Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
January-2018 Volume 17 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2018 Volume 17 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Comparison of the osteogenic differentiation of orofacial bone marrow stromal cells prior to and following marsupialization in patients with odontogenic cyst

  • Authors:
    • Yao Sun
    • Juan Zhang
    • Naiying Qian
    • Guoqi Sima
    • Jianming Zhang
    • Jiayong Zhong
    • Zhiqin Guo
    • Yawen Chen
    • Weijie Dong
  • View Affiliations / Copyright

    Affiliations: Department of Stomatology, The First Hospital of Jiaxing, Jiaxing, Zhejiang 314000, P.R. China, Department of Stomatology, Zhenjiang Stomatological Hospital, Zhenjiang, Jiangsu 212000, P.R. China
    Copyright: © Sun et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 988-994
    |
    Published online on: November 3, 2017
       https://doi.org/10.3892/mmr.2017.7949
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Decompression has been considered a valuable tool for odontogenic cystic lesions to minimize cyst size with low morbidity and recurrence. However, whether decompression has a role in regulating stem cell properties of orofacial bone marrow stromal cells (BMSCs) around the cysts has not been fully investigated. The present study compared the stem cell marker profile and osteogenic differentiation potential of orofacial BMSCs prior to and following marsupialization (pre‑BMSCs vs. post‑BMSCs) in the same individuals. The results demonstrated that post‑BMSCs proliferated significantly faster, displayed higher colony‑forming unit‑fibroblast capacity and demonstrated higher expression of octamer binding protein 4, Nanog and SRY‑related HMG box 2 when compared with the pre‑BMSCs. Notably, the osteogenic potential was greater in the post‑BMSCs compared with in pre‑BMSCs, by demonstrating that the protein and mRNA expression levels of osteopontin, runt‑related transcription factor 2, osteocalcin, alkaline phosphatase and osterix were upregulated in pre‑BMSCs. Furthermore, the phosphorylated levels of extracellular signal‑regulated kinase and c‑Jun N‑terminal kinase were enhanced in post‑BMSCs. In conclusion, the study indicated that decompression influences the stem cell properties of orofacial BMSCs, and further studies are needed to verify the findings.

Introduction

Odontogenic cysts are the most common lesions in the jaw, which usually grow large along with resorbing the bone and expanding into surrounding tissues, leading some vital structures (i.e., inferior alveolar neurovascular bundle, and maxillary sinus) damage and causing facial asymmetry, displacement of teeth, and pathologic fractures (1–3). Removal of the cysts is necessary, but enucleation of these lesions can bring forth a risk of complications such as infection, fracture of the jaw, or nerve injury. Recently, decompression with marsupialization has been recommended as a more conservative treatment for large odontogenic cysts. Decompression can mitigate the intramural pressure and reduce the cytokines production, in favor of maintenance of pulp vitality, preservation of the inferior alveolar nerve or maxillary sinus, prevention of fracture of the jaw, and minimization of the recurrence risk (4–7).

Human bone marrow stromal cells (BMSCs) have been widely studied and used as a therapeutic tool in numerous studies and clinical trials due to their unique characteristics, including ease of isolation, amplification in vitro, immunological tolerance and multipotent capacity (8,9). Previous studies have showed that BMSCs from human alveolar/jaw bone have osteogenic potential to promote regeneration of alveolar bone (10). Moreover, differentiation of BMSCs into osteoblasts is regulated by many factors including growth factors, cytokines, hormones and mechanical stress. Whilst decompression causes a reduction in the cyst volume with new bone formation, it is unclear if BMSCs respond to these changes. In this study, we examined the effects of decompression on the ‘stemness’ and osteogenic potential of alveolar BMSCs around the cysts.

