International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Cranioplasty is the predominant method for the treatment of a variety of skull defects. Seizure is a common complication of skull injury and cranioplasty, with the incidence ranging between 14.8 and 33.0% (1,2). Seizures pose a serious threat to human health, with patients subsequently presenting with varying degrees of mental disorders and physical damage, which greatly impacts upon their normal learning and quality of life, and may bring serious mental and economic burdens to society and the patient's family. Seizures are a frequent neurological problem during the neonatal period, occurring in 1.8–5 out of 1,000 live births in Canada and The United States (3). The most common cause of neonatal seizures is hypoxic/ischemic encephalopathy, affecting 1–2 out of 1,000 live neonatal births, therefore contributing to ~2/3 of seizure cases in neonatal babies (3). Clinically, it can be challenging to diagnose neonatal seizures, which may be exclusively electrographic (4). In addition, currently available antiepileptic drugs (AEDs) are often not effective for neonatal seizures (5). The frequency of seizure has been demonstrated to be significantly elevated following cranioplasty, and previous research has indicated that valproic acid could decrease the risk of post-operative seizures (6).
Recently, microRNAs (miRNAs) have been identified as pivotal regulators of gene function, and this has been a significant step forward in our understanding of gene regulatory mechanisms (7,8). Although there are only a few hundred known miRNAs, it is estimated that miRNAs may regulate >1/3 of all human genes, as each miRNA is likely to regulate hundreds of target genes (9,10). miRNAs are involved in several intrinsic cellular processes, including cellular metabolism, immune responses, hematopoietic differentiation and cell-cycle regulation (11–14), and their expression patterns have been investigated in schizophrenia, Down's syndrome and a variety of tumors (15–17). Previous research demonstrated that valproic acid (VPA) was able to modulate miRNA expression profiles in rats (18). The interaction between miRNAs and their target genes is closely modulated, and our recent report investigated this using in silico methods to predict the network of miRNAs that interacted with and interrupted protein complexes following VPA administration (19). Furthermore, a previous study revealed that VPA was able to affect expression of miRNAs in the brain (18).
Based on these observations, the present study compared patients who underwent cranioplasty from March 2010 to March 2015 and used AEDs to control preoperative or postoperative cranioplasty-related seizures, with patients who did not use AED drugs across the same period. The role of miR155 and its potential target SCN1A in the control of post-operative seizure were explored. Downregulation of microRNA-155 by preoperative administration of VPA prevents postoperative seizure by upregulating SCN1A.
All patients who came to the Department of Neurosurgery, the Affiliated Yangming Hospital of Ningbo University (Ningbo, China) for cranioplasty from March 2010 to March 2015, and were self reliant in their ability to take care of themselves and to perform basic self-care were suitable for inclusion in the present study. A total of 85 cases were recruited into the study; 2 patients were lost to follow-up and 3 were excluded due to rejection reaction and infection, leaving 80 cases [57 males, 23 females; age 36.2±2.6 (range 17–72) years]. A total of 69 cases had subdural (or intracerebral) hematoma clearance + decompressive craniectomy due to brain trauma, and 11 had intracranial hematoma clearance + decompressive craniectomy due to intracranial spontaneous bleeding. Patients underwent craniotomies in the previous 3–25 months (average, 4.4±0.7 months) prior to undergoing the present cranioplasty. The patients presented with several skull defect sites: 52 cases of unilateral frontotemporal and parietal, 15 cases of bilateral frontotemporal and parietal, 9 cases of bilateral frontal, 3 cases of unilateral occipital and 1 case of bilateral occipital. Amongst all subjects, tissue samples were available for 48 participants (VPA treated, n=23; Control, n=25). The study protocol was approved by the research ethics committee at The Affiliated Yangming Hospital of Ningbo University (Ningbo, China), and written informed consent was obtained from each participant.
Patients who presented with the following were excluded: Patients who had hydrocephalus shunt under anesthesia; patients who had seizures prior to being hospitalized for the present cranioplasty, including those who had or had not used drug control; patients who had their implant titanium plate and nail for cranioplasty removed due to infection or rejection reaction following cranioplasty; and patients who had severe heart, liver or kidney dysfunctions or had routine blood abnormalities prior to surgery.
