Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
May-2019 Volume 19 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2019 Volume 19 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Targeted next‑generation sequencing for research and diagnostics in congenital heart disease, and cleft lip and/or palate

  • Authors:
    • Haisong Bu
    • Lin Liu
    • Shijun Hu
    • Zhiping Tan
    • Tianli Zhao
  • View Affiliations / Copyright

    Affiliations: Department of Cardiovascular Surgery, The Second Xiangya Hospital, Central South University, Changsha, Hunan 410011, P.R. China, Department of Stomatology, The Second Xiangya Hospital, Central South University, Changsha, Hunan 410011, P.R. China
  • Pages: 3831-3840
    |
    Published online on: March 15, 2019
       https://doi.org/10.3892/mmr.2019.10043
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Congenital heart disease (CHD), and cleft lip and palate (CLP) are currently the most common types of structural malformation in infants. Various methods have been used to identify the disease‑associated genes. However, targeted next‑generation sequencing (NGS) is not yet considered an option for routine use. Thus, the present study aimed to assess the safety and feasibility of using targeted NGS in patients with CHD concomitant with CLP. Between November 2015 and May 2017, a total of 17 patients with CHD concomitant with CLP, who were excluded from a diagnosis of trisomy syndrome, were selected at The Second Xiangya Hospital of Central South University (Changsha, China). Genomic DNA was extracted from peripheral blood samples of the patients. The copy number variants (CNVs) were determined by conducting a single nucleotide polymorphism (SNP) array with Illumina HumanOmni1‑Quad Beadchip, while information on other gene mutations was obtained from targeted sequencing. The functions of gene mutations were then predicted using the PolyPhen‑2, SIFT and Mutation Taster tools. Finally, Sanger sequencing was used to verify the mutations. The results identified no pathogenic mutations in CNVs analyzed by high‑throughput SNP sequencing. Targeted NGS results demonstrated that 10 patients (58.8%) carried gene mutations, including 4 (23.5%) genetically diagnosed cases and 6 (35.3%) cases with unknown etiology. The 4 known diseases were Opitz G/BBB syndrome caused by MID1 gene mutation, Loeys‑Dietz syndrome caused by TGFBR1 gene mutation, Ritscher‑Schinzel/3C syndrome caused by KIAA0196 gene mutation and CHARGE syndrome caused by CHD7 gene mutation. The remaining 6 cases were not genetically diagnosed, although they carried candidate genes. In conclusion, the present study demonstrated that targeted NGS was an effective and accurate candidate gene detection method in patients with CHD concomitant with CLP.

Introduction

Congenital heart disease (CHD), and cleft lip and palate (CLP) represent birth defects with the highest rates of incidence worldwide. Furthermore, the incidence rate of CHD in patients with CLP is 6.5–12.7%, which is notably higher in comparison with that of the general population (1,2). In addition to distorting the facial appearance, CLP can negatively affect normal infant activities, such as suckling and speaking (3). Clinically, CHD and CLP are commonly referred to as the main phenotypes, although specific syndromes are also described in certain patients, such as velocardiofacial syndrome, solitary median maxillary central incisor syndrome and Wolf-Hirschhorn syndrome, among others (4–6). Children with CLP typically require multiple surgical interventions and numerous sessions of speech therapy from infancy to early adulthood to achieve near-normal appearance and function (7). Genetic studies have suggested that deletion of the chromosome fragments and single gene mutation are both observed in these syndromes (4–6,8). However, the hereditary background of patients with such syndromes currently remains clear.

With the development of genetic sequencing technologies, numerous novel methods have been suggested as important techniques to identify disease-associated genes, including single nucleotide polymorphism (SNP) array, copy number variation (CNV) analysis, and targeted and whole exome sequencing (9–11). Traditionally, genetic testing in DNA-based diagnostic laboratories involves sequential Sanger sequencing of known disease genes. However, the diagnostic yield of next-generation sequencing (NGS) exceeds that of Sanger sequencing in genetic diseases, since multiple genes can be analyzed in a single experiment. Thus, the introduction of NGS has provided revolutionary opportunities for comprehensive genetic testing in research and diagnostics.

In the present study, the effectiveness and accuracy of using targeted NGS to determine candidate genes in patients with CHD concomitant with CLP were assessed.

Patients and methods

Patients

A total of 17 patients with CHD concomitant with CLP treated at The Second Xiangya Hospital of Central South University (Changsha, China) between November 2015 and May 2017 were enrolled into the present study (Fig. 1). The study group comprised of 14 male and 3 female patients aged 4–108 months (mean age, 42.8±32.9 months) with a mean body weight of 17.6±6.9 kg (Table I). The patient selection criteria in terms of CHD were as follows: i) Exhibiting typical clinical manifestations and symptoms of CHD on physical examination, including cyanosis and/or cardiac murmur; and ii) diagnosis of CHD by transthoracic echocardiography (12). In terms of CLP the inclusion criteria included the following: i) Typical clinical manifestations and symptoms on physical examination, including cleft lip (CL) and/or cleft palate (CP) (13,14); ii) stomatological diagnosis; and iii) amalgamation or non-merger of other malformations, or growth/mental retardation. The patient exclusion criteria were as follows: i) Patients without CHD and CLP; ii) cases diagnosed with trisomy 18 or 21 syndrome; and iii) refusal of participation by the patient's parents or guardians.

Figure 1.

Characteristic examples of left lip and/or palate phenotype in patients.

Table I.

Patient characteristics.

Table I.

Patient characteristics.

CharacteristicValue
Total no.17
Males/females14/3
Mean age (months)42.8±32.9
Mean weight (kg)17.6±6.9
Cardiac phenotype
  ASD1
  VSD7
  DORV1
  ASD + VSD3
  ASD + PLSVC1
  TOF + PLSVC1
  VSD + PFO1
  TOF + ASD1
  PDA + PFO1
Maxillofacial phenotype
  CL5
  CP9
  CLP3

[i] VSD, ventricular septal defect; ASD, atrial septal defect; TOF, tetralogy of Fallot; PLSVC, persistent left superior vena cava; PDA, patent ductus arteriosus; PFO, patent foramen ovale; DORV, double outlet right ventricle; CLP, cleft lip and cleft palate; CP, cleft palate; CL, cleft lip.

The study protocol was approved by the Review Board of The Second Xiangya Hospital of Central South University, and the relatives of study subjects provided informed consent for participation. All experiments were performed in accordance with relevant guidelines and regulations.