Materials and methods

Samples and cell culture

Trabecular bone isolated with a rongeur from five patients with odontogenic cysts (three women and two men at the age ranging from 29 to 37 years), who provided informed consent at the Department of stomatology of the First Hospital of Jiaxing, Zhejiang, China. The study was carried out under approved guidelines of the Ethical Committee. Trabecular bone around cysts was separately collected during the marsupialization surgery and the second-stage procedure of cysts excision in same individuals. Nucleated cells isolated from each sample were cultured to establish primary BMSC using α-modified Eagle's medium (α-MEM; Gibco-BRL, Carlsbad, CA, USA) supplemented with 20% fetal bovine serum (FBS) (Equitech-Bio, Kerrville, TX, USA), 100 U/ml penicillin, 100 mg/ml streptomycin and 2 mM glutamine (Sangon Biotech Co., Ltd., Shanghai, China), as previously described (11,12). Cultures were maintained at 37°C in a humidified atmosphere of 5% CO2 and the culture medium changed thrice a week. Primary BMSCs from before (pre-BMSCs) and after (post-BMSCs) marsupialization were further expanded and then used at passage 2–4 for in vitro experiment.

Cell proliferation assay

BMSCs were seeded into 96-well plates at a density of 5×103 cells/well and incubated overnight in α-MEM medium. Then Cell Counting Kit-8 (CCK8; KeyGen Biotech Co., Ltd., Nanjing, China) solution was added to each well and incubated at 37°C for 1 h at room temperature. Absorbance at 450 nm was measured spectrophotometrically with a MRX II absorbance reader (Dynex Technologies, Inc., Chantilly, VA, USA). The proliferation assay was performed each day for 18 days consecutively.

Colony forming efficiency assay

For colony forming unit-fibrolast (CFU-F) assays, BMSCs were cultured in triplicate 25 cm2 plastic culture flasks at 103, 104 and 105 cells/flask with 6 mls of non-osteogenic growth medium (13). After incubation for 10 days without medium change, cultures were washed with PBS, fixed with 100% methanol and dyed bv an aqueous solution of saturated methyl violet (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). Aggregates of 50 or more cells were counted as colonies.

Flow cytometric analysis

BMSCs were trypsinized with 0.25% trypsin-EDTA, centrifuged at 1,500 g for 5 min, resuspended and aliquoted at PBS containing 3% FBS into a fluorescence-activated cell sorting (FACS) tube. Each aliquot containing 1×105 cells were incubated with saturating concentrations of primary antibodies or control IgG at room temperature for 30 min. The cells were washed twice by PBS and incubated with a fluorescent conjugated secondary antibody for 30 min at room temperature in dark. The following monoclonal antibodies (mAbs) were used: CD34-PE, CD90-PE, CD44-FITC, and CD45-FITC (Becton-Dickinson, Franklin Lakes, NJ, USA). Events were collected with FACScan (BD Bioscience), and the data were analyzed with FlowJo software (TreeStar, Ashland, OR, USA).

Immunofluorescence staining

BMSCs were were fixed with 4% paraformaldehyde for 20 min at room temperature and permeabilised with 0.1% Triton X-100 in PBS for 5 min. After rinsing with phosphate-buffered solution (PBS), the cells were blocked with 5% horse serum in PBS for 1 h at room temperature and then were incubated with fluorescein isothiocyanate (FITC)-conjugated STRO-1 (sc-47,733 FITC; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) and with phycoerythrin (PE)-conjugated CD105 (Santa Cruz, sc-18,838 PE) antibodies antibody (1:100 dilution) for 2 h at room temperature. After washing three times with PBS, cells were stained with DAPI (100 ng/ml) for 3 min. All of the images were captured with a fluorescence microscope (BX50 Olympus, Tokyo, Japan).

