Open Access

Downregulation of Glt25d1 aggravates carbon tetrachloride‑induced acute hepatic injury through activation of the TGF‑β1/Smad2 signaling pathway

  • Authors:
    • Xiaohui Ye
    • Lingling He
    • Jiali Ma
    • Yufeng Li
    • Manka Zhang
    • Junru Yang
    • Jian Zhang
    • Fan Xiao
    • Hongshan Wei
  • View Affiliations

  • Published online on: August 16, 2018     https://doi.org/10.3892/mmr.2018.9392
  • Pages: 3611-3618
  • Copyright: © Ye et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Collagen β (1‑O) galactosyltransferase 1 (GLT25D1) has been reported to transfer galactose to hydroxylysine residues via β (1‑O) linkages in collagen. The present study investigated the function of the collagen galactosyltransferase activity of GLT25D1 against carbon tetrachloride (CCl4)‑induced acute liver injury in vitro. Glt25d1+/‑ mice and wild‑type (WT) mice were injected intraperitoneally with the same dose of CCl4. The grade of hepatic injury and the extent of hepatocyte necrosis in the acute phase were assessed 48 h following CCl4 injection. Hepatocyte necrosis was evaluated by histological examination and by serum alanine aminotransferase and aspartate aminotransferase levels, which were higher in the Glt25d1+/‑ mice compared with those in the WT mice. Reverse transcription‑quantitative polymerase chain reaction was performed, and the results demonstrated that the mRNA expression levels of inflammatory cytokines, including tumor necrosis factor‑α and interleukin‑6 were significantly increased in the Glt25d1+/‑ mice. Furthermore, western blot analyses were performed, and the results demonstrated that the protein levels of cleaved caspase‑3 and ‑9 were also markedly increased in the Glt25d1+/‑ liver, indicating that hepatocyte apoptosis was induced. Additionally, the expression levels of transforming growth factor (TGF)‑β1 and phosphorylated small mothers against decapentaplegic (Smad)2 were markedly upregulated, indicating activation of the TGF‑β1/Smad2 signaling pathway during CCl4‑induced acute liver injury in Glt25d1+/‑ mice. CCl4 administration also resulted in severe damage to Glt25d1+/‑ primary hepatocytes in vitro. Taken together, the downregulation of Glt25d1 deteriorated CCl4‑induced liver injury in mice, which may involve triggering inflammatory responses, apoptosis and TGF‑β1/Smad2 signaling pathway activation.

Introduction

Liver injury has been recognized as a serious health problem worldwide (1) and can be caused by toxic chemicals, drugs or alcohol abuse, viral infection and other factors (2,3). However, the mechanisms underlying liver injury remain to be fully elucidated (4) and few effective therapies are available for acute liver injury at present. Therefore, it is necessary to elucidate the possible molecular mechanism underlying liver injury for developing effective drugs. The collagen β (1-O) galactosyltransferase 1 (Glt25d1) gene encodes Hyl-specific galactosyltransferase enzymes, which catalyze the transfer of β-linked Gal to Hyl residues on collagen (5,6), which initiates collagen glycosylation during its post-translational modification. Despite the identification of Glt25d1, its functional role in collagen glycosylation remains to be fully elucidated. The biological significance of collagen glycosylation also remains to be elucidated as it has neither been associated with a disease nor has a model organism harboring defective collagen glycosylation been described to date (7,8).

Previous studies have indicated that transgenic mice with mutations that caused cytoskeletal keratin lacking of glycosylation modifications in the extracellular matrix (ECM) are susceptible to liver injury (8,9) and that glycosyltransferase activities in the extracellular space are important for cell growth and viability (10). Accordingly, in the present study, Glt25d1+/− mice, lacking one allele of Glt25d1, were established, and their susceptibility to liver injury induced by carbon tetrachloride (CCl4) was compared with that of wild-type (WT) mice.

Materials and methods

Animals and treatments

To examine the functional roles of Glt25d1 in vivo, a Glt25d1 conventional knockout mouse model was established (Glt25d1flox/flox) with loxP sites flanking exons 2 and 3 of the Glt25d1 gene. The Glt25d1flox/flox mice were crossed with CMV-Cre transgenic mice, both of which were purchased from the Model Animal Research Center Of Nanjing University (Nanjing, China), to facilitate the deletion of exons 2 and 3 of Glt25d1 and generate heterozygous Glt25d1 mice (Glt25d1+/−). This targeted disruption results in a frame shift mutation, which leads to the early termination of GLT25D1 protein translation. However, no homozygous Glt25d1−/− mice were recovered from the intercrossed Glt25d1+/− mice, which suggested that a lack of functional Glt25d1 alleles resulted in embryonic lethality.

