Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
December-2018 Volume 18 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2018 Volume 18 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Identification of the inhibitory activity of walnut extract on the E3 ligase Syvn1

  • Authors:
    • Hidetoshi Fujita
    • Satoko Aratani
    • Naoko Yagishita
    • Kusuki Nishioka
    • Toshihiro Nakajima
  • View Affiliations / Copyright

    Affiliations: Institute of Medical Science, Tokyo Medical University, Tokyo 160‑8402, Japan, Institute of Medical Science, St. Marianna University School of Medicine, Kawasaki, Kanagawa 216‑8511, Japan
  • Pages: 5701-5708
    |
    Published online on: October 23, 2018
       https://doi.org/10.3892/mmr.2018.9576
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Synoviolin (Syvn1), an E3 ubiquitin ligase in endoplasmic reticulum‑associated protein degradation, is involved in rheumatoid arthritis, fibrosis, liver cirrhosis and obesity. We previously demonstrated that Syvn1 negatively regulates the function of peroxisome proliferator‑activated receptor gamma coactivator‑1β (PGC‑1β). In addition, treatment with a Syvn1 inhibitor suppressed weight gain in a mouse model of obesity by activating PGC‑1β via Syvn1 inhibition. It has been suggested that the Syvn1 inhibitors may have therapeutic benefits in obese patients. The present study tested the inhibitory activity of walnut extract, a natural product, on Syvn1 activity. Walnut extract inhibited the effect of Syvn1 on the cell proliferation of rheumatoid synovial cells and repressed the interaction between PGC‑1β and Syvn1 in an in vitro binding assay. Polyubiquitination of PGC‑1β by Syvn1 was suppressed by walnut extract in a concentration‑dependent manner, but walnut extract did not have an inhibitory effect on the autoubiquitination of Syvn1. Treatment with walnut extract in mouse embryonic fibroblasts increased the number of mitochondria, suggesting that exposure to the extract recovered PGC‑1β function. These results demonstrated that constituents of walnut extract may serve as lead compounds in drug development efforts aiming to produce drugs to treat patients with obesity and obesity‑associated metabolic diseases.

Introduction

Obesity is a global health problem associated with various metabolic disorders, including diabetes, hypertension, cardiovascular disease, and depression (1). There are two major types of medication used to treat obese patients (2). Some anti-obesity drugs, such as appetite suppressants, reduce food intake by regulating the function of the central nervous system, whereas other drugs block absorption of lipids from food in the intestine. In addition, some candidate anti-obesity drugs directly modulate energy metabolism without affecting the central nervous system, such as peroxisome proliferator-activated receptor (PPAR) agonists. However, the undesirable side effects of currently available agonists significantly limit their use.

Natural products have been used for millennia to treat diseases and mitigate the adverse effects of toxic substances (3). Recently, berberine and curcumin, which have antioxidant and anti-inflammatory properties, have been reported to have anti-obesity effects (4–6). Berberine and curcumin ameliorate obesity by increasing energy expenditure. Berberine activates AMP-activated protein kinase (AMPK) (4), a key energy sensor that leads to reduced energy storage and increased energy production. In addition, berberine regulates expression of uncoupling protein 1 (UCP1), which is found in the mitochondria and generates heat in brown adipose tissue (BAT) and white adipose tissue (WAT) in an AMPK- and PPAR gamma coactivator-1 alpha (PGC-1α)-dependent manner (6). These studies suggest that therapeutic chemicals are involved in natural products with antioxidant and anti-inflammatory properties.

Synoviolin (Syvn1), a mammalian homolog of Hrd1p/Der3p, is involved in the development of obesity, rheumatoid arthritis, fibrosis, limb girdle muscular dystrophy, and liver cirrhosis (7–11). Syvn1 was identified in rheumatoid synovial cells (RSCs) as an endoplasmic reticulum (ER)-resident E3 ubiquitin ligase (7) that plays an important role in RSC proliferation (12). LS-102, a Syvn1 inhibitor, repressed proliferation of RSCs in a Syvn1-dependent manner (13). We recently demonstrated that global elimination of Syvn1 in post-neonatal mice was associated with weight loss and reduced white adipose tissue (14). Adipose tissue from Syvn1 knockout mice showed significant up-regulation of PGC-1β-target genes, as well as a significant increase in the number of mitochondria, mitochondrial respiration, and basal energy expenditure. Syvn1 interacts with PGC-1β and negatively regulates its function. Therefore, we propose that knockout or inhibition of Syvn1 leads to stabilization of PGC-1β, enhancing energy expenditure. These results suggest that Syvn1 is a therapeutic target for anti-obesity drugs. However, natural products that inhibit Syvn1 activity have not been found.

To identify Syvn1 inhibitors with antioxidant and anti-inflammatory properties in this study, we performed a screening of natural products based on their inhibitory effects on RSC proliferation. We found that walnut extract inhibited Syvn1 activity, indicating that walnut extract could be used to treat patients with obesity.