Osteogenic differentiation

BMSCs were trypsinized, resuspended and seeded in 96-well culture plates in a density of 1×104 cells/well. The next day, the growth medium was replaced by osteogenic medium to induce osteogenic differentiation (14). The cells were grown for 28 days and the medium was refreshed twice a week. Alkaline phosphatase (ALP) staining to detect osteoblasts was performed with the ALP kit and protocol (Sigma) on cultures grown in osteogenic medium for 7 days. All images were captured on a Olympus IX70 microscope (Olympus, Tokyo, Japan) at the same magnification and light intensity and analyzed by ImageJ software (NIH, Bethesda, MD, USA). Image segmentation was used to generate percent stained values for each field of view. At the 28th day of differentiation, the BMSCs were washed once with PBS and fixed with 4% paraformaldehyde (Sigma) for 15 min at room temperature. At the end of osteogenic stimulation, cells were fixed with 4% paraformaldehyde (Sigma) for 15 min, washed with dH2O, and stained with 1% Alizarin Red S for 30 min to assess the formation of the mineralized matrix. The level of calcium deposition was quantified by elution of AR-S following incubation in 10% cetylpyridinium chloride (Sigma-Aldrich) for 1 h at room temperature. Samples of the resulting solution were distributed on a 96-well plate and absorbance was read at 570 nm. All experiments were performed in triplicate with independent samples.

RNA isolation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from BMSCs using Trizol reagenl (Invitrogen, Carlsbad, CA, USA) and then reverse-transcribed with PrimeScript RT Master mix Kit (Takara, Otsu, Japan) according to manufacturer's recommended protocol. Quantitative real-time PCR was performed using an Eppendorf Mastercycler ep realplex machine (Eppendorf, Germany) and using SYBR Premix Ex Taq™ II Kit (Takara) according to the manufacturer's instructions. The primers were present in Table I. Real-time PCR reactions were carried out with the following conditions: Initial denaturation step at 95°C for 10 min, followed by 40 cycles of 5 sec at 95°C and 34 sec at 60°C. The specificity of PCR products was checked by melting curve analysis and gel electrophoresis. Relative mRNA expression levels were calculated by the 2−ΔΔCt method after by normalizing to GAPDH as an internal control (15).

Table I.

The primer sequences for PCR.

Table I.

The primer sequences for PCR.

GeneForward primers (5′-3′)Reverse primers (3′-5′)Product size (bp)
GAPDH AGAAGGCTGGGGCTCATTTG AGGGGCCATCCACAGTCTTC196
ALP GGACCATTCCCACGTCTTCAC CCTTGTAGCCAGGCCCATTG237
RUNX2 CCCGTGGCCTTCAAGGT CGTTACCCGCCATGACAGTA190
OCN CCCAGGCGCTACCTGTATCAA GGTCAGCCAACTCGTCACAGTC224
OPN CAGTTGTCCCCACAGTAGACAC GTGATGTCCTCGTCTGTAGCATC230
Osterix GCAGCTAGAAGGGAGTGGTG GCAGGCAGGTGAACTCTTC218
OCT4 GTATTCAGCCAAACGACCATC CTGGTTCGCTTTCTCTTTCG326
Nanog ATTCAGGACAGCCCTGATTCTTC TTTTTGCGACACTCTTCTCTGC360
SOX2 GACTTCACATGTCCCAGCACTA CTCTTTTGCACCCCTCCCATT298
c-myc GCTGCTTAGACGCTGGATTT TAACGTTGAGGGGCATCG252

[i] OPN, osteopontin; RUNX2, runt-related transcription factor 2; OCN, osteocalcin; ALP, alkaline phosphatase; OCT4, octamer binding protein 4; SOX2, SRY-related HMG box 2.