A total of 14 female Glt25d1+/− mice, 7–8 weeks of age and 18–20 g in weight, were fed in a specific pathogen-free laboratory environment, with free access to standard pellet chow and sterile water. Mice were housed at the Department of Laboratory Animal Science, Peking University Health Science Center (Beijing, China), and maintained under a 12/12 h light/dark cycle, an ambient temperature of 21±2°C and a constant humility of 50±10%. C57BL/6J WT mice of the same age, gender and weight served as controls. The mice were divided into four groups (n=6–8/group). Acute liver injury model groups (Glt25d1+/− and WT) were injected intraperitoneally with a single dose of CCl4 [10 ml/kg body weight dissolved in corn oil (1:6)] as reported previously (11). The WT control and Glt25d1+/− control mice were administered the same dose of corn oil without CCl4. Subsequently, all mice were sacrificed 48 h following CCl4 injection. Blood and liver samples were collected for further analyses. All experimental procedures were performed according to the Animal Care Committee guidelines and the experimental protocol was approved by the Ethics Committee of Peking University Health Science Center.

Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) assessment

Serum samples were separated from the blood by centrifugation at 3,000 × g for 10 min at 4°C. Serum AST and ALT levels were determined using a biochemical kit (Sichuan Maccura Biotechnology, Sichuan, China).

Hematoxylin/eosin (HE) staining

The liver tissues were excised, fixed in 10% formalin, paraffin-embedded, cut into 4-µm sections, and stained with HE according to a standard protocol. All the images were acquired and analyzed using an Axio Observer A1 Fluorescence Microscope (ZeissAG, Oberkochen, Germany). Six randomly selected fields (magnification, ×100) were assessed for necrosis according to standard morphological criteria, including loss of architecture and morphological changes in the cells, and the necrotic area percentage was determined as reported previously (12).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis

Total RNA was extracted from the liver tissue using the TRIzol reagent protocol (Takara Biotechnology Co., Ltd., Dalian, China). The concentration and quantity of isolated total RNA was determined using NanoDrop One Microvolume UV-Vis Spectrophotometer (Thermo Fisher Scientific, Inc., Waltham, MA, USA). Reverse transcription was performed using a PrimeScript RT Reagent kit (Takara Biotechnology Co., Ltd.) under the following conditions: 37°C for 15 min, 85°C for 5 sec and then maintained at 4°C. RT-qPCR was performed in a 20 µl reaction volume [diluted cDNA (2 µl), primers (0.4 µl per primer), SYBR Premix EX Taq (10 µl; Promega Corporation, Madison, WI, USA) and nuclease-free water (7.2 µl)]. qPCR was performed using a Tetrad2 Peltier Thermal Cycler (Bio-Rad Laboratories, Inc., Hercules, CA, USA) and the reaction was run on an Applied Biosystems 7500 Real-Time PCR system under the following conditions: i) holding stage: 95°C for 2 min; ii) cycling stage: 95°C for 15 sec, 60°C for 1 min, (40 cycles); iii) melt curve stage: 95°C for 15 sec, 60°C for 1 min, 95°C for 30 sec, 60°C for 15 sec. Gapdh was amplified as a reference gene and differences between the relative expression of the target genes were calculated using the 2−ΔΔCq method (13). The sequences of the primers used for PCR are shown in Table I.

Table I.

Primer sequences for reverse transcription-quantitative polymerase chain reaction analysis.

Table I.

Primer sequences for reverse transcription-quantitative polymerase chain reaction analysis.

Gene (ID)Primer sequence (5′-3′)
TnfForward: TGGGCCTCTCATGCACCACC
Reverse: GAGGCAACCTGACCACTCTCCCT
Il-6Forward: AGACAAAGCCAGAGTCCTTCAG
Forward: GCCACCTTTTGACAGTGATGAG
Il-1βForward: GCCACCTTTTGACAGTGATGAG
Reverse: GACAGCCCAGGTCAAAGGT
GapdhForward: CAATGACCCCTTCATTGAC
Reverse: GATCTCGCTCCTGGAAGATG

[i] Tnf-α, tumor necrosis factor-α; Il-6, interleukin-6; Il-1β, interleukin-1β.