Materials and methods

Ethical considerations

All human experimental protocols in the present study (no. 2728, 2729, 3758, 3759) were approved by the Ethics Review Committee of Tokyo Medical University (Tokyo, Japan). RA patients received stable doses of methotrexate (6–10 mg/week) before joint replacement surgery. Written informed consent was obtained from all patients prior to the collection of joint tissue samples. All procedures involving animals were performed in accordance with institutional and national guidelines for animal experimentation, and were approved by the Institutional Animal Care and Use Committee of Tokyo Medical University (no. S-28038, S-28040).

Mice

Mice were kept in SPF under conditions (20–26°C temperature; 40–65% humidity) on a 12 h light/12 h dark cycle. F-1 Foods (5.1% fat, 21.3% protein) were purchased from Funabashi farm (Chiba, Japan). Mice had free access to water bottles. Tamoxifen (Tam)-inducible Syvn1 knockout mice (CAG-Cre-ER; Syvn1flox/flox) was generated previously (14). To isolate MEFs, embryos were isolated at E13.5, and the head and internal (including reproductive) organs were removed. The remaining tissue was physically dissociated and incubated in trypsin at 37°C for 15 min. Cells were resuspended in DMEM and plate the cells in 10 cm tissue culture dishes. On the next day, medium was changed and cells were expanded for two passages before freezing.

Plasmids, antibodies, and walnut extract

The Syvn1 (NM_032431) and PGC-1β (NM_133249) plasmids are described in the literature (7,14,15). The following antibodies were used: Anti-HA (3F10) (Roche Molecular Biochemicals, Indianapolis, IN, USA). Polyclonal antiserum against GST was generated by immunizing rats with purified GST. Anti-PGC-1β antibody has been described previously (14). Walnut extracts were prepared from the branches of walnut trees by the standard ethanol extraction method (16). Briefly, the air-dried walnut branches were milled into fine powder in the blender and the fibrous powder of walnut branches was extracted twice, on each occasion with 60% ethyl alcohol at room temperature for 24 h. The combined ethanol extract was filtered, and the filtrate was concentrated to dryness under reduced pressure in a rotary evaporator. The ethanol extract was freeze-dried. Without any further purification, the plant crude ethanol extract was used in our study. Aliquot portions of the ethanol extract was dissolved in DMSO for use of our experiments.

Cell culture and assessment of cell proliferation

Rheumatoid synovial cells were obtained by standard methods (17). Briefly, the tissue was minced into small pieces and digested with collagenase (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). The single-cell suspension was incubated overnight, and then floating cells were removed, and adherent cells were cultured in dishes. RSCs and MEFs, which were derived from Tam-inducible Syvn1 knockout mice (CAG-Cre-ER; Syvn1flox/flox), were cultured in Dulbecco's modified Eagle's medium (DMEM) as previously described (14). RSC proliferation was measured with DMSO or walnut extract treatment (1, 3.3, 10, 33.3 µg/ml) for 3 days using the Cell Counting Kit-8 (Dojindo, Tokyo, Japan). MEFs were treated with DMSO or Tamoxifen (2.5 µM) for 2 days, and were then treated with DMSO or walnut extract (50 µg/ml) for 3 days. Electron microscopic analysis was then performed.

GST pull-down assay

The GST pull-down assay was performed as previously described (14,18). Briefly, GST-Syvn1ΔTM and MBP-PGC-1β (1–367) were expressed and purified using glutathione sepharose beads and amylose beads, respectively (GE Healthcare Life Sciences, Little Chalfont, UK). GST-Syvn1ΔTM was incubated with MBP-PGC-1β bound to resin in 1 ml buffer A (20 mM Tris-HCl, pH 8.0; 100 mM NaCl; 1 mM ethylenediaminetetraacetic acid (EDTA); 1 mM dithiothreitol (DTT); 0.1% Nonidet P-40 (NP-40); 5% glycerol; 1 mM Na3VO4; 5 mM NaF; 1 µg/ml aprotinin; and 1 µg/ml leupeptin) for 4 h at 4°C. After washing the beads with buffer A, bound proteins were fractionated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by western blotting.

In vitro ubiquitination assay

In vitro ubiquitination assays were performed as previously described (14). Briefly, GST-PGC-1β (1–367) was incubated with 0.75 µg HA-Ub, 125 ng E1 (Biomol International, Plymouth Meeting, PA, USA), 150 ng UbcH5c, and 150 ng MBP-Syvn1ΔTM in reaction buffer (50 mM Tris-HCl, pH 7.5; 5 mM MgCl2; 0.6 mM DTT; and 2 mM ATP) at 37°C for 2 h. Glutathione sepharose was added to the solution, after which the mixture was washed with GST wash buffer (50 mM Tris-HCl, pH 7.5; 0.5 M NaCl; 1% Triton X-100; 1 mM EDTA; 1 mM DTT; and protease inhibitors). Ubiquitinated PGC-1β was analyzed by western blotting using anti-PGC-1β antibodies.