Western blotting

The BMSCs were collected and lysed in cell lysis buffer containing protease inhibitors at 15 min (Sangon Biotech Co., Ltd.). Then, total protein concentration in every lysate was calculated by a bicinchoninic acid (BCA) protein assay kit (Pierce; Thermo Fisher Scientific, Inc.). Equivalent amounts of protein samples (100 µg) were electrophoresed through 10–15% gels by SDS-PAGE and subsequently transferred to PVDF membranes. The membranes were then blocked for 1 h in 10% skimmed milk in Tris-buffered saline Tween (TBST) at room temperature and then incubated overnight at 4°C with primary antibodies: Anti-osteopontin (OPN; ab8448, 1:1,000), anti-runt-related transcription factor 2 (Runx2; ab54868, 1:1,000), anti-osterix (ab94744, 1:500), anti-ALP (ab83259, 1:500), and anti-osteocalcin (OCN; ab76690, 1:2,000) (all from Abcam, Cambridge, MA, USA), extracellular signal-regulated kinase1/2 (ERK1/2; no. 9102, 1;1,000), phosphorylated ERK1/2 (p-ERK1/2; no. 4370, 1;1,000), c-Jun N-terminal kinase (JNK; no. 9,252, 1:1,000), phosphorylated JNK (p-JNK; no. 9,251, 1:1,000), anti-p38 mitogen-activated protein kinase (p38 MAPK; no. 9,212, 1:1,000), phosphorylated-p38 MAPK (p-p38 MAPK; no. 9,215, 1:1,000), and anti-glyceraldehyde-phosphate dehydrogenase (GAPDH) (all from Cell Signaling Technology, Inc., Danvers, MA, USA), used at dilutions recommended by the manufacturer. Following three times washing with TBST, membranes were incubated with the corresponding horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature. Relative protein bands intensities were quantified using RapidStep™ ECL reagent (EMD Millipore, Billerica, MA, USA).

Statistical analysis

Results are showed as the mean ± standard deviation (SD) and all experiments were separately repeated at least three times. Statistical analysis was performed using the GraphPad Prism statistical package (version 5.0) and the Student's t-test was performed to assess differences between experimental groups. Differences were considered statistically significant at P<0.05.

Results

Isolation and identification of BMSCs in culture

BMSCs grew as adherent monolayers with a tendency to grow in clusters under microscope, and showed fibroblast-like morphology (Fig. 1A). The surface markers of mesenchymal stem cells (MSCs) were identified by flow cytometry and the results revealed positive staining for MSC markers (CD44 and CD90), and negative for hemacyte antigen markers (CD34 and CD45). Moreover, two early MSC markers STRO-1 and CD105, were also present on both pre- and post-BMSCs by confocal microscopy (Fig. 1C). All the results indicated that the isolated BMSCs were of mesenchymal origin and of high purity (Fig. 1B).

Figure 1.

Isolation of pre-BMSCs and post-BMSCs from orofacial bone. (A) Morphological aspects of the pre-BMSCs and post-BMSCs. (B) Flow cytometry analysis to detect the cell surface markers expression (CD34, CD44, CD45 and CD90) of the pre-BMSCs and post-BMSCs. (C) Immunofluorescence analysis of STRO-1 and CD105 expressions in pre-BMSCs and post-BMSCs (Scale bar, 100 µm).

Post-BMSCs proliferate faster and have an increased number of CFU-F and higher expression of stemness genes than pre-BMSCs

We first analysed the proliferation rate of pre-BMSCs and post-BMSC populations. The results showed that the capacity of proliferation was significantly higher in the post-BMSCs with respect to pre-BMSCs (Fig. 2A). Then, primary cultures of BMSCs were established at clonal density in order to obtain discrete colonies. The CFU-F of post-BMSCs was significant increased when compared with the pre-BMSCs, indicating that the self-renewal capability is significantly higher in post-BMSCs (Fig. 2B).

Figure 2.

Growth and self-renewal capacity of pre-BMSCs and post-BMSCs. (A) The proliferation of pre-BMSCs and post-BMSCs from day 2 to 16 days. (B) Colony forming unit fibroblast (CFU-F) in pre-BMSCs and post-BMSCs. (C and D) mRNA expression of stemness genes in pre-BMSCs and post-BMSCs evaluated by qRT-PCR. Results are mean ± SD. *P<0.05 compared with pre-BMSCs.

Next, we questioned if the decompression operation could influence the stemness genes expression in BMSCs. We observed that both pre-BMSCs and post-BMSCs expressed the transcripts of the embryonic stem cells including octamer binding protein 4 (OCT4), Nanog, SRY-related HMG box 2 (SOX2) and c-myc. Importantly, the mRNA expression of OCT4, Nanog and SOX2 was significantly higher in the post-BMSCs, whereas no significant difference in c-myc was detected between the two population (Fig. 3C). Collectively, these results clearly indicate that decompression surgery can influence several stem cell properties of BMSCs.