Blood sample collection and DNA extraction

Peripheral blood samples (600 µl) obtained from each patient were collected into 1.5 ml Eppendorf tubes (Eppendorf, Hamburg, Germany) containing protein kinase (20 µl) and cell lysate (200 µl). Tubes were agitated for 1 min, centrifuged for 10 sec at 4°C at 9,295 × g, and subjected to genomic (g)DNA extraction using a DNeasy Blood and Tissue kit (Qiagen, Inc., Valencia, CA, USA) according to the manufacturer's protocols using a QIAcube automated DNA extraction device (Qiagen, Inc.). The gDNA solution generated was stored at −80°C. Subsequently, a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Inc., Waltham, MA, USA) was used to determine the quantity and quality of the DNA samples, and 3 µg DNA from each sample was then used in subsequent assays (15–17).

SNP array analysis

Genomic DNA samples of the patients were used to conduct SNP array analysis at a final concentration of 50 ng/ml. The signal intensities of SNP probes were determined by employing an Illumina BeadScan genotyping system (Beadstation Scanner 500; Illumina, Inc., San Diego, CA, USA) with a HumanOmni1-Quad Beadchip (Illumina, Inc.), according to the manufacturer's protocol.

Targeted NGS

A targeted NGS gene panel for 455 genes that have been associated with CHD or CLP in previous studies (8,16,18,19) was employed (Table II). Targeted NGS, including library construction, capture and sequencing, was performed by Agilent Technologies, Inc. (Santa Clara, CA, USA). Enrichment of target regions and library preparation were performed using a SureSelectXT2 Custom kit (1–499 kb; Agilent Technologies, Inc.) according to the manufacturer's protocol. Library DNA concentrations were determined using an Agilent QPCR NGS Library Quantification kit (G4880A; Agilent Technologies, Inc.), with each sample at a final concentration of 10 nmol/l. Subsequently, samples were ordered with a HiSeq2000 sequencing system using TruSeq chemistry and protocols (version 3; Illumina, Inc.) (20).

Table II.

Target regions.

Table II.

Target regions.

Regions 1Regions 2Regions 3Regions 4Regions 5Regions 6Regions 7Regions 8Regions 9Regions 10
ABCC9ACEACP6ACTA2ACTBACTC1ACTN2ACVR1ACVR2BADRB1
ADRB2ADRB3AGLAGTAGTR1AHSA2ANKRD1APOBEC2ARL13BASXL2
ATE1ATP1A2ATP4AATP4BBAT1BBIP1BBS1BBS10BBS12BBS2
BBS4BBS5BBS7BBS9BCL11ABCL6BCL9BCORBICC1BMP7
BMPR1ABMPR1BBMPR2BUB1BC1ORF106CACNA1CCACNA2D1CALM1CALM2CALR3
CASQ2CAV3CCDC39CCDC40CCT4CDH1CDH2CDKN1CCER1CFC1
CHD1LCHD7LDB3FH19APPB1FIBPKMT2DGPD1TTC8NGF
HMGCLSTILMKKSRPSAARL6NELFAGRID2KCNH2TRIM32CHRAC1
CHRDCHRNGPQBP1CITED2CLDN7CLUL1CNTFCOL11A1COL11A2COL2A1
COL3A1CREBBPCRELD1CRHBPCRXCRYABCSRP1CSRP3CTLA4CTNNA3
CUL3CYP11B2DAND5DAPK3DESDHCR24DHCR7DHODHDLL1DMRT2
DNAI1DNAI2DOLKDOT1LDPP6DPPA4DSC2DSG2DSPDST
DTNADVL1DVL2DZIP1EDNRAEDNRBEEDEFNB1EHMT1ELN
EMDEP300ESCO2EVCEVC2EYA4EZH1EZH2FBN1FBN2
FGBFKTNFLNAFLNBFMO5FOXA2FOXC1FOXC2FOXH1FOXJ1
FOXL2FTOFXNGAAGADL1GALNT11GATA4GATA5GATA6GATAD1
GDF1GJA1GJA5GJA8GJA9GLAGLI2GLI3GPC3GPD1L
GPR161GPRC6AGSK3BHAND1HAND2HCN4HES1HES4HEY2HFE
HOXA1HUWE1HYLS1ID2IDUAIER2IFNGIFT122IFT172IFT20
IFT57IFT88IGFBP4IGFBP5IHHIL10IPPKISL1JAG1JARID2
JAZF1JPH2JUPKCND2KCND3KCNE1KCNE1LKCNE2KCNE3KCNE4
KCNH2KCNJ11KCNJ2KCNJ5KCNJ8KCNMB1KCNQ1KDM5AKDM5BKDM6A
KIAA0196KIAA1841KIF3AKIF3BKIF3CKIFAP3KLF13KRASLAMA4LAMP2
LBRLDB3LEFTY1LEFTY2LEMD3LIPCLLPHLMNALPIN1LRRC50
LRRC6MARK2MAXMED13LMED20MEF2AMEF2CMETT10DMGAT1MGP
MICAMICBMID1MKKSMKRN2MKS1MNDAMSX2MYBPC3MYH10
MYH11MYH6MYH7MYL2MYL3MYLK2MYOZ2MYPNNAA15NCOR2
NEBLNEK2NEXNNF1NFATC1NFATC3NFATC4NFKBIL1NIPBLNKD1
NKX2-5NKX2-6NKX3-2NODALNOS3NOTCH1NOTCH2NOTCH2NLNOTCH3NOTCH4
NOTONPHP3NPPANPPBNSD1NUB1NUMBLNUP188OBSCNOFD1
OSR1PAFAH1B1PAPOLGPCMTD2PCSK5PDLIM3PEX1PEX13PHF8PHYHD1
PIFOPITX2PKD1L1PKD2PKP2PLA2G7PLAGL1PLNPPM1KPPP3CA
PQBP1PRC1PRDM1PRKAB2PRKAG2PROX1PSEN1PSEN2PTCH1PTCH2
PTPLAPTPN11PTPN22PTPRCRAB10RAB23RAF1RAI1RAI2RANGRF
RAPGEF5RBM20RELRFX2RFX3RIT1RNF20ROCK2ROR2 RPGRIP1L
RUNX2S100ZSALL1SALL2SALL4SATB2SCN1BSCN3BSCN4BSCN5A
SDC2SDHASEL1L3SEMA3ESESN1SETBP1SGCASGCBSGCDSGCE
SGCGSHHSHOC2SIX3SLC26A2SLC2A10SLMAPSMAD2SMAD5SMARCD3
SMOSMYD1SMYD2SNAI1SNTA1SOD2SOS1SOX17SOX9SRF
STILSUFUSUPT3HSUPT5HSUV420H1TAZTBX1TBX20TBX3TBX5
TCAPTCF21TCOF1TDGF1TFAP2ATFAP2BTGFB1TGFBR1TGFBR2TGIF1
TLL1TMBIM4TMEM195TMEM43TMPOTNFTNFRSF21TNNC1TNNI3TNNT2
TP63TPM1TRDNTRPM4TSC1TSEN15TTC21BTTC30ATTRTWIST1
TXNDC3UBE2BUBR1UMODL1USF1USP34USP44VANGL2VCLVEGFA
VEGFCVITWDR5WHSC1WNT3AXPO1ZEB2ZFPM1ZIC3ZNF480
ZNF528ZNF534ZNF610ZNF638ZNHIT3
Data analysis and filtering