Ubiquitination assay

In vivo ubiquitination assays were performed as previously described (14). Briefly, 293T cells were transfected with HA-PGC-1β, FLAG Ub, or Syvn1 expression plasmids. Cells were treated with DMSO or walnut extract (50 µg/ml) for 3 days. Cells were lysed in lysis buffer (50 mM HEPES, pH 7.9; 150 mM KCl; 1 mM phenylmethanesulfonyl fluoride, 1% Triton X-100; 10% glycerol; and protease inhibitors). Lysates were mixed with 1 µg anti-HA antibody conjugated to protein G-sepharose beads. After a 4-h incubation at 4°C, beads were washed three times with lysis buffer. Bound proteins were fractionated by SDS-PAGE and analyzed by immunoblotting.

MitoTracker staining

For analysis of mitochondria using MitoTracker Red (Molecular Probes, Eugene, OR, USA), MEFs were treated with DMSO or walnut extract (50 µg/ml) for 3 days. Mitochondria were stained with the MitoTracker Red probe for 30 min at 37°C according to the manufacturer's protocol. Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI). The intensity of staining by mitotracker was measured (n=8).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Tam-inducible Syvn1 knockout MEFs were treated with DMSO (WT MEFs) or Tam (Syvn1 knockout MEFs) for 2 days, and then WT MEFs and Syvn1 knockout MEFs were treated with DMSO or walnut extract (50 µg/ml) for 3 days. Total RNA from MEFs treated with DMSO or walnut extract was purified by using ISOGEN (Nippon Gene, Tokyo, Japan) according to the manufacturer's instructions and reverse transcribed by using ReverTra Ace with random primers (Toyobo, Osaka, Japan). RT-qPCR was performed by using LightCycler 480 Probes Master (Roche Diagnostics, Mannheim, Germany) and the Step One Plus Detection System (Applied Biosystems; Life Technologies Japan, Tokyo, Japan). The thermocycling conditions were as follows: Initial denaturation at 95°C for 10 min, followed by 45 cycles of denaturation at 95°C for 10 sec, annealing at 60°C for 20 sec and extension at 72°C for 1 sec. Expression levels were determined relative to that of 18sRNA (RSCs) or ACTB (MEFs). Primers and probes used in the present study are shown in Table I. Relative expression was determined using the 2−∆∆Cq method (19).

Table I.

Primers and probes for reverse transcription-quantitative polymerase chain reaction.

Table I.

Primers and probes for reverse transcription-quantitative polymerase chain reaction.

GeneTypePrimer (5′-3′)Probe no.
SYVN1Forward ccagtacctcaccgtgctg16
Reverse tctgagctagggatgctggt
18sRNAForward gcaattattccccatgaacg48
Reverse gggacttaatcaacgcaagc
MCADForward tcttgctggaaatgatcaaca88
Reverse gggctctgtcacacagtaagc
Atp5bForward tgagagaggtcctatcaaaacca15
Reverse cctttatcccagtcaccagaa
ACTBForward ctaaggccaaccgtgaaaag64
Reverse accagaggcatacagggaca

[i] SYVN1, synoviolin; MCAD, medium chain acyl-coenzyme A dehydrogenase; Atp5b, mitochondrial ATP synthase β subunit; ACTB, β-actin.

RNA interference assay

siRNAs for Syvn1 were previously described (14). Transfection with siRNAs (20 µM) was performed by using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's protocol. Total RNA from RSCs was purified 2 days after transfection using ISOGEN (Nippon Gene, Tokyo, Japan) according to the manufacturer's instructions, and reverse transcribed using ReverTra Ace with random primers (Toyobo).

Statistical analysis

All data are expressed as the mean ± standard deviation and were analyzed using Excel Statistics 2012 version 1.00 (Social Survey Research Information Co., Ltd., Tokyo, Japan). Differences between two groups were examined by Student's t-test. One-way analysis of variance with Tukey-Kramer post hoc analysis was used to determine correlations in datasets containing multiple groups. P<0.05 was considered to indicate a statistically significant difference.

Results

Screening of natural products for Syvn1 inhibitors

Syvn1 is a crucial factor involved in RSC proliferation (7,13,20). To identify Syvn1 inhibitors in natural products, we tested the effects of natural products on RSC proliferation with or without Syvn1. At first, we performed knockdown experiments with control siRNA (siControl) or siRNA for Syvn1 (siSyvn1). RT-qPCR showed that siSyvn1 induced 60% repression of Syvn1 expression (Fig. 1A). Walnut extract inhibited proliferation in a concentration-dependent manner in two RSC lines treated with siControl (Fig. 1B). Whereas, the inhibitory effect was attenuated in siSyvn1-treated cells (Fig. 1B). In the case of patient 1, walnut extract did not significantly have any effect (n.s.). In the case of patient 2, walnut extract had still inhibited cell growth, however, the strength of the effect was reduced as compared to control siRNA-treated cells.

