as indicated. (C) The LDL-c/HDL-c ratio between the ONFH and control groups. #P<0.0001 vs. control. Data are presented as mean ± standard deviation. ONFH, osteonecrosis of the femoral head; SREBP2, sterol regulatory element-binding protein 2; TC, total cholesterol; TG, triglyceride; HDL, high-density lipoprotein; LDL, low-density lipoprotein.

Serum protein expression of SREBP2 gene and its association with SREBP2 genotypes and the clinical phenotypes of ONFH

ELISA analysis revealed that serum SREBP2 protein expression was not significantly different between the ONFH and control groups. The correlation analysis between the genotypes and serum SREBP2 protein expression presented no statistical significance, as demonstrated in Fig. 2. The association analysis of the serum SREBP2 protein level with the etiological classification, clinical stages and the unilateral or bilateral hip lesions of ONFH patients also presented no significant differences, as displayed in Fig. 3.

Figure 2.

Serum SREBP2 protein expression and the association of protein expression with SREBP2 genotypes in ONFH patients. (A) The serum protein expression of SREBP2 gene between the ONFH and control groups. (B) The association of SREBP2 genotypes with protein expression in ONFH patients. Data are presented as mean ± standard deviation. SREBP2, sterol regulatory element-binding protein 2; ONFH, osteonecrosis of the femoral head.

Figure 3.

The association of protein expression of the SREBP2 gene with the clinical phenotypes of ONFH. (A) The association of the protein expression of the SREBP2 gene with the clinical etiological classification of ONFH. (B) The association of the protein expression of the SREBP2 gene with the clinical stages of ONFH. (C) The association of the protein expression of the SREBP2 gene with unilateral or bilateral hip lesions of ONFH. Data are presented as mean ± standard deviation. SREBP2, sterol regulatory element-binding protein 2; ONFH, osteonecrosis of the femoral head.

Discussion

SREBPs are transcription activation factors that regulate endogenous cholesterol and fatty acid synthesis and are expressed in all tissues and organs of that exhibit lipid synthesis (10,11). A previous study demonstrated that OA is a metabolic disease involving the genetic deregulation of lipid and cholesterol metabolism. A genetic association analysis demonstrated a significant association between the 1784G>C mutation of the SREBP2 gene and OA development in a cohort of 1,410 Greek OA patients and healthy controls (12). A study in a Chinese Han population also demonstrated that the SREBP-2 rs2228314 polymorphism was closely associated with increased risk of knee OA (13).

Few reports have shown an association between SREBP-2 polymorphism and ONFH risk. In 2008, Kim et al (14) reported the protective effect of the SREBP-2 rs2267439 C allele against ONFH risk and the significant associations of rs1052717 and rs2267443 with increased ONFH risk. In 2012, the authors confirmed that the rs2267439TT and rs2267443GA genotype of the SREBP2 gene were associated with increased ONFH risk, while rs2267439 C allele frequency was associated with decreased ONFH risk (15). Lipid metabolism disorder has been recognized as a main factor in ONFH pathogenesis. The results of clinical and animal experiments have demonstrated that steroid- and alcohol-induced ONFH are associated with lipid metabolism disorder (16,17). Considering both the critical effects of SREBP2 on lipid homeostasis and the role of lipid metabolism disorder in the development of ONFH, the authors conducted the genotype and haplotype analyses of rs1052717, rs2267439 and rs2267443 of the SREBP2 gene in 182 ONFH patients and 179 controls. The results revealed that, although no statistical significance, the A-T-G haplotype frequency of the ONFH group was lower tendency while the G-T-A haplotype frequency of the ONFH group was higher tendency than that of the control group, indicating that the A-T-G haplotype may be associated with a lower risk of ONFH and the G-T-A haplotype might be associated with a higher risk of ONFH. In the expanded sample system, the roles of A-T-G and G-T-A haplotypes in the development of ONFH remain to be deeply investigated.

To further explore the association of SREBP2 polymorphism with ONFH risk, conducted correlation analyses were conducted between the genotypes and haplotypes of the SREBP2 gene and the clinical phenotypes of ONFH. The results demonstrated that the SREBP2 rs2267439 genotypes were significantly associated with the clinical stages of ONFH; the frequencies of stage IV patients carrying the homozygous CC genotype and heterozygous CT genotype of rs2267439 were significantly lower and higher, respectively, than those of stage III patients, suggesting that the CC genotype may be a protective genotype against ONFH hip lesion development, while the CT genotype may indicate a higher risk of ONFH hip lesion development. To investigate the effects of SREBP2 polymorphisms on gene expression, the authors examined serum SREBP2 protein expression and no significant difference was identified between the ONFH and control groups. As a key transcription factor, SREBP2 gene expression is affected by multiple signaling pathways and related genes. The polymorphism of a single minor gene might not be enough to cause obvious changes in serum SREBP2 protein expression. Moreover, the three tag SNPs examined in the present study are located in the intron region of the SREBP2 gene, and the polymorphism effects of SNPs in the intron region on gene expression are much less than those of SNPs in the promoter, 3′-untranslated region, and open reading frame regions.