The Ensembl database (release 95; http://www.ensembl.org/) was used for variant annotation. Filtering was performed with ANNOVAR Documentation (http://annovar.openbioinformatics.org/), using the following SNP databases for filtering: dbSNP (build 138; http://www.ncbi.nlm.nih.gov/snp), Exome Variant Server (release ESP6500SI–V2; http://evs.gs.washington.edu/EVS/), 1000 Genomes Project (released May 2012; http://www.internationalgenome.org/home) and HapMap CHB (release 28; http://hapmap.ncbi.nlm.nih.gov/). In order to predict the possible impact of variants, the following tools were used: SIFT (version 6.2.1, http://sift.bii.a-star.edu.sg/), Polyphen-2 (version 2.2.2; http://genetics.bwh.harvard.edu/pph2/), Mutation-Taster (version 2; http://www.mutationtaster.org/) and Human Splicing Finder (version 3.1, http://www.umd.be/HSF3/). The filtering strategies used are displayed in Fig. 2.

Figure 2.

Flow chart representing the filtering strategies employed in the present study.

Variant validation

Variants warranting further investigation included novel variants, which were predicted to be ‘likely pathogenic’ or ‘pathogenic’ according to PolyPhen-2, Mutation-Taster and SIFT predictions, or were indicated to be ‘likely pathogenic’ and possessed minor allele frequencies of <0.1%, as predicted by ExAC browser (version 0.3.1; http://exac.broadinstitute.org/). Variants and samples from the parents of certain patients were assessed by Sanger sequencing. To confirm the disease-associated genes, the relevant literature was surveyed on PubMed (https://www.ncbi.nlm.nih.gov/pubmed); example literature searches included: MID1, Opitz G/BBB syndrome, 2007.1.1–2018.10.31, English; TGFBR1, Loeys-Dietz syndrome, 2007.1.1–2018.10.31, English; KIAA0196, Ritscher-Schinzel syndrome, 2007.1.1–2018.10.31, English; CHD7, CHARGE syndrome, 2007.1.1–2018.10.31, English.

Polymerase chain reaction (PCR)

Entire exon and exon-intron junctions of genes were amplified by PCR. Genomic DNA (0.5 µl) obtained from peripheral blood samples of patients was added to 11 µl double-distilled water, 0.5 µl forward primer, 0.5 µl reverse primer and 2× PCR Master Mix (12.5 µl; Nanjing Saihongrui Biotechnology Co., Ltd., Nanjing, China) containing 2X Taq DNA Polymerase. qPCR was conducted as follows: Initial denaturation at 94°C for 5 min; 35 cycles of denaturation at 94°C for 30 sec, annealing at 50°C for 30 sec and extension at 72°C degrees for 30 sec; and final extension at 72°C degrees for 10 min. Sequences of the PCR products were determined using an ABI 3100 Genetic Analyzer (Applied Biosystems; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. The primer sequences are listed in Table III.

Table III.

Primer sequences.

Table III.

Primer sequences.

GenePrimers (5′-3′)
MID1 F:CACTTTGTGATAGGAGGCATGA
R:ACACATTTCCAGCTACTCCATAG
TGFBR1 F:CACCAGTACCCTATTGATGGAAA
R:AGTTCAGGCAAAGCTGTAGAA
KIAA0196 F:CATATTTGGTGCCGCATGTC
R:AGAAGCCTGTCTAAGCCATTTA
CHD7 F:AATGTTTCAGGGTGGAGA
R:CAGGACCTTGTTACAGTGAT
NPHP3 F:CACAATGCAGTATAGCACACAAA
R:CTTATCTGTTCCAGCCACACT
PCSK5 F:GTGCCTTGTTAATCCCTTTACAC
R:CAGGCTGCTCTTGCTCTT
FBN2 F:TAATGAGTGTGTCGCCCTTC
R:TGGCACTTAGTATGTTTCCAGAG
DLL1 F:CTGTCTTTGGTTTGTCTGGTTTC
R:AAGTCGTTCACGCCATCC
NOTCH3 F:TCCTAAACTCACCCTGTCCT
R:GCACAGTCGTAAGTGAGGTC
COL3A1 F:AAGCAGCATCACTGTCATCTAA
R:AGAACTGCCCATTTGTGGT
CHD1L F:GAACTCGCTCTGAGGTTCAA
R:AACTTCTAAGGTCACAGGTTAGG
FMO5 F:GCTGAGTAAAGAGAACACTTGGA
R:TGGCTGTTTGGCTAATCTCTAC
LLPH F:GGATGAACCAAAGGCAAAGAAA
R:GAGGAGTTATGCTGGGTTTGA
PPARGC1A F:GGATGAACCAAAGGCAAAGAAA
R:GAGGAGTTATGCTGGGTTTGA
PTPN22 F:GGACATAGAGCTGAATTTGCTTC
R:CAAAGACAAGCTCTCTATAAGGTAGA
TTC30A F:GGAACTCTTTATTGTGCCAAAGG
R:CTGGACTCATCTGTGACTGTATTC
OBSCN F:CCACGCTGGACTCCATTAG
R:GCACAGATGGGTGGATGAA
DAND5 F:GTCATTGCTCCTCTCTCTACATC
R:ACGTCTTTCTTGGTCCATCTC
STIM2 F:CTAGAGCTTGTGCATGGGAA
R:GACTTTGCTCTGCAGTTTGTAAG

[i] F, forward; R, reverse; MID1, midline-1; TGFBR1, transforming growth factor-β receptor type I; CHD7, chromodomain-helicase- DNA-binding protein 7; NPHP-3, nephrocystin-3; PCSK5, proprotein convertase subtilisin/kexin type 5; FBN2, fibrillin 2; DLL1, delta-like protein 1; NOTCH3, Notch 3; COL3A1, collagen type III α1 chain; CHD1L, chromodomain helicase DNA binding protein 1 like; FMO5, flavin containing monooxygenase 5; LLPH, LLP homolog, long-term synaptic facilitation factor; PPARGC1A, peroxisome proliferator activated receptor gamma coactivator 1 alpha; PTPN22, protein tyrosine phosphatase non-receptor type 22; TTC30A, tetratricopeptide repeat domain 30A; OBSCN, obscurin; DAND5, DAN domain BMP antagonist family member 5; STIM2, stromal interaction molecule 2.

