Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
December-2017 Volume 16 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2017 Volume 16 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Cryptotanshinone exhibits therapeutical effects on cerebral stroke through the PI3K/AKT‑eNOS signaling pathway

  • Authors:
    • Weixin Zhu
    • Weihong Qiu
    • Ailan Lu
  • View Affiliations / Copyright

    Affiliations: Department of Rehabilitation, Jinhua Municipal Central Hospital, Jinhua, Zhejiang 321001, P.R. China
  • Pages: 9361-9366
    |
    Published online on: October 19, 2017
       https://doi.org/10.3892/mmr.2017.7824
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Cerebral stroke is a kind of acute cerebrovascular disease with high incidence, morbidity and disability. Treatments against various types of cerebral stroke are limited at preventive measurements due to the lack of effective therapeutic method. The present study aimed to investigate the protective effect of cryptotanshinone (CPT) on cerebral stroke, and investigate the possible mechanism involved in order to develop a novel therapy against stoke. The phosphoinositide 3‑kinase membrane translocation of cerebral stroke rats pretreated with CPT at various concentrations were measured, as well as the phosphorylation of protein kinase B (AKT) and endothelial nitric oxide synthase (eNOS). Additionally, the expression level of B‑cell lymphoma 2 (Bcl‑2), Bcl‑2‑associated X protein (Bax) and vascular endothelial growth factor were also assessed using western blotting and reverse transcription‑quantitative polymerase chain reaction. Furthermore, biochemical tests were used to measure the activity of superoxide dismutase (SOD), malondialdehyde (MDA) and nitric oxide (NO) in both the cerebral cortex and peripheral blood. As a result, CPT‑pretreated rats presented declined phosphoinositide 3‑kinase (PI3K) and AKT expression levels, indicating that the PI3K/AKT signaling pathway was inhibited. Increased Bcl‑2 and NO levels in both the cerebral cortex and peripheral blood demonstrated the anti‑apoptosis and blood vessel protection effect of CPT. Furthermore, increased SOD activity and declined MDA levels demonstrated suppressed lipid peroxidation. In conclusion, CPT exhibited a protective effect against cerebral stroke through inhibition of the PI3K/AKT‑eNOS signaling pathway. These results suggested the potential of CPT as a promising agent in the treatment of cerebral stroke.

Introduction

Cerebral stroke, also known as cerebral vascular accident (CVA), is a kind of acute cerebrovascular disease (1). Cerebral stroke, including ischemic stroke and hemorrhagic stroke caused by the blood vessels burst or vascular obstruction, results in brain tissue damage (2). Cerebral stroke has the characteristics of high incidence, morbidity and disability (3). Ischemic stroke has a higher incidence at 60–70% of the total number of cerebral apoplexy, while hemorrhagic stroke caused by the occlusion or stenosis of internal carotid artery or vertebral artery has a higher mortality in individuals aged 40 or older (4). At present, treatments against various types of cerebral stroke are mainly preventive due to the lack of effective therapeutic method.

Cryptotanshinone (CPT) extracted from Danshen (Salvia miltiorrhiza Bunge) has been reported to possess multiple pharmacological activities, including anti-cancer, anti-inflammatory, anti-oxidative, anti-diabetic and anti-obesity functions (5–9). Danshen, as a well-known traditional Chinese herb, is frequently used in the clinic in Chinese medicine to protect against several diseases, including cardiovascular diseases, diabetes, hepatitis, ischemic stroke, chronic renal failure and menstrual disorders. CPT isolated from Danshen is one of the major representative components (7). It has been reported to have obvious antitumor activity in a variety of cancer cells, including prostate carcinoma, hepatocarcinoma, rhabdomyosarcoma and melanoma cells (10,11). Additionally, CPT was demonstrated to inhibit MCF7 cell proliferation by suppressing mechanistic target of rapamycin-mediated CyclinD1 expression and Rb phosphorylation that lead to MCF7 cell apoptosis by inducing stress in the endoplasmic reticulum (ER) in breast carcinoma cells (12). This suggested that CPT may be effective for the treatment of cerebral stroke, which has previously rarely been reported. Therefore, the present study aimed to explore the feasibility of CPT as an anti-cerebral stroke agent and investigate the possible mechanisms involved.