All enrolled patients were randomly divided into experimental and control groups. A few patients were not included in the statistics: 2 cases in the control group were lost to follow-up and 2 cases underwent reoperation due to postoperative rejection; 1 case in the experimental group developed an infection. There were 41 cases remaining in the VPA-treated group with 30 male cases and 11 female cases. SCN1A expression was detected in 23 of them. Patients received craniotomies in the previous 3–20 months (average, 4.2±0.5 months) prior to undergoing the present cranioplasty. The experimental patients presented with the following skull defects: 26 cases of unilateral frontotemporal and parietal, 9 cases of bilateral frontotemporal and parietal, 4 cases of bilateral frontal, 2 cases of other sites. The defect area of each bone window was between 4×4 and 12×16 cm (average, 9.5×10.2 cm). There were 39 cases remaining in the control group, with 28 male and 11 female cases. SCN1A expression was detected in 25 of them. Patients received craniotomies in the previous 3.3–25 months (average, 4.6±0.8 months) prior to undergoing the present cranioplasty. The control patients presented with the following skull defects: 26 cases of unilateral frontotemporal and parietal, 6 cases of bilateral frontotemporal and parietal, 5 cases of bilateral frontal, 2 cases of other sites. The defect area of each bone window was between 4×5 and 13×15 cm (average, 9.4×10.5 cm). The two groups of patients had no significant difference in clinical features (data not shown).
Patients underwent clinical examination following admission, including liver and kidney function analyses, routine blood tests and head computed tomography scan. Patients were fitted for custom titanium mesh plates, and underwent operation ~5 days later. Under general anesthesia, the scalp was cut open along the original surgical incision line to the skull, and the scalp and temporal muscle were carefully peeled to expose the endocranium and fully expose the bone window surface. The custom titanium (titanium mesh) plate was placed on the skull window and was fixed with a few titanium nails. Outside the plate a drainage tube was connected with negative pressure (to be removed 48 h later). All patients were started on medicine 4 days prior to surgery (following admission and whilst the custom titanium mesh plate was prepared) until 1 month following surgery. The control group took oral 20 mg ATP tablet (tid). The experimental group took ATP (20 mg) and Compound Sodium Valproate and Valproic Acid Sustained Release tablets [500 mg (bid); Sanofi-Aventis (Hangzhou) Pharmaceuticals Co., Ltd., Hangzhou, China].
The following clinical parameters were observed and compared between the two groups of patients: Incidence of seizures following admission (4 days prior to surgery) up to 1 month following surgery; abnormal rate of liver function; routine blood tests or other indicators 2 weeks post-surgery (serum aspartate aminotransferase >2-fold of the preoperative level was considered abnormal; white blood cell or platelet count reduced by ≥50% of the preoperative level was considered abnormal).
U251 cells (American Type Culture Collection, Manassas, VA, USA) were selected for the analysis due to low levels of expression of miR-155. U251 cells were grown in Dulbecco's modified Eagle's medium (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA), supplemented with 1% penicillin/streptomycin, 2 mM glutamine and 10% fetal bovine serum (Invitrogen; Thermo Fisher Scientific, Inc.) at 37°C with 5% CO2/95% air. When confluence reached 80%, Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) was used to transfect U251 cells with miRNA (miR)-155 mimics (5UUA AUG CUA AUC GUG AUA GGG G3), negative control (NC; 5CAG UAC UUU UGU GUA GUA CAA3) and miR-155 inhibitors (5CCC CUA UCA CGA UUA GCA UUA A3), in accordance with the manufacturers protocol (GenePharma, Shanghai, China). The final concentration of miR-155, NC and inhibitor is 100 nM. Three independent experiments were performed.
TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) was used to purify total RNA from U251 cells (5×106 cells) and cerebrospinal fluid (CSF) samples (2 ml) in accordance with the manufacturer's protocol. CSF was sampled via epidural during surgery. All CSF samples were put on ice immediately and spun within 15 min at 500 × g for 10 min; the supernatant was stored at −80°C until further use. DNaseI treatment (Takara Bio Inc., Otsu, Japan) was used to treat the total RNA, according to the manufacturer's protocol. A NanoDrop (Thermo Fisher Scientific, Inc., Wilmington, DE, USA) was used to assess the concentration and quality of RNA. QuantiTect_SYBR_Green RT-PCR kit (Qiagen GmbH, Hilden, Germany) was used to synthesize cDNA from 200 ng total RNA, in accordance with the manufacturer's protocol. An Applied Biosystems 7500 Sequence Detection System (Thermo Fisher Scientific, Inc., USA) was used to perform qPCR. The upstream primers (5–3) used in the study were: TTA ATG CTA ATC GTG ATA GG for miR-155; AATTGCACTCGTCCCGGCCTCC for miR-92b; CCTCTGGGCCCTTCCTCCAG for miR-326; CTGGCCCTCTCTGCCCTTCCGT for miR-328; TAT GAC TGA TGT GTG CGT GTG TCT G for miR-468; AGG GAT CGC GGG CGG GTG GCG GCC T for miR-638; AGG CGG GGC GCC GCG GGA CCG C for miR-663; GTG CGG AAC GCT GGC CGG GGC G for miR-685. Downstream primer was the universal primer supplied by Qiagen GmbH. The thermocycling reaction involved 95°C for 10 min (initial denaturation), followed by 40 cycles of 95°C for 15 sec and 60°C for 60 sec. Small nuclear RNA U6 (5′CTCGCTTCGGCAGCACA3′ and 5′AACGCTTCACGAATTTGCGT3′) was used as an internal control to normalize the expression of microRNAs.
For SCN1A detection, each sample was reverse transcribed into cDNA and analyzed by SYBR-Green Real-Time PCR kit (Bio-Rad, America). Quantitative real-time PCR was performed using Applied Biosystems 1900 system (Thermo Fisher Scientific, Inc). The primers for SCN1A were 5′GCATCCGTGGCTCCCTATTTT3′ and 5′CTCATTGCTCGTTGCCTTTGG3′. GAPDH (5′CCACTCCTCCACCTTTGAC3′ and 5′ACCCTGTTGCTGTAGCCA3′) was used as an internal control for-SCN1A. The 2−ΔΔCq method (20) was used to analyze the relative quantification of miR-155 and SCN1A mRNA. All reactions were performed in triplicate.
The University of California Santa Cruz genome browser (http://genome.ucsc.edu) was used to examine the downstream region of miR-155. The predicted miR-155 binding site in the 3′-untranslated region (UTR) of SCN1A was amplified using PCR (5CGCTCGAGA TGA AAA TAA ATA AAA ATA ATT GG3 and 5ATAAGCTTG CTA AAA TAA AAA ATG TAA T3, underlined are XhoI and HindIII sites respectively, 2103 bp). The reaction condition was 95°C 2 min, followed by 30 cycles of 95°C 30 sec, 53°C 30 sec and 72°C 2 min. 3′UTR mutants were created using a site directed mutagenesis kit (Takara Bio Inc.) (Fig. 1). The PCR products and the site-directed mutagenesis products were inserted into the XhoI/HindIII restriction sites of a pGL3-Basic vector (Promega Corporation, Madison, WI, USA) to create the wild-type or mutant luciferase/reporter constructs. Sequencing was performed to confirm all the constructs. Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) was used to co-transfect the U251 cells with wild-type SCN1A 3′UTR or mutant SCN1A 3′UTR luciferase reporter constructs at a final concentration of 100 nM per well, together with miR-155 mimic or miR-NC with a final concentration of 100 nM. The Dual-Luciferase Reporter Assay System (Promega Corporation) was used to measure the activities of firefly and Renilla luciferase 48 h following transfection. Three independent experiments were performed.