Results

Screening outcomes

No pathogenic mutations were identified in CNVs analyzed by high-throughput SNP sequencing. The targeted NGS results demonstrated that 10 out of the 17 patients (58.8%) carried gene mutations, including 4 cases (23.5%) that were genetically diagnosed and 6 cases (35.3%) with unknown etiology; the remaining 7 patients did not carry known mutations. The diseases involved in the 4 known cases and the associated genes were as follows: Opitz G/BBB syndrome caused by midline-1 (MID1) gene mutation; Loeys-Dietz syndrome (LDS) caused by transforming growth factor-β receptor type I (TGFBR1) gene mutation; Ritscher-Schinzel syndrome (RSS; also known as 3C syndrome) caused by KIAA0196 gene mutation; and CHARGE syndrome caused by chromodomain-helicase-DNA-binding protein 7 (CHD7) gene mutation.

Prediction of gene function

Characteristics of the named gene mutations were predicted through the PolyPhen-2, SIFT and Mutation Taster programs (Table IV). Among the genetically diagnosed cases, the MID1 (c.G1477C, p.A723V) and TGFBR1 (c.T1400A, p.M467K) gene mutations were predicted to be ‘pathogenic’, ‘likely pathogenic’ and ‘pathogenic’ by SIFT, PolyPhen-2 and Mutation Taster, respectively. The CHD7 gene mutation (c.C4894T, p.R1632C) was predicted to be ‘pathogenic’ by both SIFT and Mutation Taster, while the PolyPhen-2 program predicted this mutation to be ‘benign’. The KIAA0196 gene mutation (c.A2533G, p.T845A) was predicted to be ‘likely pathogenic’ by PolyPhen-2 and ‘pathogenic’ by Mutation Taster, while the SIFT program predicted this mutation to have ‘uncertain significance’. Potential pathogenic genes were identified in the remaining 6 cases; however, literature searches did not reveal previously reported associations between the genes and diseases of interest. Therefore, the cases cannot be diagnosed based upon the identified mutations.

Table IV.

Results of targeted sequencing.

Table IV.

Results of targeted sequencing.

Prediction tool

Patient no.Age (months)SexCHDCLPGeneChromosomeSIFTPolyPhen-2Mutation tasterCCDSAmino acid
1108MaleVSDCLMID1Xp22.2PathogenicLikely pathogenicPathogenicG1477CA723V
248MaleTOF, PLSVCCLPTGFBR19q22.3PathogenicLikely pathogenicPathogenicT1400AM467K
39MalePDA, PFOCL KIAA01968q24.13Uncertain significanceLikely pathogenicPathogenicA2533GT845A
460MaleVSD, ASDCLCHD78q12.2PathogenicBenignPathogenicC4894TR1632C
54FemaleVSD, ASDCPNPHP33q22.1Uncertain significanceBenignPathogenicC1228AQ410K
636MaleVSDCLPCSK51q21.1PathogenicLikely pathogenicPathogenicC5041GP1681A
724MaleDORV, VSDCPFBN25q23.3Uncertain significanceLikely pathogenicPathogenicG6154AE2052K
872MaleASD, PLSVCCPDLL16q27PathogenicLikely pathogenicPathogenicC1307TS436L
984FemaleVSDCPNOTCH319p13.12PathogenicLikely pathogenicPathogenicG515AG172D
1030MaleASDCPCOL3A12q32.2Uncertain significanceLikely pathogenicPathogenicG1472AR491Q

[i] CHD, congenital heart disease; VSD, ventricular septal defect; ASD, atrial septal defect; TOF, tetralogy of Fallot; PLSVC, persistent left superior vena cava; PDA, patent ductus arteriosus; PFO, patent foramen ovale; DORV, double outlet right ventricle; CLP, cleft lip and palate; CP, cleft palate; CL, cleft lip; MID1, midline-1; TGFBR1, transforming growth factor-β receptor type I; CHD7, chromodomain-helicase-DNA-binding protein 7; NPHP-3, nephrocystin-3; PCSK5, proprotein convertase subtilisin/kexin type 5; FBN2, fibrillin 2; DLL1, delta-like protein 1; NOTCH3, Notch 3; COL3A1, collagen type III α1 chain; CCDS, consensus coding sequence.

Sanger sequencing

Finally, Sanger sequencing verified each mutation (Fig. 3), which was followed by review of the literature in the context of each mutation to obtain the genetic diagnosis (8,21–23). The parents of certain patients were also studied through the use of Sanger sequencing, but the identified gene mutations were not detected in any of the parents (data not shown).

Figure 3.

Results of Sanger sequencing. Results for patients 1 to 10 are presented in graphs A-J, respectively. The first four patients were diagnosed as follows: Patient 1, Opitz G/BBB syndrome; patient 2, Loeys-Dietz syndrome; patient 3, Ritscher-Schinzel syndrome; and patient 4, CHARGE syndrome.

Discussion

CHD and CLP are characterized by anomalous anatomical structures, caused by abnormal development of the heart and large blood vessels in CHD (24), or abnormal fusion of the lip and palate during embryonic development in CLP (25). These diseases can severely affect neonatal health, thus representing a burden to families and the society (16). With the rapid development of genetic sequencing technology, a number of methods are considered to be important in identifying disease-associated genes, including Sanger sequencing, SNP array, CNV analysis, and targeted and whole exome sequencing.

In the current study, no pathogenic mutations were identified in CNVs analyzed by high-throughput SNP sequencing. Certain gene mutations were successfully identified in 10 patients (58.8%) via targeted NGS. According to the clinical phenotype of the patient and the mutation site of the candidate pathogenetic gene, 4 of these patients were diagnosed with a known genetic syndrome. To the best of our knowledge, it appears that the present study identified for the first time a mutation (c.G1477C, p.A723V) in the MID1 gene as a possible cause of ventricular septal defect and CL in an Opitz G/BBB syndrome patient. The MID1 gene is located on the short arm of the X chromosome, is approximately 300 kb, and includes 9 coding exons and multiple non-coding exons. In early embryonic development, the MID1 gene is highly expressed in the heart, facial region and central nervous system (26,27). In total, >90 different mutations of the MID1 gene have been reported in the literature, and point mutations in this gene have been suggested to cause Opitz G/BBB syndrome (18,21,28–31). The MID1 protein encoded by the MID1 gene is a ubiquitin ligase that interacts with the α4 protein, which is linked to the protein phosphatase PP2A and forms the complex MID1-α4-PP2A (27,32). This complex is closely associated with the development of the ventral midline; therefore, this is also the main reason for the abnormal development of the ventral midline structure caused by MID1 gene mutation (33).