Materials and methods

Animal grouping and drug delivery

Male Sprague-Dawley rats (weight, 140–160 g; n=36) of specific pathogen free class were purchased from SLAC animal, Shanghai, China. Animals were kept with the maintenance of environmental conditions at 20–26°C, 40–70% and a 12-h light/dark cycle, with free access to food and water. Rats were randomly allocated into 6 groups (n=6/group): Blank control (rats underwent a sham procedure without model induction or treatment), control (cerebral stroke rats without the treatment of CPT), low dose CPT (5 mg/kg), medium dose CPT (15 mg/kg), high dose CPT (45 mg/kg) and LY294002 (Merck KGaA, Darmstadt, Germany). Rats in the CPT groups were treated with different concentrations of CPT (Sigma-Aldrich; Merck KGaA) through intragastric administration for 24 h prior to surgery. All animal study protocols were approved by the Institutional Animal Care and Use Committee of Zhejiang Province Center Hospital (Zhejiang, China; IACUC-20130315-01).

Cerebral stroke model in rats

Rats were treated with CPT for 24 h, during which rats were fasted for the last 12 h of CPT treatment. A suture method was employed to generate a cerebral stroke model. Chloral hydrate (10%; 0.35 ml/100 g; Aladdin, Shanghai, China) was injected through intraperitoneal administration. Fully anesthetized rats were fixed on a plate at supine position and disinfected with iodine. The right side of subcutaneous tissue and gland were separated through the median incision on the neck of rats. The common carotid artery was ligated at the proximal part and the external carotid artery was ligated at the distal part. The internal carotid was blocked with a vascular clamp at the proximal part. An occlusion line was inserted into the internal carotid along the common carotid artery ~18 mm until the sensation of resistance. The crotch of common carotid artery, external carotid artery and internal carotid was ligated so as to fix the occlusion line before the suture of neck incision.

Biochemical analyses

Measurements of superoxide dismutase (SOD), malondialdehyde (MDA) and nitric oxide (NO) levels in the cerebral cortex and peripheral blood were assessed using commercial kits [Nanjing Jiancheng Bioengineering Institute, Nanjing, China; cat. nos. A001-2 (SOD), A003 (MDA) and A012 (NO)]. Tissue samples homogenized in 100 mmol/l Tris-HCl buffer were centrifuged at 10,000 × g for 20 min at 4°C. The content of SOD, MDA and NO were determined and calculated according to the manufacturer's protocol.