Figure 3.

Osteogenic differentiation potential of pre-BMSCs and post-BMSCs. (A) Osteogenic differentiation of pre-BMSCs and post-BMSCs stained with alizarin red. (B) Alizarin red quantification of mineralized deposits in sorted fractions of pre-BMSCs compared to post-BMSCs. (C) Osteogenic differentiation of pre-BMSCs and post-BMSCs stained with alkaline phosphatase. (D) Quantitation of alkaline phosphatase staining in (C) using the ImageJ software.

Osteogenic potential is higher in the post-BMSCs than in pre-BMSCs

Last, to test whether the pre-BMSCs and post-BMSCs exhibited differences in osteogenic capacity Alizarin Red S staining was employed to observe the calcium deposition in the osteogenic differentiation of BMSCs in vitro. The results showed that decompression operation could enhance the osteogenic differentiation potential of the BMSCs (Fig. 3A). These results were further confirmed by spectrophotometric quantification, with significant more absorbance noted in the post-BMSCs (Fig. 3B). Moreover, both pre- and post-BMSCs displayed a positive color signal of the ALP staining, the post-BMSCs showed a more intensive signal compared with the pre-BMSCs (Fig. 3C).

To further investigate the effects of decompression operation on osteogenic differentiation of BMSCs, the gene and protein expression levels of OPN, RUNX2, OCN, ALP and osterix were determined by RT-PCR and Western blotting, respectively. Post-BMSCs cultured in osteogenic medium showed a significant upregulation of protein levels in OPN, RUNX2, OCN, ALP and osterix than pre-BMSCs (Fig. 3A). RT-PCR analyses were consistent with the protein expression, demonstrating an increase in the gene levels of OPN, RUNX2, OCN, ALP and osterix in post-BMSCs with respect to the pre-BMSCs (Fig. 4B).

Figure 4.

The expression of osteoblast-associated genes in pre-BMSCs and post-BMSCs. (A) Protein expression and (B) mRNA expression of osteoblast marker genes in pre-BMSCs compared to post-BMSCs. *P<0.05 compared with pre-BMSCs.

Decompression operation activates ERK/JNK signaling pathway

To reveal the underlying mechanisms of decompression operation on proliferation, stemness and osteogenic differentiation of BMSCs, the phosphorylation of MAPK signaling pathway was evaluated in BMSCs. Western blot analysis illustrated phosphorylated levels of ERK and JNK were obviously enhanced in post-BMSCs, while no difference in phosphorylated level of p38 MAPK (Fig. 5), suggesting the activation of ERK/JNK signaling pathway was an important mechanisms for decompression operation.

Figure 5.

The activation of ERK, p38 MAPK and JNK signaling pathway in pre-BMSCs and post-BMSCs. Phos-phorylation of key kinases involved in ERK, p38 MAPK and JNK pathways were assessed by western blot analysis. *P<0.05 compared with pre-BMSCs.

Discussion

BMSCs have the characteristics of self-proliferation and multi-differentiation (e.g., osteogenic, chondrogenic, and adipogenic) potential, but marrow aspiration from iliac crest is an invasive procedure. It has been previously confirmed that orofacial (maxilla and mandible) BMSCs had the same fibroblastic shape as that isolated from the iliac crest, and their proliferative and osteogenic potentials were similar to those of iliac crest derived BMSCs (10,12). Therefore, orofacial BMSCs may be a cell source for promoting regeneration and remodeling of orofacial bone in patients with periodontal disease. However, many factors, such as growth factors, cytokines, hormones and mechanical stress, can influence osteogenic differentiation capability of BMSCs. In the present study, we aimed to explore the role of decompression in regulating the osteogenic differentiation of the orofacial BMSCs around the odontogenic cystic lesions.