Figure 1.

Effect of walnut extract on RSC growth. (A) Effect of Syvn1 knockdown by siRNA. RSCs derived from two patients with RA were transiently transfected with control siRNA (siControl) or siRNA for Syvn1 (siSyvn1). Following 2 days, total RNA were purified and reverse transcription-quantitative polymerase chain reaction was performed. Individual measurements were standardized using 18S RNA, and the average for siControl was set to 100. (B) RSCs were transiently transfected with siControl or siSyvn1. Following 2 days, RSCs were treated with walnut extract (1, 3.3, and 10 µg/ml) for 3 days. Data are presented as the mean ± standard deviation (n=3). *P<0.05 and **P<0.01, as indicated. n.s., not significant; DMSO, dimethyl sulfoxide; RSC, rheumatoid synovial cell; RA, rheumatoid arthritis; si-/siRNA, small interfering RNA; Syvn1, Synoviolin.

Regulation of Syvn1-PGC-1β interaction by walnut extract

Syvn1 negatively regulates PGC-1β activity via direct interaction with PGC-1β in vitro and in vivo (14). To determine whether walnut extract inhibits the interaction of Syvn1 with PGC-1β, we performed in vitro binding assays using glutathione S-transferase-tagged Syvn1 lacking the transmembrane domain (GST-Syvn1ΔTM) and maltose binding protein-tagged PGC-1β (amino acids 1–367) (MBP-PGC-1β (1–367)). As previously reported (14), MBP-PGC-1β (1–367) directly bound to GST-Syvn1ΔTM (Fig. 2A). MBP-PGC-1β (1–367) did not bind to GST, and GST-Syvn1ΔTM did not bind to MBP (Fig. 2A). Walnut extract inhibited the interaction of Syvn1 and PGC-1β in a concentration-dependent manner (Fig. 2B).

Figure 2.

Effect of walnut extract on the interactions between SYVN1 and PGC-1β. (A) An in vitro binding assay was performed with GST or GST-SYVN1ΔTM and MBP or MBP-PGC1β (amino acids 1–367). (B) An in vitro binding assay was performed using MBP-PGC-1β (amino acids 1–367) and GST-SYVN1ΔTM in the presence of DMSO or walnut extract (0.5 or 5 µg/ml). WB was performed using anti-GST antibodies or anti-PGC1β antibodies. Syvn1, Synoviolin; PGC-1β, PGC-1β, peroxisome proliferator-activated receptor coactivator 1β; GST, glutathione S-transferase; TM, transmembrane domain; MBP, maltose binding protein; DMSO, dimethyl sulfoxide; WB, western blotting.

Inhibition of PGC-1β ubiquitination by walnut extract

Syvn1 ubiquitinates PGC-1β in vitro and in vivo, negatively regulating PGC-1β abundance (14). To investigate ubiquitination of PGC-1β by Syvn1 in the presence of walnut extract, we performed an in vitro assay of ubiquitination with MBP-Syvn1ΔTM and GST-PGC-1β (1–367) in the presence of ATP, hemagglutinin-tagged ubiquitin (HA-Ub), E1, and E2 (UbcH5c) (14). As previously reported (14), Syvn1 induced polyubiquitination of PGC-1β in vitro, and polyubiquitination of PGC-1β was not observed in the absence of ATP or Syvn1. Walnut extract inhibited PGC-1β polyubiquitination (Fig. 3A). To examine the effect of walnut extract in vivo, we performed in vivo ubiquitination assay. FLAG-tagged Ub and HA-PGC-1β were coexpressed with Syvn1 in HEK 293T cells and cells were treated with DMSO or walnut extract (50 µg/ml) for 3 days. The ubiquitination of PGC-1β was observed in Syvn1-expressing cells (DMSO-treated cells). The treatment with walnut extract decreased the ubiquitination of PGC-1β in Syvn1-expressing cells (Fig. 3B). Walnut extract did not inhibit autoubiquitination of Syvn1 (Fig. 3C). The effect of walnut extract was also examined in vivo. FLAG-tagged Ub (FLAG Ub) and Syvn1/HA were coexpressed in HEK 293T cells and cells were treated with DMSO or walnut extract (50 µg/ml) for 3 days. Autoubiquitination of Syvn1 was not inhibited in walnut extract-treated cells (Fig. 3D).

Figure 3.