Western blot analysis

Total proteins were extracted from the liver using T-PER™ Tissue Protein Extraction reagent (Thermo Fisher Scientific, Inc., Waltham, MA, USA; cat. no. 78510) and the protein concentration in samples was measured using the Pierce™ BCA Protein Assay kit (Thermo Fisher Scientific, Inc.; cat. no. 23227). An equivalent quantity of protein (80 µg) was loaded onto SDS-polyacrylamide gels (10%), electrophoresed and then transferred onto Immobilon® PVDF membranes (Sigma; EMD Millipore, Billerica, MA, USA; cat. no. P3313). Following this, the membranes were blocked for 2 h at room temperature using Tris-buffered saline containing 0.1% Tween 20 and 5% skimmed milk at room temperature. The following primary antibodies were used: Monoclonal rabbit anti-mouse GAPDH (Cell Signaling Technology, Inc., Danvers, MA, USA; cat. no. 5174, 1:1,000), polyclonal rabbit anti-mouse caspase-3 (Cell Signaling Technology, Inc.; cat. no. 9662, 1:1,000), polyclonal rabbit anti-mouse Glt25d1 (ProteinTech Group, Inc., Chicago, IL, USA; cat. no. 16768-1-AP, 1:1,000), monoclonal rabbit anti-mouse caspase9 (Abcam, Cambridge, UK; cat. no. ab202068, 1:500), polyclonal rabbit anti-mouse TGF-β1 (ProteinTech Group, Inc.; cat. no. 21898-1-AP, 1:1,000), monoclonal rabbit anti-mouse phosphorylated (p)-Smad2/3 (Cell Signaling Technology, Inc.; cat. no. 8828, 1:1,000) and polyclonal rabbit anti-mouse Smad2 (ProteinTech Group, Inc.; cat. no. 12570-1-AP, 1:1,000) at 4°C overnight. This was followed by incubation with the goat anti-mouse (Abcam; cat. no. ab6789, 1:5,000) and anti-rabbit secondary antibodies (Abcam; cat. no. ab191866, 1:5,000) for 2 h at room temperature. The sample bands were revealed using the Tanon Imaging system (Tanon Science and Technology Co., Ltd., Shanghai, China).

Isolation and culture of mouse primary hepatocytes

Mouse primary hepatocytes were isolated from the female WT or Glt25d1+/− mice using a two-step collagenase perfusion procedure as described previously (14). The hepatocytes were purified further using 60% percoll (1.076 g/ml) (15,16). The mean viability and purity of mouse primary hepatocytes following isolation were identified by trypan blue exclusion and periodic acid Schiff (PAS) staining, respectively. All the images were acquired and analyzed using an Axio Observer A1 Fluorescence Microscope (Zeiss AG). Low activity or dead hepatocytes were stained blue by trypan blue staining. Six fields (original magnification, ×100) were selected randomly and the ratio of hepatocellular viability was calculated according to the following formula: Cell viability=1-(number of blue cells/total number of cells) ×100%. The hepatocytes were subjected to PAS staining, which specifically stains the hepatocyte cytoplasm red, in order to assess their purity. Six fields (original magnification, ×100) were selected randomly and the ratio of hepatocellular purity was calculated according to the following formula: Hepatocellular purity=(number of red cells/total number of cells) ×100%.

Induction of hepatocyte death/apoptosis

The cells were plated in 96-well plates at a density of 30,000 cells/well and cultured in high-glucose Dulbecco's Modified Eagle Medium (cat. no. 10569010; Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (cat. no. 10100l47; Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin-streptomycin (cat. no. 1037806; Gibco; Thermo Fisher Scientific, Inc.) under a humidified atmosphere of 5% CO2 at 37°C for 24 h. Following this, the cells were used for the experiments and divided into the following groups: Groups 1 and 2 (normal control): Culture media were removed and cells were treated with 100 µl of serum-free medium for 2 h. A further 100 µl of serum-free medium was then added for the following 24 h; groups 3 and 4 (CCl4 treatment): Culture media were removed, and the cells were treated with 100 µl of serum-free medium for 2 h. A further 100 µl of serum-free medium containing CCl4 at the selected concentration (1% v/v) (17) was added for the following 24 h. CCl4 cytotoxicity was determined using a CCK-8 assay kit. The cells were treated with CCK-8 reagent (10 µl/well) and incubated for a further 3–4 h. The optical density (OD) was recorded at 450 nm in a microplate reader (Thermo Fisher Scientific, Inc.). The ratio of cell survival (%) was determined using the following equation: Cell survival (%)=[OD(s)-OD(b)/OD(c)-OD(b)] ×100%. OD(s), OD(b) and OD(c) represent the absorbance values of the sample, blank and negative control, respectively.