The expression of SCN1A protein was assessed using western blot analysis. PBS was used to wash the U251 cells and tissue samples twice, and U251 cells (5×106 cells) were lysed using radioimmunoprecipitation assay lysis buffer (Sigma-Aldrich; Merck KGaA) containing Halt Protease Inhibitor Cocktail (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Cellular lysates were centrifuged for 15 min at 1,500 × g at 4°C to obtain the supernatants. A DC Protein assay (Bio-Rad Laboratories, Inc., Hercules, CA, USA) was used to determine the concentration of protein. Proteins were heat-denatured in boiling water. Proteins (50 µg/lane) were separated by 10% SDS-PAGE and transferred to an Immobilon-P membrane (EMD Millipore, Billerica, MA, USA) according to the manufacturer's protocol. PBS containing 5% skimmed milk and 0.1% Tween-20 was used to block the membrane to avoid non-specific binding. Membranes were incubated with primary rabbit monoclonal antibodies against SCN1A (cat. no. 14380; 1:5,000) and β-actin (cat. no. 4970; 1:15,000), both from Cell Signaling Technology (Danvers, MA, USA), at 4°C for 12 h. PBS containing 0.1% Tween-20 was subsequently used to wash the membranes three times for 10 min each and the membranes were incubated with the secondary antibody (cat. no. 14708; 1:8,000; Cell Signaling Technology, Danvers, MA, USA) at 37°C for 2 h. The blots were subsequently washed with PBS containing 0.1% Tween-20. Enhanced Chemiluminescence Detection Reagent (GE Healthcare Life Sciences, Little Chalfont, UK) was used to detect the bound antibody in accordance with the manufacturer's protocol.
Data are presented as the mean ± standard deviation. Statistical significance was tested using either one-way analysis of variance followed by a Bonferroni post-hoc test, chi-square statistic or paired Student's t-test (two-tailed). Relationships between two variables from the same test were evaluated by the linear Pearson correlation coefficient (r) and multiple regression analyses. JMP Pro 12 (SAS Institute, Cary, NC, USA) was used to analyze the data. P<0.05 was considered to indicate a significant difference.
There were 11 cases of seizures in the control group, with an incidence of ~28.2% (Table I), including 4 cases of preoperative seizures and 7 cases within 1 month of surgery (6 cases within 2 weeks of surgery; one case 2 weeks post-surgery). There were 3 cases of seizures in the experimental group, with an incidence of ~7.3%, including one case of preoperative seizure and two cases within 1 month of surgery (one case within 2 weeks of surgery, one case 2 weeks post-surgery). The difference in the incidence rates of seizures between the groups was statistically significant (P=0.019; Table I). Following surgery, there were 2 cases of abnormal liver function in the control group, and 3 cases in the experimental group. There was one case of abnormal routine blood analysis (reduced white blood cells) in each of the two groups. There were no significant differences identified for liver function or routine blood analysis between the two groups (Table I).
RT-qPCR was used to investigate differentially expressed miRNAs in subjects of control and VPA-treated patients. A total of 8 miRNAs (miRNA-155, miRNA-633, miRNA-638, miRNA-468, miRNA-685, miRNA-326, miRNA-328 and miRNA-92b) closely associated with seizure were analyzed by RT-qPCR (Fig. 2). miR-155 was the only significantly different miRNA between control and VPA-treated groups and the expression of miR-55 decreased 2.5 fold in the VPA-treated group when compared with it in the control group. The remaining 7 miRNAs demonstrated similar expression levels between the two groups. These results suggested that miR-155 may be a potential biomarker for seizure development.
The expression of miR-155 in patients who experienced seizures was 2.45 folds higher compared with patients who did not experience seizures among all patients (Fig. 2B). Pearson correlation analysis among all patients revealed a positive association between miR-155 expression and seizure occurrence (r=0.503, P=0.018). Furthermore, a multivariate linear model indicated the relationship between miR-155 and seizure was persistent in the control (r=0.490, P=0.029) and experimental groups (r=0.513, P=0.014), indicating that increased miR-155 expression may be associated with seizure occurrence.
Online miRNA target prediction tools were used to search for target genes of miR-155, and SCN1A was identified as a candidate target gene of miR-155, as it contained the appropriate seed sequence in the 3′UTR (Fig. 1). In addition, it was confirmed that the miR-155 mimics or miR-NC were successfully transfected into U251 cells (Fig. 3A). A luciferase reporter assay was used to investigate the regulatory relationship between miR-155 and SCN1A. The luciferase activity of cells transfected with wild-type SCN1A 3′UTR and miR-155 mimics was lower compared with cells transfected with wild-type SCN1A 3′UTR and miR-NC (Fig. 3B). By contrast, the luciferase activity of cells carrying the mutant SCN1A 3′UTR was comparable with the scramble control and the blank control. These data indicated that SCN1A may be a target of miR-155 in U251 cells with the binding sites located on the SCN1A 3′UTR.