Western blot assay

Cerebral cortex samples (20 mg) were cut into pieces and mixed with 250 µl histiocyte lysis buffer (radioimmunoprecipitation assay buffer; Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) containing 0.01% protease inhibitor cocktail (Sigma-Aldrich; Merck KGaA). After fully lysing, samples were centrifuged at 12,000 × g for 15 min at 4°C and the supernatant was collected. A Bicinchoninic Acid protein quantification kit (Thermo Fisher Scientific, Inc., Waltham, MA, USA) was used to quantify the protein contents. Tissue samples (15 µg) were separated by 10% SDS-PAGE and subsequently transferred to a nitrocellulose filter membrane (EMD Millipore, Billerica, MD, USA) electrophoretically. Blots were blocked with 5% skimmed milk at room temperature for 1 h, followed by incubation with anti-phosphoinositide 3-kinase (PI3K; cat. no. ab189403; 1:1,000; Abcam, Cambridge, MA, USA), anti-phosphorylated (p)-PI3K (cat. no. ab182651; 1:1,000; Abcam), anti-protein kinase B (AKT; cat. no. #9272; 1:1,000; Cell Signaling Technology, Inc., Danvers, MA, USA), anti-p-AKT (cat. no. #9271; 1:1,000; Cell Signaling Technology, Inc.), endothelial nitric oxide synthase (eNOS; cat. no. #32027; 1:1,000; Cell Signaling Technology, Inc.), anti-p-eNOS (cat. no. ab195944; 1:500; Abcam), anti-B-cell lymphoma 2 (Bcl2; cat. no. sc-492; 1:400; Santa Cruz Biotechnology, Inc., Dallas, TX, USA), anti-Bcl-2 X-associated protein (Bax; cat. no. sc-493; 1:400; Santa Cruz Biotechnology, Inc.), anti-vascular endothelial growth factor (VEGF; cat. no. ab46154; 1:1,000; Abcam) and anti-GAPDH (cat. no. #5174; 1:1,500; Cell Signaling Technology, Inc.) primary antibodies at 4°C overnight, and then incubated with horseradish peroxidase-conjugated secondary antibodies at room temperature for 1 h [goat anti-mouse (cat. no. A0216) or anti-rabbit (cat. no. A0208) secondary antibody; 1:1,000; Beyotime Institute of Biotechnology, Shanghai, China]. Enhanced chemiluminescence (Thermo Fisher Scientific Inc.) was used to detect the blots visually.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from tissue samples and quantified using TRIzol Reagent (Invitrogen; Thermo Fisher Scientific, Inc.). A reverse transcription kit (Fermentas; Thermo Fisher Scientific, Inc.) was used to synthesis cDNA through a total volume of 25 µl (12 µl RNA-primer Mix, 5 µl 5X RT reaction buffer, 1 µl 25 mM dNTPs, 1 µl 25 U/µl RNase inhibitor, 1 µl 200 U/µl M-MLV Rtase, 1 µl Oligo(dt)18 and 4 µl DNase-free ddH2O). cDNA was then amplified using a SYBR Green PCR kit (Thermo Fisher Scientific, Inc.) through a total PCR system of 25 µl (12.5 µl SYBR Green Mix, 0.5 µl forward primer, 0.5 µl reverse primer, 9.5 µl ddH2O and 2 µl cDNA template). The PCR conditions consisted of initial denaturation for 10 min at 95°C, denaturing for 15 sec at 95°C and annealing for 45 sec at 60°C for 40 cycles. Amplification kinetic curves were obtained for 15 sec at 95°C, 1 min at 60°C, 15 sec at 95°C and 15 sec at 60°C. Primers used for the amplification are listed in Table I. Quantification of gene expression was performed using the 2−∆∆Cq method (13).

Table I.

Primers used for reverse transcription-quantitative polymerase chain reaction.

Table I.

Primers used for reverse transcription-quantitative polymerase chain reaction.

GenePrimer sequenceSpeciesAmplicon size (bp)
Bcl-2F: 5′ GGGACGCGAAGTGCTATTGG 3′Rattus norvegicus214
R: 5′ GTTGCTCTCAGGCTGGAAGG 3′
VEGFF: 5′ GAGTCTGTGCTCTGGGATTTG 3′Human188
R: 5′ TCCTGCTACCTCTTTCCTCTG 3′
BaxF: 5′ TTGACGGTAAGGACGGACTC 3′Human134
R: 5′ GGCGTTCCCATACTTCACAC 3′
GAPDHF: 5 GTCGGTGTGAACGGATTTG 3′Human181
R: 5′ TCCCATTCTCAGCCTTGAC 3′

[i] F, forward; R, reverse; Bcl-2, B cell lymphoma 2; VEGF, vascular endothelial growth factor; Bax, Bcl-2-associated X protein.

Statistical analysis

Data were analyzed by one-way analysis of variance followed by Tukey's post hoc test, using GraphPad Prism 6.0 software (GraphPad, La Jolla, CA, USA). Data are presented as the mean ± standard deviation. P<0.05 was considered to indicate a statistically significant difference.