LDS is characterized by vascular abnormalities (cerebral, thoracic, and abdominal arterial aneurysms and/or dissections), skeletal manifestations, craniofacial features (such as CP) and cutaneous findings (34). Approximately a third of LDS cases are caused by TGFBR1 mutation, while two thirds are caused by TGFBR2 mutation; the mutation site is mostly located in the serine-hydroxybutyrate enzyme activation coding region, located in the intracellular portion of the TGF-β receptor (35). The TGF-β type I receptor is necessary for the fusion of the upper lip and soft palate (36,37), and the TGFBR1 gene serves a major role in the development of the heart (22). In the present study, the TGFBR1 gene mutation was predicted to be ‘pathogenic’, ‘likely pathogenic’ and ‘pathogenic’ by the SIFT, PolyPhen-2 and Mutation Taster programs, respectively. It was also identified for the first time that mutation (c.T1400A, p.M467K) in the TGFBR1 gene was a possible cause of tetralogy of Fallot and CL in the LDS patient.

RSS is a clinically heterogeneous disorder characterized by distinctive craniofacial features (including CP) in addition to cerebellar and cardiac anomalies (8). To date, two articles (8,38) have been reported on cases of RSS caused by KIAA0196 gene mutation. Mutation (c.A2533G, p.T845A) in KIAA0196 gene was investigated in the present study, which is a novel candidate gene involved in heart development. The KIAA0196 gene is situated at 8q24.13 of chromosome 8, and the encoded protein of this gene is known as strumpellin, which is comprised of 1,159 amino acids and is highly conserved (8). This protein is ubiquitously expressed in multiple systems and is highly expressed in skeletal muscle. KIAA0196 mutations have been reported to cause hereditary spastic paraplegia (39), while a complex overlapping phenotype, particularly with CHD, has been rarely reported. In 2013, Elliott et al (8) detected KIAA0196 gene mutations in 8 patients with RSS/3C syndrome. The expression of strumpellin protein was also reduced by 60%, and the patients exhibited abnormal phenotype of heart development defects. In addition, previous studies have indicated that there are genes that cause cardiac abnormalities in the 8q24 interval, and suggested that the KIAA0196 gene is incorporated into the interval (8,40). These studies also suggested that the KIAA0196 gene may serve a role in the pathogenesis of cardiac developmental disorders.

CHARGE syndrome is a congenital condition comprising of choroid disease, heart disease, atresia choanae, retarded growth and development, genital hypoplasia, and ear anomalies and/or deafness; facial palsy, micrognathia, CP and swallowing difficulties are also common (41). In the present study, the CHD7 gene mutation (c.C4894T, p.R1632C) was predicted to be ‘pathogenic’ by both SIFT and Mutation Taster, while the PolyPhen-2 program predicted this mutation to be ‘benign’. To date, ~193 mutations of the CHD7 gene have been reported to lead to CHARGE syndrome (23,42). The CHD7 gene encodes the CHD7 protein, which serves a role in chromatin remodeling, cell cycle regulation, apoptosis regulation, transcriptional regulation and embryonic stem cell diversity (43). Studies have demonstrated that the CHD7 gene is expressed in a number of fetal tissues, including the fetal eye, ear, brain cells, olfactory bulb and heart tube, among others (19,43). The majority of mutations lead to the production of non-functional CHD7 protein, which may disrupt chromatin remodeling and gene expression. Regulation changes in CHD7 gene expression during embryonic development may lead to symptoms and signs of CHARGE syndrome (19).

The remaining 6 cases were not genetically diagnosed, although candidate genes were identified, including nephrocystin-3 (NPHP-3), proprotein convertase subtilisin/kexin type 5 (PCSK5), fibrillin 2 (FBN2), delta-like protein 1 (DLL1), Notch 3 (NOTCH3) and collagen type III α1 chain (COL3A1). The NPHP3 gene mutation (c.C1228A, p.Q410K) may impact the development of cilia tissue, while it has been reported that primary ciliary dyskinesia is associated with the development of CHD (44). In addition, the PCSK5 gene mutation (c.C5041G, p.P1681A) was predicted to be ‘pathogenic’, ‘likely pathogenic’ and ‘pathogenic’ by the SIFT, PolyPhen-2 and Mutation Taster tools, respectively. In mice, the PCSK5 gene causes VACTERL syndrome, which comprises of deformity in vertebral, anorectal, cardiac, tracheoesophageal, renal, limb and other systems (45). The FBN2 gene mutation (c.G6154A, p.E2052K) may cause congenital contractural arachnodactyly. The cardiovascular phenotype of this syndrome is milder and less common in comparison with that of Marfan syndrome, and the ascending aorta is also slightly dilated, which may be combined with other intracardiac malformations (46). Furthermore, the SIFT, PolyPhen-2 and Mutation Taster programs respectively predicted the DLL1 gene mutation (c.C1307T, p.S436L) to be ‘pathogenic’, ‘likely pathogenic’ and ‘pathogenic’. The protein encoded by the DLL1 gene is a ligand in the Notch signaling pathway, which mainly regulates the apoptosis of hematopoietic cells and signals between cells. The Notch signaling pathway serves an important role in embryonic differentiation and in homeostasis in adults, as well as in the development of various systems (47). Additionally, the protein encoded by the NOTCH3 gene, which was found to be affected by mutation (c. G515A, p. G172D) in the present study, is among the key proteins in the Notch signaling pathway. The disease caused by the mutation is an autosomal dominant arteriopathy associated with subcortical infarcts and leukoencephalopathy (48). Although CHD or CLP caused by mutations in the NOTCH3 gene has not been reported to date, the role of the Notch signaling pathway in the growth and development of various systems is widely recognized (47). The COL3A1 gene mutation (c.G1472A, p.R491Q) was predicted to be ‘likely pathogenic’ and ‘pathogenic’ by PolyPhen-2 and Mutation Taster, respectively, whereas the SIFT program predicted this mutation to be of ‘uncertain significance’. This gene mutation may cause Ehlers-Danlos syndrome and aortic aneurysm. According to review of the literature, it was noted that all of the mutation sites determined in the current study are novel mutation sites that have not been previously reported to the best of our knowledge. Samples obtained from the parents of certain patients were also examined by Sanger sequencing, however, these parents did not carry the identified genes mutations. The results should be further verified in an animal model, such as zebra fish or mouse.

