Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
October-2019 Volume 20 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2019 Volume 20 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Identification of key miRNA‑mRNA pairs in septic mice by bioinformatics analysis

  • Authors:
    • Jianxin Chen
    • Min Lin
    • Sen Zhang
  • View Affiliations / Copyright

    Affiliations: Department of Colorectal Surgery, The First Affiliated Hospital of Guangxi Medical University, Nanning, Guangxi 530021, P.R. China, School of Information Engineering, Putian University, Putian, Fujian 351100, P.R. China
    Copyright: © Chen et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 3858-3866
    |
    Published online on: August 20, 2019
       https://doi.org/10.3892/mmr.2019.10594
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Sepsis is one of the most common causes of death among critically ill patients in intensive care units worldwide; however, the microRNAs (miRNAs/miRs) involved in the sepsis process (and their target genes) are largely unknown. The present study integrated miRNA and mRNA datasets to elucidate key sepsis‑related miRNA‑mRNA pairs. The datasets, GSE74952 and GSE55238 were downloaded from the Gene Expression Omnibus. By performing bioinformatics analysis such as GEO2R, miRNA target gene prediction, Gene Ontology analysis, Kyoto Encyclopedia of Genes and Genomes pathway analysis and miRNA‑mRNA network analysis, a total of four sepsis‑related miRNA‑mRNA pairs were successfully obtained. Mmu‑miR‑370‑3p, cluster of differentiation (CD)8a, CD247, Zap70 and inhibitor of nuclear factor κ B kinase subunit β (Ikbkb) were identified as the components involved in these pairs, and these genes were enriched in the T‑cell receptor signaling pathway. Finally, reverse transcription‑quantitative PCR results validated that the expression levels of the four genes (CD8a, CD247, Zap70 and Ikbkb) in the sepsis model mice were consistent with the microarray analysis. In conclusion, the present study identified four sepsis‑related miRNA‑mRNA pairs using bioinformatics analysis. These results indicated that the candidate miRNA‑mRNA pairs may be involved in the regulation of immunity in sepsis, which may in turn act as indicators or therapeutic targets for sepsis.

Introduction

Sepsis is defined as a life-threatening organ dysfunction caused by a dysregulated host response to an infection (1). Sepsis is particularly lethal as it often follows a linear continuum from systemic inflammatory response syndrome through to septic shock and organ function failure (2–4). Despite advancements in antibiotic therapy, immunotherapy and resuscitative strategies, sepsis remains the leading cause of death in intensive care units (5).

In the pathophysiological process of sepsis, certain gene expression levels markedly change in vivo and contribute to the outcome of the disease (6,7). Gene microarray or gene profiling are molecular detection techniques that have been used for a number of years. Gene microarray analysis can quickly detect gene expression levels at various time-points, which is particularly effective for the screening of differentially expressed genes (DEGs).

MicroRNAs (miRNAs/miRs) are a group of small non-coding RNAs that regulate gene expression at the post-transcriptional level and serve as key regulators in the progression of many types of disease (8,9). To investigate the roles of miRNAs and their target genes in sepsis, Chen et al (10) detected the altered expression of specific miRNAs and their target genes in patients with sepsis, and identified specific miRNA and target genes involved in the activation of immune and inflammatory responses. In addition, previous studies have also indicated that the expression level of miRNA was correlated with the mortality of sepsis patients and certain miRNAs in the blood can be used to predict the prognosis of sepsis (11,12). The aim of the present study was to obtain key sepsis-related miRNA-mRNA pairs in mice by analyzing mRNA and miRNA microarray datasets, in order to provide molecular targets for diagnostic or therapeutic strategies.