Results

CPT inhibits the PI3K/AKT signaling pathway

The membrane translocation of PI3K and the phosphorylation of AKT during stroke were measured by using western blotting. As presented in Fig. 1, the phosphorylation levels of PI3K were markedly increased in the stroke group compared with the blank control. Additionally, cerebral stroke was able to induce significant phosphorylation of the PI3K downstream effector protein AKT (n=3 independent repeats; P<0.001), and both PI3K membrane translocation and AKT phosphorylation were significantly attenuated in CPT groups. As a positive control, PI3K membrane translocation in the LY294002 group demonstrated a similar result compared with the CPT high dose group. Although there was significant difference in AKT phosphorylation between CPT high dose group and LY294002 group (n=3, P<0.01), it demonstrated a tendency to decrease in the CPT groups dose-dependently. Furthermore, the expression level of endothelial nitric oxide synthase (eNOS) was measured. The eNOS expression was increased and attenuated in the stroke and CPT groups, respectively, in comparison with the control (Fig. 1).

Figure 1.

Phosphorylation of PI3K/AKT signaling pathway proteins, as measured by western blotting. (A) Representative western blot images and (B) quantification of PI3K, AKT and eNOS protein expression levels. GAPDH served as an internal control. Data are presented as the mean ± standard deviation (n=3 independent experiments). ***P<0.001 vs. control group; #P<0.05, ##P<0.01 vs. LY294002 group. AKT, protein kinase B; p, phosphorylated; eNOS, endothelial nitric oxide synthase; PI3K, phosphoinositide 3-kinase; CPT, cryptotanshinone.

CPT regulates downstream effector proteins

Furthermore, the expression level of VEGF was measured by using western blotting and RT-qPCR. The protein expression of VEGF activated by the PI3K signaling pathway was significantly increased in stroke rats compared with the blank control. However, the increased VEGF expression was attenuated by CPT in a dose-dependent manner (Fig. 2A and B). The expression levels of the AKT downstream proteins Bcl2 and Bax were also measured. Bcl2 protein expression levels decreased significantly in the stroke compared with the blank control (n=3, P<0.001). However, decreased Bcl2 expression was attenuated in the CPT groups in a dose-dependent manner. On the other hand, Bax was markedly upregulated in the stroke group compared with the control (n=3, P<0.001). Similarly, the increased expression level of Bax was attenuated by CPT dose-dependently. Both Bcl2 and Bax expression levels in higher dose CPT groups were restored to a more similar level to the LY294002 group, though there were significant differences (n=3; P<0.05, Bcl2 vs. LY294002; P<0.001, Bax vs. LY294002).

Figure 2.

Expression level of phosphoinositide 3-kinase/protein kinase B signaling pathway downstream proteins, as measured by western blotting and reverse transcription-quantitative polymerase chain reaction. (A) Representative western blot images and (B) quantification of protein expression levels of Bcl-2, Bax and VEGF. GAPDH served as an internal control. (C) mRNA expression levels of Bcl-2, Bax and VEGF. Data are presented as the mean ± standard deviation (n=3 independent experiments). ***P<0.001 vs. control group; #P<0.05, ##P<0.01, ###P<0.001 vs. LY294002 group. Bcl-2, B-cell lymphoma 2; Bax, Bcl-2-associated X protein; VEGF, vascular endothelial growth factor; CPT, cryptotanshinone.

CPT regulates NO level

As presented in Fig. 3A, a significant decrease in NO level was detected in the stroke group compared with the control in both cerebral cortex and peripheral blood, while it increased dose-dependently in the CPT groups and demonstrated no significant difference compared with the LY294002 group.

Figure 3.

Content of NO, MDA and SOD in the cortex and peripheral blood. (A) NO, (B) MDA and (C) SOD content. Data are presented as the mean ± standard deviation (n=3 independent experiments). *P<0.05, **P<0.01, ***P<0.001 vs. control group; #P<0.05, ##P<0.01 vs. LY294002 group. CPT, cryptotanshinone; NO, nitric oxide; MDA, malondialdehyde; SOD, superoxide dismutase.