When considering all forms of genetic sequencing technology, the advantages of targeted NGS are evident. Firstly, the amount of tedious and repetitive work for researchers is reduced, owing to the fact that this method can rapidly analyze large quantities of genetic information. NGS enables thousands of genes to be analyzed simultaneously, or a smaller subset of genes (a ‘mini-genome’ or disease-specific panel) to be examined in a single assay. However, the limitation of sample size and the possibility of leak detection of base point mutation exist in SNP array technology. Secondly, targeted NGS not only allows focusing on specific genes associated with pathological expression, but can also improve the coverage and expressive quality of exons due to its efficient enrichment. Large-scale parallel sequencing of a specifically selected part of the genome (for example, the exome or a specific set of genes relevant to a disease phenotype) leads to a higher sequencing coverage as compared with that of whole-genome sequencing (49). Furthermore, for a specific phenotype or disease, targeted sequencing has lower cost and is more rapid than whole exome sequencing, since this technology reduces the genetic discovery that may be irrelevant to the disease (49). In addition, targeted NGS may be more clinically useful in comparison with other sequencing techniques, owing to faster turnaround time (reduced sequencing volume and associated data analysis), higher and more reliable coverage, and the ability to avoid incidental findings. However, this method is associated with certain disadvantages including the limitation of requiring known virulence genes and its lack of suitability for a single sample.

Notably, the implementation of NGS in clinical practice has altered the way genetic counsellors and other clinicians approach genetic testing. Molecular diagnostics may now be performed at an early stage of disease, often enabling a broader set of therapeutic options and a lengthened window of opportunity to ameliorate disease progression (50). The identification of underlying genetic defects can also improve diagnosis of the disease prior to genetic counselling and enable prenatal testing.

In conclusion, using targeted NGS technology, the present study determined 10 individual mutations (58.8%) in candidate disease genes, which are possible causes of CHD and CLP in patients. The targeted NGS was demonstrated to be an effective and accurate method for providing a specific diagnosis of CHD and CLP, despite the presence of diverse phenotypes.

Acknowledgements

The authors would like to thank the State Key Laboratory of Medical Genetics of China (Changsha, China) for the technical assistance provided.

Funding

This study was supported by the Hunan Provincial Natural Science Foundation of China (grant no. 2015JJ4085) and the Scientific Research Foundation for the Returned Overseas Chinese Scholars, State Education Ministry (2014; grant no. 1685).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

HB and TZ conceived and designed the study, and drafted the manuscript. HB and LL collected the data. HB, TZ and SH were involved in data cleaning and verification. HB, TZ and ZT analyzed the data. All authors were involved in the final draft of the manuscript.

Ethics approval and consent to participate

The study protocol was approved by the Review Board at The Second Xiangya Hospital of Central South University (China), and the relatives of study subjects provided informed consent. All experiments were performed in accordance with relevant guidelines and regulations.

Patient consent for publication

Written informed consent was obtained from the their parent, guardian or next of kin for the publication of any associated data and accompanying images.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

CHD

congenital heart disease

CLP

cleft lip and palate

SNP

single nucleotide polymorphisms

CNVs

copy number variations

CL

cleft lip

CP

cleft palate

NGS

next-generation sequencing

PCR

polymerase chain reaction

LDS

Loeys-Dietz syndrome

RSS

Ritscher-Schinzel syndrome

References

1 

Liang CD, Huang SC and Lai JP: A survey of congenital heart disease in patients with oral clefts. Acta Paediatr Taiwan. 40:414–417. 1999.PubMed/NCBI

2 

Barbosa MM, Rocha CM, Katina T, Caldas M, Codorniz A and Medeiros C: Prevalence of congenital heart diseases in oral cleft patients. Pediatr Cardiol. 24:369–374. 2003. View Article : Google Scholar : PubMed/NCBI

3 

Bill J, Proff P, Bayerlein T, Weingaertner J, Fanghänel J and Reuther J: Treatment of patients with cleft lip, alveolus and palate-a short outline of history and current interdisciplinary treatment approaches. J Craniomaxillofac Surg. 34 (Suppl 2):S17–S21. 2006. View Article : Google Scholar

4 

Ho KS, South ST, Lortz A, Hensel CH, Sdano MR, Vanzo RJ, Martin MM, Peiffer A, Lambert CG, Calhoun A, et al: Chromosomal microarray testing identifies a 4p terminal region associated with seizures in Wolf-Hirschhorn syndrome. J Med Genet. 53:256–263. 2016. View Article : Google Scholar : PubMed/NCBI

5 

Biswas AB and Furniss F: Cognitive phenotype and psychiatric disorder in 22q11.2 deletion syndrome: A review. Res Dev Disabil. 53-54:242–257. 2016. View Article : Google Scholar : PubMed/NCBI

6 

Poelmans S, Kawamoto T, Cristofoli F, Politis C, Vermeesch J, Bailleul-Forestier I, Hens G, Devriendt K, Verdonck A and Carels C: Genotypic and phenotypic variation in six patients with solitary median maxillary central incisor syndrome. Am J Med Genet A. 167A:2451–2458. 2015. View Article : Google Scholar : PubMed/NCBI

7 

Abulezz TA: Cleft lip and palate: An experience of a developing center in egypt. J Craniofac Surg. 28:e731–e734. 2017. View Article : Google Scholar : PubMed/NCBI

8 

Elliott AM, Simard LR, Coghlan G, Chudley AE, Chodirker BN, Greenberg CR, Burch T, Ly V, Hatch GM and Zelinski T: A novel mutation in KIAA0196: Identification of a gene involved in Ritscher-Schinzel/3C syndrome in a First Nations cohort. J Med Genet. 50:819–822. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Tang M, Yang YF, Xie L, Chen JL, Zhang WZ, Wang J, Zhao TL, Yang JF and Tan ZP: Duplication of 10q22.3-q23.3 encompassing BMPR1A and NGR3 associated with congenital heart disease, microcephaly, and mild intellectual disability. Am J Med Genet A. 167A:3174–3179. 2015. View Article : Google Scholar : PubMed/NCBI

10 

Zeng H, Tang JG, Yang YF, Tan ZP and Tan JQ: A novel homozygous SACS mutation identified by whole-exome sequencing in a consanguineous family with autosomal recessive spastic ataxia of charlevoix-saguenay. Cytogenet Genome Res. 152:16–21. 2017. View Article : Google Scholar : PubMed/NCBI

11 

Guo T, Tan ZP, Chen HM, Zheng DY, Liu L, Huang XG, Chen P, Luo H and Yang YF: An effective combination of whole-exome sequencing and runs of homozygosity for the diagnosis of primary ciliary dyskinesia in consanguineous families. Sci Rep. 7:79052017. View Article : Google Scholar : PubMed/NCBI

12 

Koestenberger M: Transthoracic echocardiography in children and young adults with congenital heart disease. ISRN Pediatr. 2012:7534812012. View Article : Google Scholar : PubMed/NCBI

13 

Allori AC, Mulliken JB, Meara JG, Shusterman S and Marcus JR: Classification of Cleft Lip/Palate: Then and now. Cleft Palate Craniofac J. 54:175–188. 2017. View Article : Google Scholar : PubMed/NCBI

14 

Gatti GL, Freda N, Giacomina A, Montemagni M and Sisti A: Cleft lip and palate repair. J Craniofac Surg. 28:1918–1924. 2017. View Article : Google Scholar : PubMed/NCBI