Lipid metabolism disorders have been recognized as a primary factor in ONFH pathogenesis. However, the association between SREBP2 polymorphism and the lipid metabolism disorder of ONFH has never been reported. Considering the important role of SREBP2 in the cholesterol synthesis and lipid metabolism, the authors first conducted the simultaneous detection of SREBP2 gene polymorphism and gene expression and ONFH lipid metabolism disorder. The results showed that ONFH lipid metabolism disorder was characterized by an increase in serum TG and LDL-c levels and the LDL-c/HDL-c ratio and a decrease in HDL-c levels. Furthermore, the serum LDL-c levels of rs2267443 GG or AG genotype carriers were significantly higher than those of AA genotype carriers, suggesting that SREBP2 polymorphism is associated with the lipid metabolism disorder of ONFH.

Excess glucocorticoids lead to an obvious increase of serum lipid levels and the necrosis of the femoral head (18). In an experiment animal model of ONFH induced by excess glucocorticoids, lipid droplets were observed in the bone cells concurrently with increased serum lipids (19). A study of 240 ONFH patient-control systems showed that the serum adiponectin levels of ONFH patients were significantly lower than those of the healthy control subjects. Moreover, serum adiponectin levels positively associated with HDL-c levels and negatively associated with body mass index, TG levels, and the LDL/HDL ratio (20). Therefore, the serum adiponectin level was considered to be an independent predictor of ONFH risk. The pravastatin has been shown to prevent experimental ONFH induced by steroids, but the exact mechanism is unclear. A recent study using a rat ONFH model further demonstrated that pravastatin downregulated the expression of peroxisome proliferator activated receptor γ, a key transcription factors of adipogenic differentiation, and upregulated the expression of wingless-type MMTV integration site family 3A, LDL receptor related protein 5, beta catenin and Runt-related transcription factor 2 genes on the signaling pathway of osteogenic differentiation at the mRNA and protein levels and prevented ONFH induction by steroids, providing the molecular evidence of lipid metabolism disorders affecting bone metabolism (21).

Bone marrow stromal cells (BMSCs) are a common precursor of osteoblasts and adipocytes. Using an in vivo diffusion chamber assay, preadipocytes from BMSCs enter an activated proliferation stage and differentiate into osteoblasts (22). The study using lithium chloride (LiCl) to reverse the abnormal adipogenic and osteoblastic differentiation of ONFH showed that LiCl significantly increased the expression of osteocalcin and Runx2 and enhanced osteogenic mineralization during the osteogenic induction process and also significantly reduced the formation of lipid droplets in the cells and the antagonism of adipogenesis by inhibiting PPARγ and fatty acid binding protein 4 expression in BMSCs during the induced adipogenic differentiation process (23). These results demonstrated that the lipid metabolism disorder serve critical roles in the development of ONFH. The present results further confirmed the lipid metabolism disorder of ONFH as well as the lipid metabolism disorder significantly associated with the SREBP2 genotypes, first suggesting the evidence SREBP2 gene polymorphisms intruding in the lipid metabolism disorder of ONFH. The complicated effects of SREBP2 on lipid homeostasis relate to the molecular functions of multiple signaling pathways. The detailed roles of SREBP2 gene in the lipid metabolism disorder of ONFH need to be elucidated.

In conclusion, the authors simultaneously showed the gene polymorphism and gene expression of SREBP2, as well as the lipid metabolism disorder in 182 ONFH patients and 179 healthy controls and their association with the clinical phenotypes and development of ONFH. The results demonstrated that SREBP2 gene polymorphisms are closely associated with lipid metabolism disorder and the development of ONFH.

Acknowledgements

The authors appreciate the support from all of the surgeons in the Department of Orthopedics who were involved in patient care and control and all of the graduate students of The Research Center who were involved in genomic DNA extraction. This work was supported by the Projects of Health Management Department of the Jilin Province, China (grant no. 20132003), the Project of Bethune Youth Foundation of Jilin University, China (grant no. 2015409), the Department of Science and Technology of the Jilin Province, China (grant nos. 20140311006YY and 20150312022ZG), and the Development and Reform Commission of the Jilin Province, China [grant no. 2014G073, the Project of Application Demonstration Center of Precision Medicine for Molecular Diagnosis in Jilin Province (2016–2018)].