CPT inhibits lipid peroxidation

SOD and MDA were measured to evaluate the oxidative damage caused by stroke (Fig. 3B and C). Similar results were obtained from both cerebral cortex and peripheral blood. Lower levels of SOD were detected in the stroke group, and this effect was attenuated in the CPT groups dose-dependently. Conversely, a higher content of MDA was measured in the stroke group, and it declined in the CPT groups in a dose-dependent manner. Both MDA and SOD content in the control group were similar to the LY294002 group.

Discussion

PI3K has been implicated as a signaling enzyme activated by chemoattractant receptors (14,15). A previous study reported that an agonist binding to the C5a receptor can activate multiple signaling proteins, including PI3K. The PI3K inhibitors wortmannin and LY294002 were demonstrated to inhibit chemotaxis in macrophages treated with chemoattractants (16). The activation of PI3K largely involves the substrates inside the plasma membrane. A variety of growth factors and signal transduction compounds, including fibroblast growth factor (FGF), VEGF, human growth factor, angiopoietin I (AngI) and insulin, can activate PI3K through the activation of receptor tyrosine kinase, resulting in phosphorylation (17,18). The activation of PI3K leads to the generation of secondary messenger plasma membrane intrinsic protein 3, which combines with signaling protein AKT and phosphoinositide dependent kinase-1 (PDK1). The combination induces the phosphorylation of Ser308 in AKT by PDK1, resulting in the activation of AKT. AKT is a major downstream effector of PI3K (19). AKT acts as an anti-apoptosis agent through the phosphorylation of downstream target proteins. AKT activates IκB kinase, leading to the degradation of the NF-κB inhibitor IκB, resulting in the activation of NF-κB, so as to improve the survival of cells (12). The phosphorylation of Bcl-2-associated agonist of cell death, which belongs to Bcl-2 family, inhibits the combination to Bcl-extra large, resulting in the initiation of cell apoptosis. Additionally, AKT inhibits Caspase-9 so as to arrest the activation of apoptosis cascades. In the present study, reduced phosphorylation of PI3K in the CPT and LY294002 groups indicated the PI3K/AKT signaling pathway was suppressed. These findings suggested that CPT might inhibit the activation of PI3K as the PI3K inhibitor LY294002, leading to the declined AKT phosphorylation.

Furthermore, PI3Kg serves a critical role in the regulation of leukocyte functions, such as chemotaxis and superoxide production. Oxygen free radicals cause lipid peroxidation through attacking the polyunsaturated fatty acid to generate lipid peroxide, some of which can lead to cell metabolism and function disorder (20). MDA is a sensitive index of ROS-mediated lipid peroxidation which contributes to stroke damage, while SOD is an endogenous antioxidant enzyme developed to inhibit the production of ROS. Studies of MDA are generally combined with measuring SOD activity (21–23). The activity of SOD reflects the ability of remove oxygen free radicals, while the level of MDA indicates the damage of tissues and cells caused by free radicals. Previous studies demonstrated that the development of ROS serves an important role in tissue damage caused by stroke. Generated ROS in tissues experienced during ischemia and reperfusion is metabolized to prostaglandins and leukotrienes, resulting in the chemotaxis of leukocytes, and control of vascular endothelial cell function (24–26). In the present study, results obtained from biochemical tests demonstrated significantly increased MDA level and decreased SOD activity, demonstrating tissue damage caused by ROS-mediated lipid peroxidation during stroke. CPT dose-dependently attenuated SOD activity and MDA level, indicating the protective effect of CPT on cerebral tissue against lipid peroxidation.