15 

Hu S, Yang Y, Liu L, Tan Z and Zhao T: High-resolution single nucleotide polymorphism arrays identified an atypical microdeletion of the Williams-Beuren syndrome interval in a patient presenting with a different phenotype. Mol Med Rep. 15:2709–2712. 2017. View Article : Google Scholar : PubMed/NCBI

16 

Liu L, Bu H, Yang Y, Tan Z, Zhang F, Hu S and Zhao T: A targeted, next-generation genetic sequencing study on tetralogy of fallot, combined with cleft lip and palate. J Craniofac Surg. 28:e351–e355. 2017. View Article : Google Scholar : PubMed/NCBI

17 

Chen JL, Zhu X, Zhao TL, Wang J, Yang YF and Tan ZP: Rare copy number variations containing genes involved in RASopathies: Deletion of SHOC2 and duplication of PTPN11. Mol Cytogenet. 7:282014. View Article : Google Scholar : PubMed/NCBI

18 

Hu CH, Liu YF, Yu JS, Ng YY, Chen SJ, Su PH and Chen JY: A MID1 gene mutation in a patient with Opitz G/BBB syndrome that altered the 3D structure of SPRY domain. Am J Med Genet A. 158A:726–731. 2012. View Article : Google Scholar : PubMed/NCBI

19 

Jongmans MC, Admiraal RJ, van der Donk KP, Vissers LE, Baas AF, Kapusta L, van Hagen JM, Donnai D, de Ravel TJ, Veltman JA, et al: CHARGE syndrome: The phenotypic spectrum of mutations in the CHD7 gene. J Med Genet. 43:306–314. 2006. View Article : Google Scholar : PubMed/NCBI

20 

Tan ZP, Xie L, Deng Y, Chen JL, Zhang WZ, Wang J, Yang JF and Yang YF: Whole-exome sequencing identifies Y1495X of SCN5A to be associated with familial conduction disease and sudden death. Sci Rep. 4:56162014. View Article : Google Scholar : PubMed/NCBI

21 

Zhang X, Chen Y, Zhao S, Markljung E and Nordenskjöld A: Hypospadias associated with hypertelorism, the mildest phenotype of Opitz syndrome. J Hum Genet. 56:348–351. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Muramatsu Y, Kosho T, Magota M, Yokotsuka T, Ito M, Yasuda A, Kito O, Suzuki C, Nagata Y, Kawai S, et al: Progressive aortic root and pulmonary artery aneurysms in a neonate with Loeys-Dietz syndrome type 1B. Am J Med Genet A. 152A:417–421. 2010. View Article : Google Scholar : PubMed/NCBI

23 

Husu E, Hove HD, Farholt S, Bille M, Tranebjærg L, Vogel I and Kreiborg S: Phenotype in 18 Danish subjects with genetically verified CHARGE syndrome. Clin Genet. 83:125–134. 2013. View Article : Google Scholar : PubMed/NCBI

24 

Srivastava D: HAND proteins: Molecular mediators of cardiac development and congenital heart disease. Trends Cardiovasc Med. 9:11–18. 1999. View Article : Google Scholar : PubMed/NCBI

25 

Sisti A and Oranges CM: Evidence-based medicine: Unilateral cleft lip and nose repair. Plast Reconstr Surg. 136:118e–119e. 2015. View Article : Google Scholar : PubMed/NCBI

26 

Pinson L, Augé J, Audollent S, Mattéi G, Etchevers H, Gigarel N, Razavi F, Lacombe D, Odent S, Le Merrer M, et al: Embryonic expression of the human MID1 gene and its mutations in Opitz syndrome. J Med Genet. 41:381–386. 2004. View Article : Google Scholar : PubMed/NCBI

27 

Short KM, Hopwood B, Yi Z and Cox TC: MID1 and MID2 homo- and heterodimerise to tether the rapamycin-sensitive PP2A regulatory subunit, alpha 4, to microtubules: Implications for the clinical variability of X-linked Opitz GBBB syndrome and other developmental disorders. BMC Cell Biol. 3:12002. View Article : Google Scholar : PubMed/NCBI

28 

Hüning I, Kutsche K, Rajaei S, Erlandsson A, Lovmar L, Rundberg J and Stefanova M: Exon 2 duplication of the MID1 gene in a patient with a mild phenotype of Opitz G/BBB syndrome. Eur J Med Genet. 56:188–191. 2013. View Article : Google Scholar : PubMed/NCBI

29 

Migliore C, Athanasakis E, Dahoun S, Wonkam A, Lees M, Calabrese O, Connell F, Lynch SA, Izzi C, Pompilii E, et al: Complex rearrangement of the exon 6 genomic region among Opitz G/BBB syndrome MID1 alterations. Eur J Med Genet. 56:404–410. 2013. View Article : Google Scholar : PubMed/NCBI

30 

Preiksaitiene E, Krasovskaja N, Utkus A, Kasnauskiene J, Meskiene R, Paulauskiene I, Valeviciene NR and Kucinskas V: R368X mutation in MID1 among recurrent mutations in patients with X-linked Opitz G/BBB syndrome. Clin Dysmorphol. 24:7–12. 2015. View Article : Google Scholar : PubMed/NCBI

31 

Ji X, Xing Y, Xu Y, Liu Y, Chen Y, Tao J and Xiao B: A novel mutation in MID1 in a patient with X-linked Opitz G/BBB syndrome. Gene. 537:140–142. 2014. View Article : Google Scholar : PubMed/NCBI

32 

Van den Veyver IB, Cormier TA, Jurecic V, Baldini A and Zoghbi HY: Characterization and physical mapping in human and mouse of a novel RING finger gene in Xp22. Genomics. 51:251–261. 1998. View Article : Google Scholar : PubMed/NCBI

33 

Schweiger S and Schneider R: The MID1/PP2A complex: A key to the pathogenesis of Opitz BBB/G syndrome. Bioessays. 25:356–366. 2003. View Article : Google Scholar : PubMed/NCBI

34 

Van Laer L, Dietz H and Loeys B: Loeys-Dietz syndrome. Adv Exp Med Biol. 802:95–105. 2014. View Article : Google Scholar : PubMed/NCBI

35 

Loeys BL, Schwarze U, Holm T, Callewaert BL, Thomas GH, Pannu H, De Backer JF, Oswald GL, Symoens S, Manouvrier S, et al: Aneurysm syndromes caused by mutations in the TGF-beta receptor. N Engl J Med. 355:788–798. 2006. View Article : Google Scholar : PubMed/NCBI