References

1 

Mont MA, Cherian JJ, Sierra RJ, Jones LC and Lieberman JR: Nontraumatic osteonecrosis of the femoral head: Where do we stand today? A ten-year update. J Bone Joint Surg Am. 97:1604–1627. 2015. View Article : Google Scholar : PubMed/NCBI

2 

Moya-Angeler J, Gianakos AL, Villa JC, Ni A and Lane JM: Current concepts on osteonecrosis of the femoral head. World J Orthop. 6:590–601. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Chai W, Zhang Z, Ni M, Geng P, Lian Z, Zhang G, Shi LL and Chen J: Genetic association between methylenetetrahydrofolate reductase gene polymorphism and risk of osteonecrosis of the femoral head. Biomed Res Int. 2015:1964952015. View Article : Google Scholar : PubMed/NCBI

4 

Wang Z, Zhang Y, Kong X, Li S, HU Y, Wang R, Li Y, Lu C, Lin N and Chen W: Association of a polymorphism in PON-1 gene with steroid-induced osteonecrosis of femoral head in Chinese Han population. Diagn Pathol. 8:1862013. View Article : Google Scholar : PubMed/NCBI

5 

Kim H, Cho C, Cho Y, Cho S, Yoon K and Kim K: Significant associations of PAI-1 genetic polymorphisms with osteonecrosis of the femoral head. BMC Musculoskelet Disord. 12:1602011. View Article : Google Scholar : PubMed/NCBI

6 

Peng KT, Huang KC, Huang TW, Lee YS, Hsu WH, Hsu RW, Ueng SW and Lee MS: Single nucleotide polymorphisms other than factor V Leiden are associated with coagulopathy and osteonecrosis of the femoral head in Chinese patients. PLoS One. 9:e1044612014. View Article : Google Scholar : PubMed/NCBI

7 

Tang JJ, Li JG, Qi W, Qiu WW, Li PS, Li BL and Song BL: Inhibition of SREBP by a small molecule, betulin, improves hyperlipidemia and insulin resistance and reduces atherosclerotic plaques. Cell Metab. 13:44–56. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Bauer S, Wanninger J, Schmidhofer S, Weigert J, Neumeier M, Dorn C, Hellerbrand C, Zimara N, Schäffler A, Aslanidis C and Buechler C: Sterol regulatory element-binding protein 2 (SREBP2) activation after excess triglyceride storage induces chemerin in hypertrophic adipocytes. Endocrinology. 152:26–35. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Ficat RP: Idiopathic bone necrosis of the femoral head. Early diagnosis and treatment. J Bone Joint Surg Br. 67:3–9. 1985.PubMed/NCBI

10 

Singh DK, Rosenhouse-Dantsker A, Nichols CG, Enkvetchakul D and Levitan I: Direct regulation of prokaryotic kir channel by cholesterol. J Biol Chem. 284:30727–30736. 2009. View Article : Google Scholar : PubMed/NCBI

11 

Boden G, Salehi S, Cheung P, Homko C, Song W, Loveland-Jones C and Jayarajan S: Comparison of in vivo effects of insulin on SREBP-1c activation and INSIG-1/2 in rat liver and human and rat adipose tissue. Obesity (Silver Spring). 21:1208–1214. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Kostopoulou F, Gkretsi V, Malizos KN, Iliopoulos D, Oikonomou P, Poultsides L and Tsezou A: Central role of SREBP-2 in the pathogenesis of osteoarthritis. PLoS One. 7:e357532012. View Article : Google Scholar : PubMed/NCBI

13 

Qiu XM, Jin CT and Wang W: Association between single nucleotide polymorphisms of sterol regulatory element binding protein-2 gene and risk of knee osteoarthritis in a Chinese Han population. J Int Med Res. 42:320–328. 2014. View Article : Google Scholar : PubMed/NCBI

14 

Kim TH, Baek JI, Hong JM, Choi SJ, Lee HJ, Cho HJ, Park EK, Kim UK and Kim SY: Significant association of SREBP-2 genetic polymorphisms with avascular necrosis in the Korean population. BMC Med Genet. 9:942008. View Article : Google Scholar : PubMed/NCBI

15 

Song Y, Du ZW, Li QJ, Zhang GZ, Wang LL, Wu N, Wang JC and Gao ZL: Association of sterol regulatory element binding protein 2 and insulin-like growth factor binding protein 3 genetic polymorphisms with avascular necrosis of the femoral head in the Chinese population. Chin Med J (Engl). 125:4037–4043. 2012.PubMed/NCBI

16 

Wang L, Luo DK and Pan ZY: Expression of 11β-HSD in steroid-induced avascular necrosis of the femoral head. Mol Med Rep. 7:1482–1486. 2013. View Article : Google Scholar : PubMed/NCBI

17 

Liu T, Su Q, Zang L, Kang N, Wang Y and Hai Y: Correlation between local microenvironment leptin expression and avascular necrosis of the femoral head. Zhongguo Xiu Fu Chong Jian Wai Ke Za Zhi. 26:1319–1323. 2012.(In Chinese). PubMed/NCBI