Effect of walnut extract on the polyubiquitination of PGC-1β. (A) In vitro ubiquitination assays were performed with MBP-SYVN1ΔTM, GST-PGC-1β (1–367), E1 and E2 enzymes, and HA-Ub in the presence of DMSO or walnut extract (0.5, 5 or 50 µg/ml). WB was performed using anti-PGC-1β antibodies and anti-SYVN1 antibodies. (B) In vivo ubiquitination assays were performed. 293T cells were transfected with HA PGC-1β, FLAG Ub and/or SYVN1 expression plasmids and cells were treated with DMSO and walnut extract (50 µg/ml) for 3 days. Whole cell extracts were immunoprecipitated with anti-HA antibody. WB was performed using anti-FLAG and anti-HA antibodies. Quantification of the data is presented. *P<0.05, as indicated. (C) Effect of walnut extract on SYVN1 autoubiquitination. In vitro ubiquitination assays were performed with GST-SYVN1ΔTM, E1 and E2 enzymes, and HA-Ub in the presence of DMSO or walnut extract (0.5, 5 or 50 µg/ml). WB was performed using anti-SYVN1 antibodies. Quantification of the data is presented. (D) In vivo ubiquitination assays were performed. 293T cells were transfected with FLAG Ub, and SYVN1/HA expression plasmids and cells were treated with DMSO and walnut extract (50 µg/ml) for 3 days. Whole cell extracts were immunoprecipitated with anti-HA antibody. WB was performed using anti-FLAG and anti-HA antibodies. Quantification of the data is presented. The positions of molecular weight standards (in kDa) are indicated to the left of each image. Data are expressed as the mean ± standard deviation (n=3). HA, hemagglutinin; Ub, ubiquitin; DMSO, dimethyl sulfoxide; WB, western blotting; Syvn1, Synoviolin; PGC-1β, PGC-1β, peroxisome proliferator-activated receptor coactivator 1β; ATP, mitochondrial adenosine triphosphate synthase; GST, glutathione S-transferase; TM, transmembrane domain; MBP, maltose binding protein; n.s., not significant.

Effects of walnut extract on PGC-1β function

PGC-1β is a coactivator of several transcription factors, including PPARα, and is implicated in various biological processes, including mitochondrial biogenesis (21,22). LS-102 exposure increases the number of mitochondria in cultured cells (14). To investigate the effect of walnut extract on regulation of mitochondria by PGC-1β, we performed mitochondrial staining using MitoTracker with mouse embryonic fibroblasts (MEFs) (14). MitoTracker staining showed increased mitochondria in MEFs treated with walnut extract compared with MEFs treated with DMSO (Fig. 4A). We used electron microscopy and counted mitochondria. The cells treated with walnut extract had significantly more mitochondria than the cells treated with dimethyl sulfoxide (DMSO) did (Fig. 4B and C). In addition, the number of mitochondria in Syvn1 knockout MEFs treated with DMSO (KO+DMSO) increased compared to that in wildtype MEFs treated with DMSO. However, walnut extract produced no additional effect on the number of mitochondria in the Syvn1 KO MEFs (KO+Walnut extract). Furthermore, the expression of PGC-1β target genes, medium chain acyl-coenzyme A dehydrogenase (MCAD) and mitochondrial ATP synthase β subunit (ATP5b), was also induced in MEFs treated with walnut extract and in Syvn1 KO MEFs treated with DMSO (Fig. 4D). However, walnut extract produced no additional effect on the induction of MCAD and ATP5b in the Syvn1 KO MEFs (Fig. 4D).

Figure 4.

Effect of walnut extract on the number of mitochondria. (A) MEFs were treated with DMSO or walnut extract (50 µg/ml) for 3 days. Cells were immunostained with MitoTracker Red (red), and DAPI (nuclei, blue); scale bars, 20 µm. The intensity of staining was measured by MitoTracker. Data were expressed as the mean ± standard deviation (n=8). (B) Representative electron micrographs of walnut extract-treated cells (50 µg/m) are presented. Increased mitochondrial volume can be observed in the large cytoplasmic areas in MEFs (mitochondria are indicated by red asterisks). Magnification, ×10,000. (C) The number of mitochondria in the area (1,000×1,000 pixels) was measured. Data were expressed as the mean ± standard deviation (n=13). (D) Total RNA was isolated from wild-type MEFs and Syvn1 knockout MEFs treated with DMSO or walnut extract, and reverse transcription-quantitative polymerase chain reaction was performed. Individual measurements were standardized using β-actin, and then the average DMSO value was set to 1. Data were expressed as the mean ± standard deviation (n=6). **P<0.01, as indicated. MEFs, mouse embryonic fibroblasts; DMSO, dimethyl sulfoxide; Syvn1, Synoviolin; KO, Syvn1 knockout mice; MCAD, medium chain acyl-coenzyme A dehydrogenase; ATP5b, mitochondrial adenosine triphosphate synthase β subunit.

Discussion

The development of Syvn1 inhibitors is an active field of study because they have the potential to treat patients with several diseases, including rheumatoid arthritis, fibrosis, liver cirrhosis, and obesity (7–10,13). In a previous study, we demonstrated that the Syvn1 inhibitor, LS102, suppressed weight gain in a mouse model of obesity via inhibition of PGC-1β polyubiquitination by Syvn1 (14). In this study, we showed that walnut extract, a natural product, inhibits Syvn1 activity. Walnut extract inhibited the interaction between Syvn1 and PGC-1β and repressed polyubiquitination of PGC-1β by Syvn1. Taken together, these results suggest that walnut extract has anti-obesity activity.