Statistical analysis

Quantitative data are expressed as the mean ± standard deviation, and statistical evaluation was performed using SPSS 18.0 statistical software (SPSS, Inc., Chicago, IL, USA). Significance was determined by Student's t-test or two-way analysis of variance followed by Tukey's test. P<0.05 was considered to indicate a statistically significant difference.

Results

Downregulation of Glt25d1 aggravates CCl4-induced hepatic injury

As shown in Fig. 1A-D, the HE staining showed severe hepatocyte degeneration and necrosis at the centrilobular zones at 48 h post-CCl4 administration. The Glt25d1+/− mice exhibited larger annular necrotic lesion areas around the hepatic lobule portal area compared with the WT mice (0.48±0.10, vs. 0.22±0.06, P<0.01) as shown in Fig. 1E (arrows indicate lesions) and exhibited bridging necrosis. The above results were supported by a higher increase of serum ALT and AST levels in the Glt25d1+/− mice compared with the WT mice (P<0.001; Fig. 1F and G). For further confirmation of these results, the mRNA expression of inflammatory cytokines was examined. CCl4 treatment caused elevated expression of Tnf-α, Il-6 and Il-1β in the livers of the WT mice, and the expression levels of Tnf-α and Il-6 were increased further in the Glt25d1+/− mice (all P<0.05; Fig. 2A-C).

Glt25d1 deficiency increases CCl4-induced hepatocellular apoptosis

The levels of the cleaved forms of caspase-3 and −9 in the Glt25d1+/− liver were significantly higher compared with those in the WT liver (P<0.001 and P<0.01, respectively; Fig. 3A-C).

Activation of the TGF-β1/Smad2 signaling pathway in Glt25d1+/− mice

Compared with the control mice, the model mice exhibited elevated levels of TGF-β1 and p-Smad2/Smad2. The upregulation of the TGF-β1/Smad2 signaling pathway in the Glt25d1+/− liver was more marked compared with that in the WT liver (P<0.001, Fig. 3A, D and E). CCl4 treatment increased the protein level of Glt25d1 in the WT and Glt25d1+/− mice (P<0.05; Fig. 3A and F).

Downregulation of Glt25d1 enhances CCl4-induced cytotoxicity in mouse primary hepatocytes in vitro

The morphology of mouse primary hepatocytes following initial plating and incubation for 4 h is shown respectively in Fig. 4A and B. Low activity or dead hepatocytes were positively stained by trypan blue (Fig. 4C). Six randomly selected fields (magnification, ×100) were subsequently investigated, and the mean viability of primary hepatocytes was revealed to be >94.0% (data not shown). As presented in Fig. 4D, the purity of cultured hepatocytes was investigated by PAS staining, which specifically stains the hepatocyte cytoplasm red. Following this, six randomly selected fields (magnification, ×100) were investigated, and the mean purity of primary hepatocytes was revealed to be 96.25±1.20% (data not shown).

The Glt25d1+/− primary hepatocytes exhibited decreased viability upon treatment with 1% CCl4. Compared with the WT cells, the Glt25d1+/− primary hepatocytes were more sensitive to CCl4-induced toxicity and showed greater loss of viability (P<0.05; Fig. 4E).

Discussion

The present study demonstrated that Glt25d1+/− mice, which exhibited downregulated Glt25d1 synthesis, developed aggravated CCl4-induced liver injury compared with WT mice in vivo. It also provided evidence suggesting that Glt25d1 deficiency may aggravate CCl4-induced liver injury via TGF-β1/Smad2 signal pathway activation.