NO, catalyzed by NOS synthase through L-arg and oxygen, is one of the hottest topics in the field of life science research in recent years (27). NO has a close association with cardiovascular, nervous, stomach, kidney and liver diseases (28). NO is a novel immune molecule and inflammatory mediator which mediates the pathological actions of cytokines including endotoxin, tumor necrosis factor and interleukin-6. eNOS serves a key role in the regulation of vascular function; it generates NO to expand blood vessels. On the other hand, it also generates superoxide, leading to vasoconstriction. It was reported that S-glutathionylation is involved in the oxidation-reduction switch of eNOS (29). It was observed to be increased in the blood vessels with hypertension, correlating with the damaged hemangiectasis. This type of oxidant stress occurs in heart attack, stroke, diabetes and cancer, suggesting the reset of this oxidation-reduction switch in order to restore the normal function of NOS may work as a potential therapy. In the present study, an increase in NO level was detected after the treatment of CPT at various concentrations, suggesting the hemangiectasis of blood vessels, indicating the protective effect of CPT on cerebral tissues against stroke.

In conclusion, CPT presented a protective effect against cerebral stroke through suppressing the PI3K/AKT-eNOS signaling pathway. Inhibited PI3K regulated the downstream effector protein AKT. Rats treated with CPT exhibited increased Bcl-2 and NO levels in both the cerebral cortex and peripheral blood, demonstrating the anti-apoptosis and blood vessel protection effect of CPT. Furthermore, increased SOD activity and declined MDA level demonstrated suppressed lipid peroxidation. The present study suggested the potential of CPT as a potential agent in the treatment of cerebral stroke.

Acknowledgements

The present study was supported by the Jinhua city, Zhejiang Province and Social Development to Focus on Subject (grant no. 2014-3-007) and The Public Welfare Technology Application Research (Experimental Animal) Project of Zhejiang Province (grant no. 2017F81SA700035).

References

1 

Aries MJ, Elting JW, De Keyser J, Kremer BP and Vroomen PC: Cerebral autoregulation in stroke: A review of transcranial Doppler studies. Stroke. 41:2697–2704. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Stevenson SF, Doubal FN, Shuler K and Wardlaw JM: A systematic review of dynamic cerebral and peripheral endothelial function in lacunar stroke versus controls. Stroke. 41:e434–e442. 2010. View Article : Google Scholar : PubMed/NCBI

3 

Siniscalchi A, Gallelli L, Malferrari G, Pirritano D, Serra R, Santangelo E and De Sarro G: Cerebral stroke injury: The role of cytokines and brain inflammation. J Basic Clin Physiol Pharmacol. 25:131–137. 2014. View Article : Google Scholar : PubMed/NCBI

4 

Menon BK, Campbell BC, Levi C and Goyal M: Role of imaging in current acute ischemic stroke workflow for endovascular therapy. Stroke. 46:1453–1461. 2015. View Article : Google Scholar : PubMed/NCBI

5 

Chen W, Lu Y, Chen G and Huang S: Molecular evidence of cryptotanshinone for treatment and prevention of human cancer. Anticancer Agents Med Chem. 13:979–987. 2013. View Article : Google Scholar : PubMed/NCBI

6 

Kang BY, Chung SW, Kim SH, Ryu SY and Kim TS: Inhibition of interleukin-12 and interferon-gamma production in immune cells by tanshinones from Salvia miltiorrhiza. Immunopharmacology. 49:355–361. 2000. View Article : Google Scholar : PubMed/NCBI

7 

Wang N, Luo HW, Niwa M and Ji J: A new platelet aggregation inhibitor from Salvia miltiorrhiza. Planta Med. 55:390–391. 1989. View Article : Google Scholar : PubMed/NCBI

8 

Hur JM, Shim JS, Jung HJ and Kwon HJ: Cryptotanshinone but not tanshinone IIA inhibits angiogenesis in vitro. Exp Mol Med. 37:133–137. 2005. View Article : Google Scholar : PubMed/NCBI

9 

Li S, Wang H, Hong L, Liu W, Huang F, Wang J, Wang P, Zhang X and Zhou J: Cryptotanshinone inhibits breast cancer cell growth by suppressing estrogen receptor signaling. Cancer Biol Ther. 16:176–184. 2015. View Article : Google Scholar : PubMed/NCBI