The SCN1A mRNA expression level was determined in the two treatment groups using RT-qPCR (Fig. 4A). The expression of SCN1A mRNA in the VPA-treated group was higher (r=0.226; P=0.032) compared with the expression level in the control group. SCN1A exhibits no difference between patients who experienced seizures and patients who did not experience seizures (Fig. 4B).
RT-qPCR and western blot analyses were used to determine the expression of SCN1A mRNA and protein in U251 cells exposed to miR-155 mimics, miR-155 inhibitors or scramble controls. The SCN1A protein (Fig. 5A) and mRNA (Fig. 5B) expression levels were reduced in U251 cells transfected with 50 or 100 nM miR-155 mimics. The results of RT-qPCR showed the same trends. By contrast, cells treated with 50 or 100 nM miR-155 inhibitor exhibited an elevated expression levels of SCN1A protein (Fig. 5C) and mRNA (Fig. 5D) compared with cells treated with the scrambled negative control, and there was no difference between the cells treated with 50 and 100 nM miR-155 inhibitor. These results support a negative regulatory relationship between miR-155 and SCN1A, and suggested a concentration-dependent effect of miR-155 on the expression of SCN1A.
A seizure is an abnormal discharge of neurons in the brain that may follow brain injury that causes transient central nervous system disorders, with sudden and recurrent characteristics that are related to the degree of the brain injury (21). Seizure incidence rate following a severe head injury is 14.8–33.0%; patients who need craniotomy and decompressive craniotomy often have cerebral hernia; therefore, their incidence of seizure will be higher (1,2). Clinically, many nerve trauma doctors may not be able to easily diagnose a patient with epilepsy owing to various patient-centric considerations (including schooling, employment, marriage, driving and applying for loans, amongst others); in these situations they will diagnose the patient as suffering from seizures. Furthermore, whether the prophylactic use of AEDs is necessary following neurosurgical surgery has been controversial (22,23).
In the present study, 14 cases of seizures following cranioplasty were observed across the experimental and control groups, with an incidence of 17.5%. Possible associated clinical factors include: i) The cranial cavity volume changes following cranioplasty, resulting in changes to the brain tissue and cerebrospinal fluid dynamics and breaking the relative equilibrium that has existed for several months prior to surgery; ii) some patients may have presented with collapsed bone window tissues prior to surgery, as subdural stitches are often suspended on titanium during surgery to reduce the epidural space, which may cause the arachnoid fibrous band on the brain surface to move the brain tissue and induce changes to brain tissue function; iii) cranioplasty changes the oppression of atmospheric pressure on the brain tissue, bringing alterations to hemodynamics or the external environment of the brain tissue; iv) when patients underwent isolation of the endocranium, 15 cases had damage to the endocranium, of which 12 cases exhibited arachnoid damage and cerebrospinal fluid outflow, although they received a tight suture of the endocranium, non-visible brain damage cannot be excluded; v) the use of some nerve stimulant drugs following surgery, including xingnaojing and naloxone, may also induce seizures (24,25). The incidence rate of cranioplasty-related seizures is relatively high and should be prevented by the use of AEDs (26). In the present study, only 3/41 cases among the experimental group experienced seizures. One of these cases occurred prior to surgery, and was later indicated to be caused by an insufficient plasma concentration of valproic acid; following an increase in dosage, no more seizures were recorded. In two cases, following surgery, the plasma concentration of valproic acid was within expected levels, but could not control seizures. Therefore, the treatment was changed to oxcarbazepine or levetiracetam tablets for seizure control. In the control group, 11/39 patients experienced seizures; all of these were controlled well with VPA. In the experimental and control groups there were no cases that required surgery as a result of a failure to control the seizures. The difference in the incidence rates of seizures between VPA-treated group (7.3%) and control group (28.2%) was statically significant (P<0.05), indicating that VPA may have a preventive effect for cranioplasty-related seizures.
SCN1A is important for the initiation of action potentials in the central nervous system (27). This subunit contains 4 homologous domains (D1-D4) and each contains six transmembrane segments (S1-S6) (28).