Selectivity and specificity are important characteristics for targeted drugs. We identified LS-102 as an inhibitor of autoubiquitination of Syvn1 via a high-throughput screening (13) and demonstrated its inhibitory effect on the E3 ligase activity of Syvn1. LS-102 suppressed polyubiquitination of target proteins of Syvn1, including nuclear factor erythroid 2-related factor 2 (NRF2), V247M α-sarcoglycan mutant, and PGC-1β (10,11,13). Interestingly, Syvn1 interacts with NRF2 and V247M α-sarcoglycan mutant through proline-rich domains at the C-terminus, whereas Syvn1 binds to PGC-1β via the Syvn1 unique (SyU) domain (10,11,13,14). Walnut extract did not have an inhibitory effect on autoubiquitination of Syvn1. However, walnut extract decreased polyubiquitination of PGC-1β by inhibiting the interaction of Syvn1 and PGC-1β. Therefore, walnut extract may specifically target the SyU domain of Syvn1. These results indicate that walnut extract might improve obesity by selectively inhibiting the interaction of Syvn1 and PGC-1β.

The mitochondrion is an important organelle involved in cellular energy control that has been reported to be involved in the process of obesity and chronic inflammation (23,24). PGC-1β plays an important role in mitochondrial biogenesis and energy metabolism, including β-oxidation of fatty acids (25). Overexpression of PGC-1β results in increased numbers of mitochondria and increased mitochondrial respiratory function (26). PGC-1β transgenic mice show high energy expenditure and resistance to obesity (27). In addition, PGC-1β attenuated inflammation. PGC-1β diminishes the increase in proinflammatory mediators, such as interleukin-6 (IL-6) and macrophage inflammatory protein 1-alpha (MIP1α), by repressing the activity of nuclear factor-κB (NF-κB) (28). These studies indicate that PGC-1β has anti-obesity and anti-inflammatory properties. In this study, we found that walnut extract inhibited the negative regulation of PGC-1β activity by Syvn1, suggesting that walnut extract activates PGC-1β. Our results suggest that walnut extract may attenuate not only obesity, but also diseases involving chronic inflammation. Further analysis with disease state model will be need to determine whether walnut extract will be helpful in several disease with chronic inflammation. Future studies will be aimed at identifying the bioactive constituents in walnut extract that are responsible for its inhibitory effect on Syvn1.

Acknowledgements

The authors thank Mr. S. Shibata (Tokyo Medical University, Tokyo, Japan) for their technical assistance. The authors would also like to thank all of the members of Dr. Nakajima's laboratory and Dr. Khin Thuzar Wynn (Yangon Speciality Hospital, Yangon, Myanmar).

Funding

The present study was funded in part by grants from the Naito Foundation, Natural Science Scholarship Daiichi-Sankyo Foundation of Life Science, Mitsubishi, Tanabe Pharma Corporation, Bureau of Social Welfare and Public Health, Academic Contribution of Pfizer, Eisai, Santen Pharmaceutical, Abbvie, Takeda Science Foundation, AstraZeneca (R&D Grant 2013) and ONO Medical Research Foundation. The present study was also supported partly by funds provided through a MEXT-Supported Program of the Strategic Research Foundation at Private Universities (grant no. S1411011; 2014–2018) from the Ministry of Education, Culture, Sports, Science and Technology of Japan, as well as the Japan Society for the Promotion of Science KAKENHI (grant nos. 23659176, 26670479, 26461478 and 16H05157) and Industry-University Cooperation (BioMimetics Sympathies Inc.).

Availability of data and materials

All data analyzed in this study are included in this article.

Authors' contributions

HF, SA, KN, NY and TN conceived the project and designed the experiments. HF, SA and TN performed the experiments and analyzed the data. HF and TN wrote the manuscript. All authors discussed the results and commented on the manuscript.

Ethics approval and consent to participate

All human experimental protocols in the present study (nos. 2728 and 2729, 3758, 3759) were approved by the Ethics Review Committee of Tokyo Medical University (Tokyo, Japan). Written informed consent was obtained from all of the patients prior to the collection of joint tissue samples.

Patient consent for publication

Consent for publication was obtained from all of the patients.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

Syvn1

synoviolin

PGC-1β

peroxisome proliferator-activated receptor coactivator 1β

RSCs

rheumatoid synovial cells

SPF

specific pathogen-free

References

1 

Tsai AG, Williamson DF and Glick HA: Direct medical cost of overweight and obesity in the USA: A quantitative systematic review. Obes Rev. 12:50–61. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Gautron L, Elmquist JK and Williams KW: Neural control of energy balance: Translating circuits to therapies. Cell. 161:133–145. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Sun Y, Xun K, Wang Y and Chen X: A systematic review of the anticancer properties of berberine, a natural product from Chinese herbs. Anticancer Drugs. 20:757–769. 2009. View Article : Google Scholar : PubMed/NCBI