In this study, we successfully isolated and characterised orofacial BMSCs from same individuals before and after marsupialization surgery. We observed that both pre-BMSCs and post-BMSCs highly expressed the BMSC markers such as CD44 and CD90. However, the proliferation and CFU-F capacity were significantly higher in post-BMSCs compared to pre-BMSCs. Importantly, post-BMSCs expressed a high level of OCT4, Nanog and SOX2, indicating that marsupialization surgery plays a key role in regulating the pluripotency of BMSCs around cysts tissues. Furthermore, a significant difference between the osteogenic potential of pre-BMSCs and post-BMSCs was detected in our current study. In fact, the osteogenic differentiation capacity of the post-BMSCs was significantly higher with respect to the pre-BMSCs. Collectively, all of these findings suggested that decompression of odontogenic cysts could promote the stemness and osteogenic potential of orofacial BMSCs.

There are several reasons may be explained for the effect of marsupialization on orofacial BMSCs. One reason was that the intracystic pressure decreased after marsupialization could promote osteogenesis in BMSCs. It has been shown that the intracystic fluid pressure in odontogenic jaw cyst could reach up to 38–47 mmHg (16), and reduced to 0 mmHg after marsupialization. Yang et al (17) demonstrated that BMSCs showed a typical appearance of osteoblast after two weeks of induction by intermittent negative pressure, and the activity of ALP and expression of OPN increased significantly. Wiesmann et al (18) also confirmed that mechanical stimulation could promote the expression of collagen type I and osteonectin in BMSCs. Another reason was that the expression of inflammatory factors such as interleukin-1α (IL-1α) and prostaglandin E2 (PGE2) was decreased by marsupialization could inhibit osteoclastogenesis in BMSCs (19). It has been showed that IL-1α and PGE2 evoked an increase in receptor activator of nuclear factor-κB ligand (RANKL) mRNA, and a decrease in osteoprotegerin (OPG) mRNA in BMSCs (20,21). All these factors may enhance the differentiated function of osteoblasts and bone formation. Further studies by using an in vitro model were needed to confirm all these potential mechanisms, which might help the application of marsupialization in patients with odontogenic cyst.

MAPKs, comprised of ERK, P38 MAPK and JNK, are serine-threonine protein kinases and participate in a mass of cellular activities, such as proliferation, inflammation, migration and differentiation (22,23). To elucidate the possible underlying mechanism, we finally evaluated the phosphorylation of ERK, p38 MAPK and JNK pathways in pre- and post-BMSCs. Results showed that the phosphorylated levels of ERK and JNK, rather than p38 pathway, were obviously enhanced in post-BMSCs compared to pre-BMSCs, suggesting that decompression operation might participate in the modulation of proliferation, stemness and differentiation through regulating ERK and JNK pathways in orofacial BMSCs.

In summary, our results show that decompression has a crucial role in regulating stem cell properties of orofacial BMSCs. Further understanding of the relation between intracystic pressure and cytokines changes and osteogenic differentiation potential of orofacial BMSCs are needed.

Acknowledgements

This study was supported by grants from the Science and Technology Plan Project of Jiaxing Zhejiang Province, China (no. 2016BY28004) and Medical and Health Science and Technology Project of Zhejiang Province, China (no. 2017KY650).

References

1 

Borrás-Ferreres J, Sánchez-Torres A and Gay-Escoda C: Malignant changes developing from odontogenic cysts: A systematic review. J Clin Exp Dent. 8:e622–e628. 2016.PubMed/NCBI

2 

Sharifian MJ and Khalili M: Odontogenic cysts: A retrospective study of 1227 cases in an Iranian population from 1987 to 2007. J Oral Sci. 53:361–367. 2011. View Article : Google Scholar : PubMed/NCBI

3 

Nuñez-Urrutia S, Figueiredo R and Gay-Escoda C: Retrospective clinicopathological study of 418 odontogenic cysts. Med Oral Patol Oral Cir Bucal. 15:e767–e773. 2010. View Article : Google Scholar : PubMed/NCBI