The present study revealed that the expression of miR-155 was lower in VPA-treated patients, compared with patients in the untreated control group. Furthermore, computational analysis revealed that SCN1A was a potential target gene of miR-155, as it contains a potential seed region in the 3′UTR of the gene, and this was experimentally supported through the use of a luciferase assay. Furthermore, the expression of SCN1A mRNA and protein were estimated in different cell culture treatment groups, which demonstrated that SCN1A protein and mRNA expression levels were reduced in U251 cells in a dose-dependent manner, whereas cells exposed to a miR-155 inhibitor exhibited increased expression levels of SCN1A protein and mRNA. miR-155 has been reported to be involved with several diseases, including seizures. Previous study showed that upregulation of miR-155 was closely associated with ischemic stroke, intracerebral hemorrhage, and kainate seizures (29). Moreover, the expressions of miR-155 were significantly upregulated in the seizure-related acute and chronic stages of mesial temporal lobe epilepsy (MTLE) in the immature rat model and also in children with MTLE (30). Antagonist targeting microRNA-155 protects against lithium-pilocarpine-induced Status Epilepticus in C57BL/6 Mice by activating brain-derived neurotrophic factor (31). And a report also showed that VPA downregulated the expression of miR-155 which had potential protection against cerebral ischemia (6), indicating inhibition of miR-155 is a potential target for seizure and VPA can effectively inhibit the epression of miR-155.
In summary, the incidence of cranioplasty-related seizures is high and is associated with patients' morbidity. Preventative use of VPA in the early postsurgical stages may reduce the incidence of seizures.
|
Lee L, Ker J, Quah BL, Chou N, Choy D and Yeo TT: A retrospective analysis and review of an institution's experience with the complications of cranioplasty. Br J Neurosurg. 27:629–635. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Pechmann A, Anastasopoulos C, Korinthenberg R, van Velthoven-Wurster V and Kirschner J: Decompressive craniectomy after severe traumatic brain injury in children: Complications and outcome. Neuropediatrics. 46:5–12. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Ronen GM, Buckley D, Penney S and Streiner DL: Long-term prognosis in children with neonatal seizures: A population-based study. Neurology. 69:1816–1822. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Mizrahi EM: Neonatal seizures: Problems in diagnosis and classification. Epilepsia. 28 Suppl 1:S46–S55. 1987. View Article : Google Scholar : PubMed/NCBI | |
|
Sankar R and Painter MJ: Neonatal seizures: After all these years we still love what doesn't work. Neurology. 64:776–777. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Hunsberger JG, Fessler EB, Wang Z, Elkahloun AG and Chuang DM: Post-insult valproic acid-regulated microRNAs: Potential targets for cerebral ischemia. Am J Transl Res. 4:316–332. 2012.PubMed/NCBI | |
|
Filip A: MiRNA-new mechanisms of gene expression control. Postepy Biochem. 53:413–419. 2007.(In Polish). PubMed/NCBI | |
|
Chen K and Rajewsky N: The evolution of gene regulation by transcription factors and microRNAs. Nat Rev Genet. 8:93–103. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Esquela-Kerscher A and Slack FJ: Oncomirs-microRNAs with a role in cancer. Nat Rev Cancer. 6:259–269. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Guarnieri DJ and DiLeone RJ: MicroRNAs: A new class of gene regulators. Ann Med. 40:197–208. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Gauthier BR and Wollheim CB: MicroRNAs: ‘Ribo-regulators’ of glucose homeostasis. Nat Med. 12:36–38. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Bi Y, Liu G and Yang R: MicroRNAs: Novel regulators during the immune response. J Cell Physiol. 218:467–472. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Hatfield S and Ruohola-Baker H: microRNA and stem cell function. Cell Tissue Res. 331:57–66. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Matsubara H, Takeuchi T, Nishikawa E, Yanagisawa K, Hayashita Y, Ebi H, Yamada H, Suzuki M, Nagino M, Nimura Y, et al: Apoptosis induction by antisense oligonucleotides against miR-17-5p and miR-20a in lung cancers overexpressing miR-17-92. Oncogene. 