4 

Lee YS, Kim WS, Kim KH, Yoon MJ, Cho HJ, Shen Y, Ye JM, Lee CH, Oh WK, Kim CT, et al: Berberine, a natural plant product, activates AMP-activated protein kinase with beneficial metabolic effects in diabetic and insulin-resistant states. Diabetes. 55:2256–2264. 2006. View Article : Google Scholar : PubMed/NCBI

5 

Ejaz A, Wu D, Kwan P and Meydani M: Curcumin inhibits adipogenesis in 3T3-L1 adipocytes and angiogenesis and obesity in C57/BL mice. J Nutr. 139:919–925. 2009. View Article : Google Scholar : PubMed/NCBI

6 

Zhang Z, Zhang H, Li B, Meng X, Wang J, Zhang Y, Yao S, Ma Q, Jin L, Yang J, et al: Berberine activates thermogenesis in white and brown adipose tissue. Nat Commun. 5:54932014. View Article : Google Scholar : PubMed/NCBI

7 

Amano T, Yamasaki S, Yagishita N, Tsuchimochi K, Shin H, Kawahara K, Aratani S, Fujita H, Zhang L, Ikeda R, et al: Synoviolin/Hrd1, an E3 ubiquitin ligase, as a novel pathogenic factor for arthropathy. Genes Dev. 17:2436–2449. 2003. View Article : Google Scholar : PubMed/NCBI

8 

Hasegawa D, Fujii R, Yagishita N, Matsumoto N, Aratani S, Izumi T, Azakami K, Nakazawa M, Fujita H, Sato T, et al: E3 ubiquitin ligase synoviolin is involved in liver fibrogenesis. PLoS One. 5:e135902010. View Article : Google Scholar : PubMed/NCBI

9 

Li L, Shen Y, Ding Y, Liu Y, Su D and Liang X: Hrd1 participates in the regulation of collagen I synthesis in renal fibrosis. Mol Cell Biochem. 386:35–44. 2014. View Article : Google Scholar : PubMed/NCBI

10 

Wu T, Zhao F, Gao B, Tan C, Yagishita N, Nakajima T, Wong PK, Chapman E, Fang D and Zhang DD: Hrd1 suppresses Nrf2-mediated cellular protection during liver cirrhosis. Genes Dev. 28:708–722. 2014. View Article : Google Scholar : PubMed/NCBI

11 

Bianchini E, Fanin M, Mamchaoui K, Betto R and Sandona D: Unveiling the degradative route of the V247M α-sarcoglycan mutant responsible for LGMD-2D. Hum Mol Genet. 23:3746–3758. 2014. View Article : Google Scholar : PubMed/NCBI

12 

Yamasaki S, Yagishita N, Tsuchimochi K, Nishioka K and Nakajima T: Rheumatoid arthritis as a hyper-endoplasmic-reticulum-associated degradation disease. Arthritis Res Ther. 7:181–186. 2005. View Article : Google Scholar : PubMed/NCBI

13 

Yagishita N, Aratani S, Leach C, Amano T, Yamano Y, Nakatani K, Nishioka K and Nakajima T: RING-finger type E3 ubiquitin ligase inhibitors as novel candidates for the treatment of rheumatoid arthritis. Int J Mol Med. 30:1281–1286. 2012. View Article : Google Scholar : PubMed/NCBI

14 

Fujita H, Yagishita N, Aratani S, Saito-Fujita T, Morota S, Yamano Y, Hansson MJ, Inazu M, Kokuba H, Sudo K, et al: The E3 ligase synoviolin controls body weight and mitochondrial biogenesis through negative regulation of PGC-1β. EMBO J. 34:1042–1055. 2015. View Article : Google Scholar : PubMed/NCBI

15 

Yamasaki S, Yagishita N, Sasaki T, Nakazawa M, Kato Y, Yamadera T, Bae E, Toriyama S, Ikeda R, Zhang L, et al: Cytoplasmic destruction of p53 by the endoplasmic reticulum-resident ubiquitin ligase ‘Synoviolin’. EMBO J. 26:113–122. 2007. View Article : Google Scholar : PubMed/NCBI

16 

Ojewole JA: Analgesic, antiinflammatory and hypoglycaemic effects of ethanol extract of Zingiber officinale (Roscoe) rhizomes (Zingiberaceae) in mice and rats. Phytother Res. 20:764–772. 2006. View Article : Google Scholar : PubMed/NCBI

17 

Nakajima T, Aono H, Hasunuma T, Yamamoto K, Shirai T, Hirohata K and Nishioka K: Apoptosis and functional Fas antigen in rheumatoid arthritis synoviocytes. Arthritis Rheum. 38:485–491. 1995. View Article : Google Scholar : PubMed/NCBI

18 

Fujita H, Fujii R, Aratani S, Amano T, Fukamizu A and Nakajima T: Antithetic effects of MBD2a on gene regulation. Mol Cell Biol. 23:2645–2657. 2003. View Article : Google Scholar : PubMed/NCBI