4 

Castro-Núñez J: Decompression of odontogenic cystic lesions: Past, present and future. J Oral Maxillofac Surg. 74:e1–e9. 2016. View Article : Google Scholar

5 

Allon DM, Allon I, Anavi Y, Kaplan I and Chaushu G: Decompression as a treatment of odontogenic cystic lesions in children. J Oral Maxillofac Surg. 73:649–654. 2015. View Article : Google Scholar : PubMed/NCBI

6 

Gao L, Wang XL, Li SM, Liu CY, Chen C, Li JW, Yan XJ, Zhang J, Ren WH and Zhi KQ: Decompression as a treatment for odontogenic cystic lesions of the jaw. J Oral Maxillofac Surg. 72:327–333. 2014. View Article : Google Scholar : PubMed/NCBI

7 

Pogrel MA: Decompression and marsupialization as a treatment for the odontogenic keratocyst. Oral Maxillofac Surg Clin North Am. 15:415–427. 2003. View Article : Google Scholar : PubMed/NCBI

8 

Egusa H, Sonoyama W, Nishimura M, Atsuta I and Akiyama K: Stem cells in dentistry-part I: Stem cell sources. J Prosthodont Res. 56:151–165. 2012. View Article : Google Scholar : PubMed/NCBI

9 

Honda MJ, Imaizumi M, Tsuchiya S and Morsczeck C: Dental follicle stem cells and tissue engineering. J Oral Sci. 52:541–552. 2010. View Article : Google Scholar : PubMed/NCBI

10 

Matsubara T, Suardita K, Ishii M, Sugiyama M, Igarashi A, Oda R, Nishimura M, Saito M, Nakagawa K, Yamanaka K, et al: Alveolar bone marrow as a cell source for regenerative medicine: Differences between alveolar and iliac bone marrow stromal cells. J Bone Miner Res. 20:399–409. 2005. View Article : Google Scholar : PubMed/NCBI

11 

Damek-Poprawa M, Stefanik D, Levin LM and Akintoye SO: Human bone marrow stromal cells display variable anatomic site-dependent response and recovery from irradiation. Arch Oral Biol. 55:358–364. 2010. View Article : Google Scholar : PubMed/NCBI

12 

Akintoye SO, Lam T, Shi S, Brahim J, Collins MT and Robey PG: Skeletal site-specific characterization of orofacial and iliac crest human bone marrow stromal cells in same individuals. Bone. 38:758–768. 2006. View Article : Google Scholar : PubMed/NCBI

13 

Kuznetsov S and Robey Gehron P: Species differences in growth requirements for bone marrow stromal fibroblast colony formation In vitro. Calcif Tissue Int. 59:265–270. 1996. View Article : Google Scholar : PubMed/NCBI

14 

Marrelli M, Paduano F and Tatullo M: Cells isolated from human periapical cysts express mesenchymal stem cell-like properties. Int J Biol Sci. 9:1070–1078. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

16 

Skaug N: Intracystic fluid pressure in non-keratinizing jaw cysts. Int J Oral Surg. 5:59–65. 1976. View Article : Google Scholar : PubMed/NCBI

17 

Yang Z, Liu M, Zhang YG, Guo X and Xu P: Effects of intermittent negative pressure on osteogenesis in human bone marrow-derived stroma cells. J Zhejiang Univ Sci B. 10:188–192. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Wiesmann A, Buhring HJ, Mentrup C and Wiesmann HP: Decreased CD90 expression in human mesenchymal stem cells by applying mechanical stimulation. Head Face Med. 2:82006. View Article : Google Scholar : PubMed/NCBI

19 

Ninomiya T, Kubota Y, Koji T and Shirasuna K: Marsupialization inhibits interleukin-1alpha expression and epithelial cell proliferation in odontogenic keratocysts. J Oral Pathol Med. 31:526–533. 2002. View Article : Google Scholar : PubMed/NCBI

20 

Oh S, Kyung TW and Choi HS: Curcumin inhibits osteoclastogenesis by decreasing receptor activator of nuclear factor-kappaB ligand (RANKL) in bone marrow stromal cells. Mol Cells. 26:486–489. 2008.PubMed/NCBI