10 

Don MJ, Liao JF, Lin LY and Chiou WF: Cryptotanshinone inhibits chemotactic migration in macrophages through negative regulation of the PI3K signaling pathway. Br J Pharmacol. 151:638–646. 2007. View Article : Google Scholar : PubMed/NCBI

11 

Wu CY, Hsieh CY, Huang KE, Chang C and Kang HY: Cryptotanshinone down-regulates androgen receptor signaling by modulating lysine-specific demethylase 1 function. Int J Cancer. 131:1423–1434. 2012. View Article : Google Scholar : PubMed/NCBI

12 

Kim EJ, Jung SN, Son KH, Kim SR, Ha TY, Park MG, Jo IG, Park JG, Choe W, Kim SS and Ha J: Antidiabetes and antiobesity effect of cryptotanshinone via activation of AMP-activated protein kinase. Mol Pharmacol. 72:62–72. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

14 

Stephens L, Ellson C and Hawkins P: Roles of PI3Ks in leukocyte chemotaxis and phagocytosis. Curr Opin Cell Biol. 14:203–213. 2002. View Article : Google Scholar : PubMed/NCBI

15 

Hawkins PT, Anderson KE, Davidson K and Stephens LR: Signalling through Class I PI3Ks in mammalian cells. Biochem Soc Trans. 34:647–662. 2006. View Article : Google Scholar : PubMed/NCBI

16 

Tsai HR, Yang LM, Tsai WJ and Chiou WF: Andrographolide acts through inhibition of ERK1/2 and Akt phosphorylation to suppress chemotactic migration. Eur J Pharmacol. 498:45–52. 2004. View Article : Google Scholar : PubMed/NCBI

17 

Bai Y, Zhu X, Chao J, Zhang Y, Qian C, Li P, Liu D, Han B, Zhao L, Zhang J, et al: Pericytes contribute to the disruption of the cerebral endothelial barrier via increasing VEGF expression: Implications for stroke. PLoS One. 10:e01243622015. View Article : Google Scholar : PubMed/NCBI

18 

Koh SH and Lo EH: The role of the PI3K pathway in the regeneration of the damaged brain by neural stem cells after cerebral infarction. J Clin Neurol. 11:297–304. 2015. View Article : Google Scholar : PubMed/NCBI

19 

Matsui T, Nagoshi T and Rosenzweig A: Akt and PI 3-kinase signaling in cardiomyocyte hypertrophy and survival. Cell Cycle. 2:220–223. 2003. View Article : Google Scholar : PubMed/NCBI

20 

Cui HJ, Yang AL, Zhou HJ, Wang C, Luo JK, Lin Y, Zong YX and Tang T: Buyang huanwu decoction promotes angiogenesis via vascular endothelial growth factor receptor-2 activation through the PI3K/Akt pathway in a mouse model of intracerebral hemorrhage. BMC Complement Altern Med. 15:912015. View Article : Google Scholar : PubMed/NCBI

21 

Peralta C, Bulbena O, Xaus C, Prats N, Cutrin JC, Poli G, Gelpi E and Roselló-Catafau J: Ischemic preconditioning: A defense mechanism against the reactive oxygen species generated after hepatic ischemia reperfusion. Transplantation. 73:1203–1211. 2002. View Article : Google Scholar : PubMed/NCBI

22 

Ozturk H, Gezici A and Ozturk H: The effect of celecoxib, a selective COX-2 inhibitor, on liver ischemia/reperfusion-induced oxidative stress in rats. Hepatol Res. 34:76–83. 2006. View Article : Google Scholar : PubMed/NCBI

23 

Murakami K, Kondo T, Kawase M, Li Y, Sato S, Chen SF and Chan PH: Mitochondrial susceptibility to oxidative stress exacerbates cerebral infarction that follows permanent focal cerebral ischemia in mutant mice with manganese superoxide dismutase deficiency. J Neurosci. 18:205–213. 1998.PubMed/NCBI