18 

Jones JP Jr: Fat embolism, intravascular coagulation, and osteonecrosis. Clin Orthop Relat Res. 1–308. 1993.PubMed/NCBI

19 

Tintut Y, Moronny S and demer LL: Hyperlipidemia promotes osteoclastic potential of bone marrow cells ex vivo. Arterioscler Thromb Vasc Biol. 24:e6–e10. 2004. View Article : Google Scholar : PubMed/NCBI

20 

Shuai B, Shen L, Yang YP, Xie J, Shou ZX and Wei B: Low plasma adiponectin as a potential biomarker for osteonecrosis of the femoral head. J Rheumatol. 37:2151–2155. 2010. View Article : Google Scholar : PubMed/NCBI

21 

Jiang Y, Zhang Y, Zhang H, Zhu B, Li P, Lu C, Xu Y, Chen W and Lin N: Pravastatin prevents steroid-induced osteonecrosis in rats by suppressing PPARγ expression and activating Wnt signaling pathway. Exp Biol Med (Maywood). 239:347–355. 2014. View Article : Google Scholar : PubMed/NCBI

22 

Bennett JH, Joyner CJ, Triffitt JT and Owen ME: Adipocytic cells cultured from marrow have osteogenic potential. J Cell Sci. 99:131–139. 1991.PubMed/NCBI

23 

Yu Z, Fan L, Li J, Ge Z, Dang X and Wang K: Lithium prevents rat steroid-related osteonecrosis of the femoral head by β-catenin activation. Endocrine. 52:380–390. 2016. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Song Y, Du Z, Chen B, Ren M, Yang Q, Sui Y, Wang Q, Wang A, Zhao H, Qin Y, Qin Y, et al: Association of SREBP2 gene polymorphisms with the risk of osteonecrosis of the femoral head relates to gene expression and lipid metabolism disorders. Mol Med Rep 16: 7145-7153, 2017.
APA
Song, Y., Du, Z., Chen, B., Ren, M., Yang, Q., Sui, Y. ... Zhang, G. (2017). Association of SREBP2 gene polymorphisms with the risk of osteonecrosis of the femoral head relates to gene expression and lipid metabolism disorders. Molecular Medicine Reports, 16, 7145-7153. https://doi.org/10.3892/mmr.2017.7473
MLA
Song, Y., Du, Z., Chen, B., Ren, M., Yang, Q., Sui, Y., Wang, Q., Wang, A., Zhao, H., Qin, Y., Zhang, G."Association of SREBP2 gene polymorphisms with the risk of osteonecrosis of the femoral head relates to gene expression and lipid metabolism disorders". Molecular Medicine Reports 16.5 (2017): 7145-7153.
Chicago
Song, Y., Du, Z., Chen, B., Ren, M., Yang, Q., Sui, Y., Wang, Q., Wang, A., Zhao, H., Qin, Y., Zhang, G."Association of SREBP2 gene polymorphisms with the risk of osteonecrosis of the femoral head relates to gene expression and lipid metabolism disorders". Molecular Medicine Reports 16, no. 5 (2017): 7145-7153. https://doi.org/10.3892/mmr.2017.7473
Copy and paste a formatted citation
x
Spandidos Publications style
Song Y, Du Z, Chen B, Ren M, Yang Q, Sui Y, Wang Q, Wang A, Zhao H, Qin Y, Qin Y, et al: Association of SREBP2 gene polymorphisms with the risk of osteonecrosis of the femoral head relates to gene expression and lipid metabolism disorders. Mol Med Rep 16: 7145-7153, 2017.
APA
Song, Y., Du, Z., Chen, B., Ren, M., Yang, Q., Sui, Y. ... Zhang, G. (2017). Association of SREBP2 gene polymorphisms with the risk of osteonecrosis of the femoral head relates to gene expression and lipid metabolism disorders. Molecular Medicine Reports, 16, 7145-7153. https://doi.org/10.3892/mmr.2017.7473
MLA
Song, Y., Du, Z., Chen, B., Ren, M., Yang, Q., Sui, Y., Wang, Q., Wang, A., Zhao, H., Qin, Y., Zhang, G."Association of SREBP2 gene polymorphisms with the risk of osteonecrosis of the femoral head relates to gene expression and lipid metabolism disorders". Molecular Medicine Reports 16.5 (2017): 7145-7153.
Chicago
Song, Y., Du, Z., Chen, B., Ren, M., Yang, Q., Sui, Y., Wang, Q., Wang, A., Zhao, H., Qin, Y., Zhang, G."Association of SREBP2 gene polymorphisms with the risk of osteonecrosis of the femoral head relates to gene expression and lipid metabolism disorders". Molecular Medicine Reports 16, no. 5 (2017): 7145-7153. https://doi.org/10.3892/mmr.2017.7473
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team