Materials and methods

Microarray data

The sepsis and control group blood gene expression profiles GSE74952 and GSE55238 in mice were downloaded from the Gene Expression Omnibus (GEO) database of the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov/geo). The microarray data of GSE74952 was based on GPL21136 Platforms (Multiplex Circulating miRNA Assay) and the miRNA profiles of 5 sepsis samples and four control samples were obtained. These 5 sepsis samples were obtained from septic mice models that were created by cecal ligation and puncture (CLP). The microarray data of GSE55238 was based on GPL1261 Platforms (Affymetrix Mouse Genome 430 2.0 Array) and the mRNAs profile of 4 sepsis samples and 4 control samples were obtained. These 4 sepsis samples were also obtained from CLP septic mice models. The present study chose these 4 sepsis samples as Day 1, which was the same time-point used in GSE74952. GSE74952 was conducted at the Massachusetts General Hospital, Charlestown, USA; GSE55238 was conducted at the University of Florida, Gainesvile, USA.

Data preprocessing and screening strategy

A multi-step strategy (Fig. 1) was used to identify genes dysregulated in the sepsis model mice relative to the control group. First, GEO2R was applied to identify the differentially expressed miRNAs and mRNAs between sepsis and control samples. GEO2R (www.ncbi.nlm.nih.gov/geo/geo2r/) is an interactive web tool that is widely applied to detect DEGs by comparing two groups of samples in a GEO series (11). An adjusted P<0.05 and |log2 fold-change (FC)| >1 were set as the cut-off criteria.

Figure 1.

The multi-step strategy used in the present study. GO, gene ontology; miRNA, microRNA.

Second, the TargetScan database (version 7.2; www.targetscan.org/mmu-72/) was used to predict the target genes of dysregulated miRNAs and the overlap between the negatively correlated target genes and differentially expressed mRNAs was established. Gene sets data was processed using VENNY 2.1 software (bioinfogp.cnb.csic.es/tools/venny/index.html).

Third, these interacting genes were classified according to Gene Ontology (GO; http://geneontology.org/) and Kyoto Encyclopedia of Genes and Genomes (KEGG; www.genome.jp/kegg) (13) pathways using Database for Annotation, Visualization and Integration Discovery (DAVID) software (david.ncifcrf.gov/). Based on the enriched GO terms and significant KEGG pathways, the sepsis-related mRNAs were screened.

Finally, Cytoscape software (version 3.6.0; http://cytoscape.org/) was used to construct a miRNA-mRNA network. Based on the sepsis-related mRNAs, the sepsis-related miRNA-mRNA pairs were obtained.

Validation by reverse transcription-quantitative (RT-q)PCR in mouse sepsis models

A total of 12 C57BL/6 male mice (aged ~8-10 weeks, weighing 20–25 g) were purchased from the Experimental Animal Center of Guangxi Medical University. All mice were housed in specific pathogen-free facilities and acclimated for 1 week before the operation. Mice were maintained at 22°C with 55% humidity under a 12:12-h light/dark cycle for 1 week, with access to food and water ad libitum. A total of 6 mice were employed to establish the sepsis model using the CLP procedure according to a previously reported method (12). The remaining 6 mice were sham-operated to produce the control group; control mice underwent the same procedure as the sepsis model mice but without ligation and puncture of the cecum. All operation procedures were under sterile conditions. After 1 day, ~1 ml blood was collected from the hearts of the mice. Red blood cells were lysed using BD Pharm Lyse™ lysing buffer (Becton, Dickinson and Company). Total RNA was extracted using RNAiso Plus (Takara Bio, Inc.) and then reverse transcribed into cDNA using PrimeScript™ RT reagent kit with gDNA Eraser (Takara Bio, Inc.) at 42°C for 2 min, 37°C for 15 min and 85°C for 5 sec according to the manufacturer's protocol. qPCR was conducted using the SYBR Premix Ex Taq™ II (Takara Bio, Inc.) according to the manufacturer's protocol. The PCR primers were designed by the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov/) and provided by Sangon Biotech Co., Ltd., (Table I). GAPDH was selected as the internal reference for the genes. RT-qPCR thermocycling conditions included: Pre-denaturation step at 95°C for 30 sec, followed by 40 cycles of denaturing at 95°C for 5 sec and extension at 60°C for 34 sec (Applied Biosystems 7500 Real Time PCR System); each sample was performed in triplicate. Relative expression values were calculated using the 2−∆∆Cq method (14). The present study was approved by the Animal Care Committee of Guangxi Medical University (approval no. 201904001).