The ECM is known to have multiple biological functions, including cell self-renewal, adhesion, differentiation, proliferation and survival (18,19). Despite the well-regulated homeostasis of ECM components, particularly the level of collagen, which is important in tissue repair and remodeling (20,21), few studies have investigated the role of collagen glycosylation in the pathogenesis or resolution of acute liver injury. In 2009, Schegg et al (5) confirmed that collagen glycosylation during post-translational modification was catalyzed by Glt25d1 and Glt25d2 in vitro. Subsequent investigations have demonstrated that Glt25d1 is required for the secretion of high molecular weight adiponectin (6) and that Glt25d1 deletion induces collagen accumulation in osteosarcoma cells in vitro (7). The present study is the first, to the best of our knowledge, to examine the effect of Glt25d1 on acute liver injury in vivo.

The present study utilized CCl4, a chemical hepatotoxin, to generate a classical animal model of acute hepatic injury (22,23) in Glt25d1+/− and WT mice. The results demonstrated that the Glt25d1+/− mice developed aggravated CCl4-induced liver injury compared with the WT mice. HE staining of the Glt25d1+/− liver tissues showed severe hepatocyte degeneration and necrosis (Fig. 1D), which was supported by a higher increase in the levels of serum ALT and AST (Fig. 1E and G). These data also provided evidence that Glt25d1 had beneficial effects in reducing hepatic necrosis. Apoptosis or programmed cell death, particularly hepatocyte apoptosis, is a common feature of various liver diseases (24). Previous studies have reported severe hepatocyte apoptosis in CCl4-induced acute liver injury (25,26). In order to evaluate the extent of liver tissue apoptosis in the present study, western blot analysis for cleaved caspase-3, cleaved caspase-9, and pro-caspase-9 was performed, which revealed that the apoptosis was more severe in the livers of the Glt25d1+/− than in the livers of the WT mice (Fig. 3A). It is well known that hepatocyte necrosis can recruit numerous inflammatory cells, which secrete cytokines, including TNF-α, IL-6 and IL-1β, and trigger an inflammatory response (27,28). In addition, evidence suggests that apoptosis is a pro-inflammatory and fibrogenic stimulus (29). Consistent with the above results, the mRNA levels of Tnf-α and Il-6 were markedly increased in the livers of Glt25d1+/− mice in the present study (Fig. 2B and C), which indicated that normal collagen glycosylation may alleviate CCl4-induced liver dysfunction. Hyaluronan (HA), a ubiquitous glycosaminoglycan, is another common component of the ECM (30). Consistent with the results of the present study, HA-knockout mice exhibited increased hepatic injury in CCl4-induced acute liver injury (31). These results demonstrated that integrity and repair of the ECM is important in ameliorating liver injury.

Under the same CCl4 treatment, Glt25d1+/− primary hepatocytes showed increased loss of viability in vitro (Fig. 4D), which was consistent with the results of Baumann and Hennet, who suggested that the complete loss of collagen glycosylation catalyzed by GLT25D1 and GLT25D2 impairs osteosarcoma cell proliferation and viability (7). This suggests that GLT25D1 deficiency may directly influence CCl4-induced cytotoxicity in primary hepatocytes.

A number of studies have shown that the TGF-β1 signaling pathway is involved in the development of various diseases (3234) and that activation of the TGF-β1/Smad signaling pathway may aggravate the severity of CCl4-induced liver injury (35). To determine whether the glycosylation effect of GLT25D1 alleviates acute liver injury through TGF-β1 signaling pathways, the present study evaluated the protein levels of p-Smad2, Smad2 and GLT25D1 in the liver tissues. The results indicated that, upon CCl4 administration, the protein expression levels of GLT25D1 and p-Smad2, and the ratio of p-Smad2/Smad2 were upregulated, compared with the control mice. In addition, activation of the TGF-β1/Smad2 signaling pathway was more marked in the Glt25d1+/−mice. These data demonstrated that GLT25D1 deficiency may aggravate CCl4-induced liver injury through TGF-β1/Smad2 signaling pathway activation.

There were several limitations of the present study. Firstly, due to the embryonic lethality induced by conventional knockout, it was not possible to obtain Glt25d1−/− homozygous mice. In follow-up investigations on embryonic lethality, the Glt25d1−/− mouse embryos exhibited severe developmental arrest and usually died prior to embryonic day 13.5. To better understand the function of Glt25d1, the generation of liver-specific Glt25d1 mutant mice is underway.