36 

Dudas M, Kim J, Li WY, Nagy A, Larsson J, Karlsson S, Chai Y and Kaartinen V: Epithelial and ectomesenchymal role of the type I TGF-beta receptor ALK5 during facial morphogenesis and palatal fusion. Dev Biol. 296:298–314. 2006. View Article : Google Scholar : PubMed/NCBI

37 

Li WY, Dudas M and Kaartinen V: Signaling through Tgf-beta type I receptor Alk5 is required for upper lip fusion. Mech Dev. 125:874–882. 2008. View Article : Google Scholar : PubMed/NCBI

38 

Valdmanis PN, Meijer IA, Reynolds A, Lei A, MacLeod P, Schlesinger D, Zatz M, Reid E, Dion PA, Drapeau P and Rouleau GA: Mutations in the KIAA0196 gene at the SPG8 locus cause hereditary spastic paraplegia. Am J Hum Genet. 80:152–161. 2007. View Article : Google Scholar : PubMed/NCBI

39 

Jahic A, Kreuz F, Zacher P, Fiedler J, Bier A, Reif S, Rieger M, Krüger S, Beetz C and Plaschke J: A novel strumpellin mutation and potential pitfalls in the molecular diagnosis of hereditary spastic paraplegia type SPG8. J Neurol Sci. 347:372–374. 2014. View Article : Google Scholar : PubMed/NCBI

40 

Dauber A, Golzio C, Guenot C, Jodelka FM, Kibaek M, Kjaergaard S, Leheup B, Martinet D, Nowaczyk MJ, Rosenfeld JA, et al: SCRIB and PUF60 are primary drivers of the multisystemic phenotypes of the 8q24.3 copy-number variant. Am J Hum Genet. 93:798–811. 2013. View Article : Google Scholar : PubMed/NCBI

41 

Pagon RA, Graham JM Jr, Zonana J and Yong SL: Coloboma, congenital heart disease, and choanal atresia with multiple anomalies: CHARGE association. J Pediatr. 99:223–227. 1981. View Article : Google Scholar : PubMed/NCBI

42 

Cho HJ, Song MH, Choi SY, Kim J, Lee J, Kim UK, Bok J and Choi JY: Genetic analysis of the CHD7 gene in Korean patients with CHARGE syndrome. Gene. 517:164–168. 2013. View Article : Google Scholar : PubMed/NCBI

43 

Zentner GE, Layman WS, Martin DM and Scacheri PC: Molecular and phenotypic aspects of CHD7 mutation in CHARGE syndrome. Am J Med Genet A. 152A:674–686. 2010. View Article : Google Scholar : PubMed/NCBI

44 

Picard C, McCarl CA, Papolos A, Khalil S, Lüthy K, Hivroz C, LeDeist F, Rieux-Laucat F, Rechavi G, Rao A, et al: STIM1 mutation associated with a syndrome of immunodeficiency and autoimmunity. N Engl J Med. 360:1971–1980. 2009. View Article : Google Scholar : PubMed/NCBI

45 

Szumska D, Pieles G, Essalmani R, Bilski M, Mesnard D, Kaur K, Franklyn A, El Omari K, Jefferis J, Bentham J, et al: VACTERL/caudal regression/Currarino syndrome-like malformations in mice with mutation in the proprotein convertase Pcsk5. Genes Dev. 22:1465–1477. 2008. View Article : Google Scholar : PubMed/NCBI

46 

Ramos Arroyo MA, Weaver DD and Beals RK: Congenital contractural arachnodactyly. Report of four additional families and review of literature. Clin Genet. 27:570–581. 1985. View Article : Google Scholar : PubMed/NCBI

47 

Chiba S: Notch signaling in stem cell systems. Stem Cells. 24:2437–2447. 2006. View Article : Google Scholar : PubMed/NCBI

48 

Di Donato I, Bianchi S, De Stefano N, Dichgans M, Dotti MT, Duering M, Jouvent E, Korczyn AD, Lesnik-Oberstein SA, Malandrini A, et al: Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) as a model of small vessel disease: Update on clinical, diagnostic, and management aspects. BMC Med. 15:412017. View Article : Google Scholar : PubMed/NCBI

49 

Nijman IJ, Mokry M, van Boxtel R, Toonen P, de Bruijn E and Cuppen E: Mutation discovery by targeted genomic enrichment of multiplexed barcoded samples. Nat Methods. 7:913–915. 2010. View Article : Google Scholar : PubMed/NCBI

50 

Pei Y and Watnick T: Diagnosis and screening of autosomal dominant polycystic kidney disease. Adv Chronic Kidney Dis. 17:140–152. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Bu H, Liu L, Hu S, Tan Z and Zhao T: Targeted next‑generation sequencing for research and diagnostics in congenital heart disease, and cleft lip and/or palate. Mol Med Rep 19: 3831-3840, 2019.
APA
Bu, H., Liu, L., Hu, S., Tan, Z., & Zhao, T. (2019). Targeted next‑generation sequencing for research and diagnostics in congenital heart disease, and cleft lip and/or palate. Molecular Medicine Reports, 19, 3831-3840. https://doi.org/10.3892/mmr.2019.10043
MLA
Bu, H., Liu, L., Hu, S., Tan, Z., Zhao, T."Targeted next‑generation sequencing for research and diagnostics in congenital heart disease, and cleft lip and/or palate". Molecular Medicine Reports 19.5 (2019): 3831-3840.
Chicago
Bu, H., Liu, L., Hu, S., Tan, Z., Zhao, T."Targeted next‑generation sequencing for research and diagnostics in congenital heart disease, and cleft lip and/or palate". Molecular Medicine Reports 19, no. 5 (2019): 3831-3840. https://doi.org/10.3892/mmr.2019.10043
Copy and paste a formatted citation
x
Spandidos Publications style
Bu H, Liu L, Hu S, Tan Z and Zhao T: Targeted next‑generation sequencing for research and diagnostics in congenital heart disease, and cleft lip and/or palate. Mol Med Rep 19: 3831-3840, 2019.
APA
Bu, H., Liu, L., Hu, S., Tan, Z., & Zhao, T. (2019). Targeted next‑generation sequencing for research and diagnostics in congenital heart disease, and cleft lip and/or palate. Molecular Medicine Reports, 19, 3831-3840. https://doi.org/10.3892/mmr.2019.10043
MLA
Bu, H., Liu, L., Hu, S., Tan, Z., Zhao, T."Targeted next‑generation sequencing for research and diagnostics in congenital heart disease, and cleft lip and/or palate". Molecular Medicine Reports 19.5 (2019): 3831-3840.
Chicago
Bu, H., Liu, L., Hu, S., Tan, Z., Zhao, T."Targeted next‑generation sequencing for research and diagnostics in congenital heart disease, and cleft lip and/or palate". Molecular Medicine Reports 19, no. 5 (2019): 3831-3840. https://doi.org/10.3892/mmr.2019.10043
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team