26:6099–6105. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Beveridge NJ, Tooney PA, Carroll AP, Gardiner E, Bowden N, Scott RJ, Tran N, Dedova I and Cairns MJ: Dysregulation of miRNA 181b in the temporal cortex in schizophrenia. Hum Mol Genet. 17:1156–1168. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Kuhn DE, Nuovo GJ, Martin MM, Malana GE, Pleister AP, Jiang J, Schmittgen TD, Terry AV Jr, Gardiner K, Head E, et al: Human chromosome 21-derived miRNAs are overexpressed in down syndrome brains and hearts. Biochem Biophys Res Commun. 370:473–477. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Nicoloso MS and Calin GA: MicroRNA involvement in brain tumors: From bench to bedside. Brain Pathol. 18:122–129. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Zhou R, Yuan P, Wang Y, Hunsberger JG, Elkahloun A, Wei Y, Damschroder-Williams P, Du J, Chen G and Manji HK: Evidence for selective microRNAs and their effectors as common long-term targets for the actions of mood stabilizers. Neuropsychopharmacology. 34:1395–1405. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Goh WW, Oikawa H, Sng JC, Sergot M and Wong L: The role of miRNAs in complex formation and control. Bioinformatics. 28:453–456. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Wang L, Wu G, Qin X, Ma Q, Zhou Y, Liu S and Tan Y: Expression of Nodal on bronchial epithelial cells influenced by lung microbes through DNA methylation modulates the differentiation of T-Helper cells. Cell Physiol Biochem. 37:2012–2022. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Meyer FB: Calcium, neuronal hyperexcitability and ischemic injury. Brain Res Brain Res Rev. 14:227–243. 1989. View Article : Google Scholar : PubMed/NCBI | |
|
Cranley MR, Craner M and McGilloway E: Antiepileptic prophylaxis following severe traumatic brain injury within a military cohort. J R Army Med Corps. 162:109–114. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Klimek M and Dammers R: Antiepileptic drug therapy in the perioperative course of neurosurgical patients. Curr Opin Anaesthesiol. 23:564–567. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Creutzfeldt CJ, Tirschwell DL, Kim LJ, Schubert GB, Longstreth WT Jr and Becker KJ: Seizures after decompressive hemicraniectomy for ischaemic stroke. J Neurol Neurosurg Psychiatry. 85:721–725. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Krause-Titz UR, Warneke N, Freitag-Wolf S, Barth H and Mehdorn HM: Factors influencing the outcome (GOS) in reconstructive cranioplasty. Neurosurg Rev. 39:133–139. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Hesdorffer DC, Benn EK, Cascino GD and Hauser WA: Is a first acute symptomatic seizure epilepsy? Mortality and risk for recurrent seizure. Epilepsia. 50:1102–1108. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Martina M, Vida I and Jonas P: Distal initiation and active propagation of action potentials in interneuron dendrites. Science. 287:295–300. 2000. View Article : Google Scholar : PubMed/NCBI | |
|
Escayg A, MacDonald BT, Meisler MH, Baulac S, Huberfeld G, An-Gourfinkel I, Brice A, LeGuern E, Moulard B, Chaigne D, et al: Mutations of SCN1A, encoding a neuronal sodium channel, in two families with GEFS+2. Nat Genet. 24:343–345. 2000. View Article : Google Scholar : PubMed/NCBI | |
|
Liu DZ, Tian Y, Ander BP, Xu H, Stamova BS, Zhan X, Turner RJ, Jickling G and Sharp FR: Brain and blood microRNA expression profiling of ischemic stroke, intracerebral hemorrhage, and kainate seizures. J Cereb Blood Flow Metab. 30:92–101. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Ashhab MU, Omran A, Kong H, Gan N, He F, Peng J and Yin F: Expressions of tumor necrosis factor alpha and microRNA-155 in immature rat model of status epilepticus and children with mesial temporal lobe epilepsy. J Mol Neurosci. 51:950–958. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Cai Z, Li S, Li S, Song F, Zhang Z, Qi G, Li T, Qiu J, Wan J, Sui H and Guo H: Antagonist targeting microRNA-155 protects against lithium-pilocarpine-induced status epilepticus in C57BL/6 mice by activating brain-derived neurotrophic factor. Front Pharmacol. 7:1292016. View Article : Google Scholar : PubMed/NCBI |