Secondly, in order to evaluate CCl4-induced hepatotoxicity in the WT and Glt25d1+/− primary hepatocytes in vitro, ALT, AST and lactate dehydrogenase require identification in the culture supernatants. These associated experiments are also underway.

In conclusion, using Glt25d1+/− mice, the present study demonstrated that Glt25d1 deficiency aggravated CCl4-induced acute liver injury through activation of the TGF-β1/Smad2 signaling pathway. Although further investigation is required to elucidate the detailed mechanisms responsible for these observations, the role of Glt25d1 requires consideration for examining novel therapeutic strategies against acute liver injury.

Acknowledgements

The authors would like to thank Spandidos Publications for their English language editing.

Funding

This study was supported by grants from the National Natural Science Foundation of China (grant nos. 81271901 and 30671875), the Beijing Natural Science Foundation (grant no. 7152073) and the Science Foundation of Capital Medicine Development (grant no. 2014-2-2171) to Professor Hongshan Wei.

Availability of data and materials

Not applicable.

Authors' contribution

XY and LH performed the experiments and wrote the manuscript. JM, YL and MZ performed the experiments. JY and JZ helped to raise animals and established the animal model of acute liver injury. FX analyzed the data. HW designed the study and critically revised the manuscript for important intellectual content.

Ethics approval and consent to participate

All experimental procedures were performed according to the Animal Care Committee guidelines and the experimental protocol was approved by the Ethics Committee of Peking University Health Science Center.

Patient consent for publication

Not applicable.

Competing interests

The authors confirm that they have no competing interests.

References

1 

Wang FS, Fan JG, Zhang Z, Gao B and Wang HY: The global burden of liver disease: The major impact of China. Hepatology. 60:2099–2108. 2014. View Article : Google Scholar : PubMed/NCBI

2 

Chen Q, Zhan Q, Li Y, Sun S, Zhao L, Zhang H and Zhang G: Schisandra lignan extract protects against carbon tetrachloride-induced liver injury in mice by inhibiting oxidative stress and regulating the nf-kb and Jnk signaling pathways. Evid Based Complement Alternat Med. 2017:51402972017. View Article : Google Scholar : PubMed/NCBI

3 

Shi H, Han W, Ren F, Chen D, Chen Y and Duan Z: Augmenter of liver regeneration protects against carbon tetrachloride-induced liver injury by promoting autophagy in mice. Oncotarget. 8:12637–12648. 2017.PubMed/NCBI

4 

Ren F, Zhang L, Zhang X, Shi H, Wen T, Bai L, Zheng S, Chen Y, Chen D, Li L and Duan Z: Inhibition of glycogen synthase kinase 3β promotes autophagy to protect mice from acute liver failure mediated by peroxisome proliferator-activated receptor α. Cell Death Dis. 7:e21512016. View Article : Google Scholar : PubMed/NCBI

5 

Schegg B, Hulsmeier AJ, Rutschmann C, Maag C and Hennet T: Core glycosylation of collagen is initiated by two beta(1-O) galactosyltransferases. Mol Cell Biol. 29:943–952. 2009. View Article : Google Scholar : PubMed/NCBI

6 

Webster JA, Yang Z, Kim YH, Loo D, Mosa RM, Li H and Chen C: Collagen beta (1-O) galactosyltransferase 1 (GLT25D1) is required for the secretion of high molecular weight adiponectin and affects lipid accumulation. Biosci Rep. 37(pii): BSR201701052017. View Article : Google Scholar : PubMed/NCBI

7 

Baumann S and Hennet T: Collagen accumulation in osteosarcoma cells lacking GLT25D1 collagen galactosyltransferase. J Biol Chem. 291:18514–18524. 2016. View Article : Google Scholar : PubMed/NCBI

8 

Ku NO, Strnad P, Zhong BH, Tao GZ and Omary MB: Keratins let liver live: Mutations predispose to liver disease and crosslinking generates Mallory-Denk bodies. Hepatology. 46:1639–1649. 2007. View Article : Google Scholar : PubMed/NCBI

9 

Ku NO, Toivola DM, Strnad P and Omary MB: Cytoskeletal keratin glycosylation protects epithelial tissue from injury. Nat Cell Biol. 12:876–885. 2010. View Article : Google Scholar : PubMed/NCBI