Table I.

Primer sequences for reverse transcription-quantitative PCR.

Table I.

Primer sequences for reverse transcription-quantitative PCR.

GeneForward primer (5′-3′)Reverse primer (5′-3′)
CD8a TTCTGTCGTGCCAGTCCTTC TGGGACATTTGCAAACACGC
CD247 ATGGGTATTGACTCGCTCCG CAGGCTTCACCACTGAAATAAG
Zap70 ATCATGGCTTATGGCCGTGT CATGCACTCCCGGGTTAGAG
Ikbkb CCCACCCCTCCTCTCCTTAC TTCATACTGCCTCTGCGGTG
GAPDH CCCTTAAGAGGGATGCTGCC ACTGTGCCGTTGAATTTGCC

[i] CD, cluster of differentiation.

Statistical analysis

Data were analyzed using SPSS version 17.0 (SPSS, Inc.). Continuous variables are presented as the mean ± standard deviation. A Student's t-test was applied for comparisons between two groups. If the variance was not equal between two groups, a Mann-Whitney U test was used for statistical analysis. P<0.05 was considered to indicate a statistically significant difference. In addition to P-value, the false discovery rate value was also used to rank the significance of the pathways.

Results

Identification of differentially expressed miRNAs and mRNAs in sepsis model mice

The gene expression levels of miRNAs and mRNAs were download from the GEO database, respectively. Based on GEO2R analysis, a total of 63 differentially expressed miRNAs and a total of 21,765 differentially expressed mRNAs were identified in septic mice compared with the control samples. There were 7,508 upregulated and 14,257 downregulated mRNAs in the GSE55238 dataset (Fig. 2A), and 44 up- and 19 downregulated miRNAs in the GSE74952 dataset (Fig. 2B). Screened with the cut-off criteria of adjusted P<0.05 and |log2 FC| >1, 10 differentially expressed miRNAs (Table II) and 3,724 differentially expressed mRNAs were identified in sepsis model mice compared with the control mice. These candidate targets included 10 upregulated miRNAs and 3,293 up- and 431 downregulated mRNAs.

Figure 2.

Two volcano plots of two GEO datasets and two Venn diagrams from the DEG screening. (A) The volcano plots of the mRNA and (B) miRNA datasets. (C) The intersecting mRNAs between the predicted target mRNAs and differentially expressed mRNAs. (D) The overlap between the intersecting mRNAs and the negatively correlated mRNAs. GEO, Gene Expression Omnibus; DEG, differentially expressed gene; miRNA, microRNA.

Table II.

Significantly dysregulated miRNAs when comparing sepsis and control mice.

Table II.

Significantly dysregulated miRNAs when comparing sepsis and control mice.

miRNAAdjust P-valueLogFCDifferential expression
miR-155-5p<0.0012.911Upregulated
miR-146a-5p0.0042.527Upregulated
miR-21-5p<0.0012.337Upregulated
miR-370-3p0.0012.234Upregulated
miR-28-5p0.0012.231Upregulated
miR-590-5p0.0111.879Upregulated
miR-29a-3p0.0111.855Upregulated
miR-19a-3p<0.0011.731Upregulated
miR-103a-3p0.0311.349Upregulated
let-7i-5p0.0311.049Upregulated

[i] miRNAs/miRs, microRNAs.

miRNA target gene prediction

Target mRNAs for differentially expressed miRNAs were predicted using the TargetScan database. A total of 7,043 target genes were successfully predicted in 6 miRNAs, including mmu-miR-155-5p, mmu-miR-146a-5p, mmu-miR-370-3p, mmu-miR-29a-3p, mmu-miR-19a-3p and mmu-let-7i-5p.