24 

Kim ID, Sawicki E, Lee HK, Lee EH, Park HJ, Han PL, Kim KK, Choi H and Lee JK: Robust neuroprotective effects of intranasally delivered iNOS siRNA encapsulated in gelatin nanoparticles in the postischemic brain. Nanomedicine. 12:1219–1229. 2016. View Article : Google Scholar : PubMed/NCBI

25 

Chandel NS, Trzyna WC, McClintock DS and Schumacker PT: Role of oxidants in NF-kappa B activation and TNF-alpha gene transcription induced by hypoxia and endotoxin. J Immunol. 165:1013–1021. 2000. View Article : Google Scholar : PubMed/NCBI

26 

Du Y, Zhu Y, Teng X, Zhang K, Teng X and Li S: Toxicological effect of manganese on NF-kB/iNOS-COX-2 signaling pathway in chicken testes. Biol Trace Elem Res. 168:227–234. 2015. View Article : Google Scholar : PubMed/NCBI

27 

Shiraki T, Aoyama T, Yokoyama C, Hayakawa Y, Tanaka T, Nishigaki K, Sawamura T and Minatoguchi S: LOX-1 plays an important role in ischemia-induced angiogenesis of limbs. PLoS One. 9:e1145422014. View Article : Google Scholar : PubMed/NCBI

28 

Duran WN, Breslin JW and Sánchez FA: The NO cascade, eNOS location, and microvascular permeability. Cardiovasc Res. 87:254–261. 2010. View Article : Google Scholar : PubMed/NCBI

29 

Kolluru GK, Siamwala JH and Chatterjee S: eNOS phosphorylation in health and disease. Biochimie. 92:1186–1198. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhu W, Qiu W and Lu A: Cryptotanshinone exhibits therapeutical effects on cerebral stroke through the PI3K/AKT‑eNOS signaling pathway. Mol Med Rep 16: 9361-9366, 2017.
APA
Zhu, W., Qiu, W., & Lu, A. (2017). Cryptotanshinone exhibits therapeutical effects on cerebral stroke through the PI3K/AKT‑eNOS signaling pathway. Molecular Medicine Reports, 16, 9361-9366. https://doi.org/10.3892/mmr.2017.7824
MLA
Zhu, W., Qiu, W., Lu, A."Cryptotanshinone exhibits therapeutical effects on cerebral stroke through the PI3K/AKT‑eNOS signaling pathway". Molecular Medicine Reports 16.6 (2017): 9361-9366.
Chicago
Zhu, W., Qiu, W., Lu, A."Cryptotanshinone exhibits therapeutical effects on cerebral stroke through the PI3K/AKT‑eNOS signaling pathway". Molecular Medicine Reports 16, no. 6 (2017): 9361-9366. https://doi.org/10.3892/mmr.2017.7824
Copy and paste a formatted citation
x
Spandidos Publications style
Zhu W, Qiu W and Lu A: Cryptotanshinone exhibits therapeutical effects on cerebral stroke through the PI3K/AKT‑eNOS signaling pathway. Mol Med Rep 16: 9361-9366, 2017.
APA
Zhu, W., Qiu, W., & Lu, A. (2017). Cryptotanshinone exhibits therapeutical effects on cerebral stroke through the PI3K/AKT‑eNOS signaling pathway. Molecular Medicine Reports, 16, 9361-9366. https://doi.org/10.3892/mmr.2017.7824
MLA
Zhu, W., Qiu, W., Lu, A."Cryptotanshinone exhibits therapeutical effects on cerebral stroke through the PI3K/AKT‑eNOS signaling pathway". Molecular Medicine Reports 16.6 (2017): 9361-9366.
Chicago
Zhu, W., Qiu, W., Lu, A."Cryptotanshinone exhibits therapeutical effects on cerebral stroke through the PI3K/AKT‑eNOS signaling pathway". Molecular Medicine Reports 16, no. 6 (2017): 9361-9366. https://doi.org/10.3892/mmr.2017.7824
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team