19 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

20 

Nakajima T, Aono H, Hasunuma T, Yamamoto K, Maruyama I, Nosaka T, Hatanaka M and Nishioka K: Overgrowth of human synovial cells driven by the human T cell leukemia virus type I tax gene. J Clin Invest. 92:186–193. 1993. View Article : Google Scholar : PubMed/NCBI

21 

Scarpulla RC: Transcriptional paradigms in mammalian mitochondrial biogenesis and function. Physiol Rev. 88:611–638. 2008. View Article : Google Scholar : PubMed/NCBI

22 

Liu C and Lin JD: PGC-1 coactivators in the control of energy metabolism. Acta Biochim Biophys Sin (Shanghai). 43:248–257. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Bournat JC and Brown CW: Mitochondrial dysfunction in obesity. Curr Opin Endocrinol Diabetes Obes. 17:446–452. 2010. View Article : Google Scholar : PubMed/NCBI

24 

De Felice FG and Ferreira ST: Inflammation, defective insulin signaling, and mitochondrial dysfunction as common molecular denominators connecting type 2 diabetes to Alzheimer disease. Diabetes. 63:2262–2272. 2014. View Article : Google Scholar : PubMed/NCBI

25 

Puigserver P, Wu Z, Park CW, Graves R, Wright M and Spiegelman BM: A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell. 92:829–839. 1998. View Article : Google Scholar : PubMed/NCBI

26 

St-Pierre J, Lin J, Krauss S, Tarr PT, Yang R, Newgard CB and Spiegelman BM: Bioenergetic analysis of peroxisome proliferator-activated receptor gamma coactivators 1alpha and 1beta (PGC-1alpha and PGC-1beta) in muscle cells. J Biol Chem. 278:26597–26603. 2003. View Article : Google Scholar : PubMed/NCBI

27 

Kamei Y, Ohizumi H, Fujitani Y, Nemoto T, Tanaka T, Takahashi N, Kawada T, Miyoshi M, Ezaki O and Kakizuka A: PPARgamma coactivator 1beta/ERR ligand 1 is an ERR protein ligand, whose expression induces a high-energy expenditure and antagonizes obesity. Proc Natl Acad Sci USA. 100:12378–12383. 2003. View Article : Google Scholar : PubMed/NCBI

28 

Eisele PS, Salatino S, Sobek J, Hottiger MO and Handschin C: The peroxisome proliferator-activated receptor γ coactivator 1α/β (PGC-1) coactivators repress the transcriptional activity of NF-κB in skeletal muscle cells. J Biol Chem. 288:2246–2260. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Fujita H, Aratani S, Yagishita N, Nishioka K and Nakajima T: Identification of the inhibitory activity of walnut extract on the E3 ligase Syvn1. Mol Med Rep 18: 5701-5708, 2018.
APA
Fujita, H., Aratani, S., Yagishita, N., Nishioka, K., & Nakajima, T. (2018). Identification of the inhibitory activity of walnut extract on the E3 ligase Syvn1. Molecular Medicine Reports, 18, 5701-5708. https://doi.org/10.3892/mmr.2018.9576
MLA
Fujita, H., Aratani, S., Yagishita, N., Nishioka, K., Nakajima, T."Identification of the inhibitory activity of walnut extract on the E3 ligase Syvn1". Molecular Medicine Reports 18.6 (2018): 5701-5708.
Chicago
Fujita, H., Aratani, S., Yagishita, N., Nishioka, K., Nakajima, T."Identification of the inhibitory activity of walnut extract on the E3 ligase Syvn1". Molecular Medicine Reports 18, no. 6 (2018): 5701-5708. https://doi.org/10.3892/mmr.2018.9576
Copy and paste a formatted citation
x
Spandidos Publications style
Fujita H, Aratani S, Yagishita N, Nishioka K and Nakajima T: Identification of the inhibitory activity of walnut extract on the E3 ligase Syvn1. Mol Med Rep 18: 5701-5708, 2018.
APA
Fujita, H., Aratani, S., Yagishita, N., Nishioka, K., & Nakajima, T. (2018). Identification of the inhibitory activity of walnut extract on the E3 ligase Syvn1. Molecular Medicine Reports, 18, 5701-5708. https://doi.org/10.3892/mmr.2018.9576
MLA
Fujita, H., Aratani, S., Yagishita, N., Nishioka, K., Nakajima, T."Identification of the inhibitory activity of walnut extract on the E3 ligase Syvn1". Molecular Medicine Reports 18.6 (2018): 5701-5708.
Chicago
Fujita, H., Aratani, S., Yagishita, N., Nishioka, K., Nakajima, T."Identification of the inhibitory activity of walnut extract on the E3 ligase Syvn1". Molecular Medicine Reports 18, no. 6 (2018): 5701-5708. https://doi.org/10.3892/mmr.2018.9576
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team