21 

Brändström H, Jonsson KB, Ohlsson C, Vidal O, Ljunghall S and Ljunggren O: Regulation of osteoprotegerin mRNA levels by prostaglandin E2 in human bone marrow stroma cells. Biochem Biophys Res Commun. 247:338–341. 1998. View Article : Google Scholar : PubMed/NCBI

22 

Fu L, Tang T, Miao Y, Zhang S, Qu Z and Dai K: Stimulation of osteogenic differentiation and inhibition of adipogenic differentiation in bone marrow stromal cells by alendronate via ERK and JNK activation. Bone. 43:40–47. 2008. View Article : Google Scholar : PubMed/NCBI

23 

Gao Q, Walmsley AD, Cooper PR and Scheven BA: Ultrasound stimulation of different dental stem cell populations: role of mitogen-activated protein kinase signaling. J Endod. 42:425–431. 2016. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Sun Y, Zhang J, Qian N, Sima G, Zhang J, Zhong J, Guo Z, Chen Y and Dong W: Comparison of the osteogenic differentiation of orofacial bone marrow stromal cells prior to and following marsupialization in patients with odontogenic cyst. Mol Med Rep 17: 988-994, 2018.
APA
Sun, Y., Zhang, J., Qian, N., Sima, G., Zhang, J., Zhong, J. ... Dong, W. (2018). Comparison of the osteogenic differentiation of orofacial bone marrow stromal cells prior to and following marsupialization in patients with odontogenic cyst. Molecular Medicine Reports, 17, 988-994. https://doi.org/10.3892/mmr.2017.7949
MLA
Sun, Y., Zhang, J., Qian, N., Sima, G., Zhang, J., Zhong, J., Guo, Z., Chen, Y., Dong, W."Comparison of the osteogenic differentiation of orofacial bone marrow stromal cells prior to and following marsupialization in patients with odontogenic cyst". Molecular Medicine Reports 17.1 (2018): 988-994.
Chicago
Sun, Y., Zhang, J., Qian, N., Sima, G., Zhang, J., Zhong, J., Guo, Z., Chen, Y., Dong, W."Comparison of the osteogenic differentiation of orofacial bone marrow stromal cells prior to and following marsupialization in patients with odontogenic cyst". Molecular Medicine Reports 17, no. 1 (2018): 988-994. https://doi.org/10.3892/mmr.2017.7949
Copy and paste a formatted citation
x
Spandidos Publications style
Sun Y, Zhang J, Qian N, Sima G, Zhang J, Zhong J, Guo Z, Chen Y and Dong W: Comparison of the osteogenic differentiation of orofacial bone marrow stromal cells prior to and following marsupialization in patients with odontogenic cyst. Mol Med Rep 17: 988-994, 2018.
APA
Sun, Y., Zhang, J., Qian, N., Sima, G., Zhang, J., Zhong, J. ... Dong, W. (2018). Comparison of the osteogenic differentiation of orofacial bone marrow stromal cells prior to and following marsupialization in patients with odontogenic cyst. Molecular Medicine Reports, 17, 988-994. https://doi.org/10.3892/mmr.2017.7949
MLA
Sun, Y., Zhang, J., Qian, N., Sima, G., Zhang, J., Zhong, J., Guo, Z., Chen, Y., Dong, W."Comparison of the osteogenic differentiation of orofacial bone marrow stromal cells prior to and following marsupialization in patients with odontogenic cyst". Molecular Medicine Reports 17.1 (2018): 988-994.
Chicago
Sun, Y., Zhang, J., Qian, N., Sima, G., Zhang, J., Zhong, J., Guo, Z., Chen, Y., Dong, W."Comparison of the osteogenic differentiation of orofacial bone marrow stromal cells prior to and following marsupialization in patients with odontogenic cyst". Molecular Medicine Reports 17, no. 1 (2018): 988-994. https://doi.org/10.3892/mmr.2017.7949
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team