10 

Wang C, Kovanen V, Raudasoja P, Eskelinen S, Pospiech H and Myllyla R: The glycosyltransferase activities of lysyl hydroxylase 3 (LH3) in the extracellular space are important for cell growth and viability. J Cell Mol Med. 13:508–521. 2009. View Article : Google Scholar : PubMed/NCBI

11 

Louis H, Van Laethem JL, Wu W, Quertinmont E, Degraef C, Van den Berg K, Demols A, Goldman M, Le Moine O, Geerts A and Devière J: Interleukin-10 controls neutrophilic infiltration, hepatocyte proliferation, and liver fibrosis induced by carbon tetrachloride in mice. Hepatology. 28:1607–1615. 1998. View Article : Google Scholar : PubMed/NCBI

12 

Li R, Wang Y, Zhao E, Wu K, Li W, Shi L, Wang D, Xie G, Yin Y, Deng M, et al: Maresin 1, a proresolving lipid mediator, mitigates carbon tetrachloride-induced liver injury in mice. Oxid Med Cell Longev. 2016:92037162016.PubMed/NCBI

13 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

14 

Nitta T, Kim JS, Mohuczy D and Behrns KE: Murine cirrhosis induces hepatocyte epithelial mesenchymal transition and alterations in survival signaling pathways. Hepatology. 48:909–919. 2008. View Article : Google Scholar : PubMed/NCBI

15 

Li P, Liu S, Lu M, Bandyopadhyay G, Oh D, Imamura T, Johnson AM, Sears D, Shen Z, Cui B, et al: Hematopoietic-derived galectin-3 causes cellular and systemic insulin resistance. Cell. 167:973–984 e912. 2016. View Article : Google Scholar : PubMed/NCBI

16 

Goncalves LA, Vigario AM and Penha-Goncalves C: Improved isolation of murine hepatocytes for in vitro malaria liver stage studies. Malar J. 6:1692007. View Article : Google Scholar : PubMed/NCBI

17 

Tong J, Yao X, Zeng H, Zhou G, Chen Y, Ma B and Wang Y: Hepatoprotective activity of flavonoids from Cichorium glandulosum seeds in vitro and in vivo carbon tetrachloride-induced hepatotoxicity. J Ethnopharmacol. 174:355–363. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Lucendo-Villarin B, Khan F, Pernagallo S, Bradley M, Iredale JP and Hay DC: Maintaining hepatic stem cell gene expression on biological and synthetic substrata. BioRes Open Access. 1:50–53. 2012. View Article : Google Scholar : PubMed/NCBI

19 

Arriazu E, Ruiz de Galarreta M, Cubero FJ, Varela-Rey M, Perez de Obanos MP, Leung TM, Lopategi A, Benedicto A, Abraham-Enachescu I and Nieto N: Extracellular matrix and liver disease. Antioxid Redox Signal. 21:1078–1097. 2014. View Article : Google Scholar : PubMed/NCBI

20 

Duarte S, Baber J, Fujii T and Coito AJ: Matrix metalloproteinases in liver injury, repair and fibrosis. Matrix Biol 44–46. 1–156. 2015.

21 

Fausto N, Campbell JS and Riehle KJ: Liver regeneration. J Hepatol. 57:692–694. 2012. View Article : Google Scholar : PubMed/NCBI

22 

Mizuoka H, Shikata N, Yang J, Takasu M, Inoue K and Tsubura A: Biphasic effect of colchicine on acute liver injury induced by carbon tetrachloride or by dimethylnitrosamine in mice. J Hepatol. 31:825–833. 1999. View Article : Google Scholar : PubMed/NCBI

23 

Pritchard DJ, Wright MG, Sulsh S and Butler WH: The assessment of chemically induced liver injury in rats. J Appl Toxicol. 7:229–236. 1987. View Article : Google Scholar : PubMed/NCBI

24 

Guicciardi ME and Gores GJ: Apoptosis: A mechanism of acute and chronic liver injury. Gut. 54:1024–1033. 2005. View Article : Google Scholar : PubMed/NCBI

25 

Yang BY, Zhang XY, Guan SW and Hua ZC: Protective effect of procyanidin B2 against CCl4-induced acute liver injury in mice. Molecules. 20:12250–12265. 2015. View Article : Google Scholar : PubMed/NCBI

26 

Karakus E, Karadeniz A, Simsek N, Can I, Kara A, Yildirim S, Kalkan Y and Kisa F: Protective effect of Panax ginseng against serum biochemical changes and apoptosis in liver of rats treated with carbon tetrachloride (CCl4). J Hazard Mater. 195:208–213. 2011. View Article : Google Scholar : PubMed/NCBI

27 

Zhang F, Wang X, Qiu X, Wang J, Fang H, Wang Z, Sun Y and Xia Z: The protective effect of Esculentoside A on experimental acute liver injury in mice. PLoS One. 9:e1131072014. View Article : Google Scholar : PubMed/NCBI

28 

Zeng B, Su M, Chen Q, Chang Q, Wang W and Li H: Protective effect of a polysaccharide from anoectochilus roxburghii against carbon tetrachloride-induced acute liver injury in mice. J Ethnopharmacol. 200:124–135. 2017. View Article : Google Scholar : PubMed/NCBI

29 

Guo J and Friedman SL: Hepatic fibrogenesis. Semin Liver Dis. 27:413–426. 2007. View Article : Google Scholar : PubMed/NCBI

30 

Chanmee T, Ontong P and Itano N: Hyaluronan: A modulator of the tumor microenvironment. Cancer Lett. 375:20–30. 2016. View Article : Google Scholar : PubMed/NCBI

31 

McCracken JM, Jiang L, Deshpande KT, O'Neil MF and Pritchard MT: Differential effects of hyaluronan synthase 3 deficiency after acute vs chronic liver injury in mice. Fibrogenesis Tissue Repair. 9:42016. View Article : Google Scholar : PubMed/NCBI

32 

Shirasaki T, Honda M, Shimakami T, Murai K, Shiomoto T, Okada H, Takabatake R, Tokumaru A, Sakai Y, Yamashita T, et al: Impaired interferon signaling in chronic hepatitis C patients with advanced fibrosis via the transforming growth factor beta signaling pathway. Hepatology. 60:1519–1530. 2014. View Article : Google Scholar : PubMed/NCBI

33 

Dooley S and ten Dijke P: TGF-β in progression of liver disease. Cell Tissue Res. 347:245–256. 2012. View Article : Google Scholar : PubMed/NCBI

34 

Macias-Silva M, Abdollah S, Hoodless PA, Pirone R, Attisano L and Wrana JL: MADR2 is a substrate of the TGFbeta receptor and its phosphorylation is required for nuclear accumulation and signaling. Cell. 87:1215–1224. 1996. View Article : Google Scholar : PubMed/NCBI

35 

Niu L, Cui X, Qi Y, Xie D, Wu Q, Chen X, Ge J and Liu Z: Involvement of TGF-β1/smad3 signaling in carbon tetrachloride-induced acute liver injury in mice. PLoS One. 11:e01560902016. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

October-2018
Volume 18 Issue 4

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Ye X, He L, Ma J, Li Y, Zhang M, Yang J, Zhang J, Xiao F and Wei H: Downregulation of Glt25d1 aggravates carbon tetrachloride‑induced acute hepatic injury through activation of the TGF‑β1/Smad2 signaling pathway. Mol Med Rep 18: 3611-3618, 2018
APA
Ye, X., He, L., Ma, J., Li, Y., Zhang, M., Yang, J. ... Wei, H. (2018). Downregulation of Glt25d1 aggravates carbon tetrachloride‑induced acute hepatic injury through activation of the TGF‑β1/Smad2 signaling pathway. Molecular Medicine Reports, 18, 3611-3618. https://doi.org/10.3892/mmr.2018.9392
MLA
Ye, X., He, L., Ma, J., Li, Y., Zhang, M., Yang, J., Zhang, J., Xiao, F., Wei, H."Downregulation of Glt25d1 aggravates carbon tetrachloride‑induced acute hepatic injury through activation of the TGF‑β1/Smad2 signaling pathway". Molecular Medicine Reports 18.4 (2018): 3611-3618.
Chicago
Ye, X., He, L., Ma, J., Li, Y., Zhang, M., Yang, J., Zhang, J., Xiao, F., Wei, H."Downregulation of Glt25d1 aggravates carbon tetrachloride‑induced acute hepatic injury through activation of the TGF‑β1/Smad2 signaling pathway". Molecular Medicine Reports 18, no. 4 (2018): 3611-3618. https://doi.org/10.3892/mmr.2018.9392