Selection of disease-associated miRNA-mRNA pairs

A total of 1,510 intersecting mRNAs between the predicted target mRNAs and differentially expressed mRNAs were selected (Fig. 2C), of which 126 mRNAs that were negatively correlated with their predicted miRNAs matches were selected (Fig. 2D). Based on differentially expressed miRNAs and their negatively correlated mRNAs, a total of 147 miRNA-mRNA pairs were predicted.

Selected mRNA ontology analysis in sepsis model mice

The functional enrichment of 126 candidate DEGs were analyzed using DAVID (david.ncifcrf.gov/; Table III). A total of three GO category results are presented including biological processes, cellular components and molecular functions. The biological process results revealed that the selected DEGs were mainly enriched in ‘cellular response to cAMP’, ‘actin cytoskeleton organization’ and ‘calcium ion regulated exocytosis’ (Fig. 3A). The cellular component results revealed that selected DEGs were mainly enriched in ‘cytoplasm’, ‘membrane’ and ‘membrane raft’ (Fig. 3B). The molecular function analysis revealed that the selected DEGs mainly enriched in ‘protein binding’, ‘phospholipid binding’ and ‘actin binding’ (Fig. 3C). These results demonstrated that the majority of the selected DEGs were enriched in ‘binding’ and ‘cell signaling’.

Figure 3.

Top 5 results of GO enrichment and KEGG pathway analysis. (A) Biological processes, (B) Cellular components and (C) Molecular functions. (D) KEGG pathway analysis. GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genome.

Table III.

The 126 negatively correlated intersecting genes with their predicted miRNAs.

Table III.

The 126 negatively correlated intersecting genes with their predicted miRNAs.

StyleGenes name
DownregulatedRnf123, Boc, Sox10, Ebf1, 1700019N19Rik, Zdhhc7, Cbfa2t2, Cblc, Gjc1, Pip5k1b, Grid1, Cacna1e, Arhgap17, Hip1r, Wnt2b, Fbln5, Cend1, Cd8a, Samd11, Trp53i11, Haao, Phxr4, Aanat, Ralgps2, Gulp1, P2rx3, Mlxipl, Hapln4, Naa40, Kcnk5, Ptgis, Fkbp8, Cgnl1, Dusp9, Fads1, R3hdm4, Apobec2, Clip4, Spsb1, Tet3, Arhgef18, Ikbkb, Myo1e, Specc1, Npepl1, Capn8, Polg, Klhl17, Nr5a1, 6330408A02Rik, Stx1a, Kmt2a, Il5ra, Wnt7a, Lurap1, Brat1, Marf1, Lynx1, Pde11a, H2-Eb2, Dcun1d2, Rnf165, Gpr50, Wnt2, Slc4a1, Ctnnd1, Wsb2, Zfp882, Dgcr6, Faim2, Synpo2l, Fam222a, Hmg20a, Mark4, Bmp1, Bgn, Efna4, Unc45a, Ccr6, Bcl2, Tgif2, Cmtr2, Smtnl2, Slc8a1, Asphd2, Tmem86b, Eef2k, Ermp1, Ucp2, Adal, Snrnp70, Sumo3, Fam193a, 2-Mar, Atp9a, Dmtn, Dtnb, Gorasp1, Vps13a, Kynu, Usp15, Ank1, Pmf1, Slc2a8, Snap47, Cers4, Serpinh1, Mpp3, Plk2, Zap70, Igfbp5, Cd247, Akap4, Trappc12, Prrt4, Enpp2, Slc6a2, Ehd2, Wasf3, Psd, Rapgef4, Usp14, Slc26a7, Sgip1, Kl, Adipor1

[i] miRNAs, microRNAs.

Signaling pathway enrichment analysis

The signaling pathway enrichment of 126 candidate DEGs were analyzed using KEGG pathway online databases. The selected DEGs were significantly enriched in ‘T-cell receptor signaling pathway’, ‘tryptophan metabolism’ and ‘proteoglycans in cancer’ (Fig. 3D). Based on a previous study (15), the T-cell receptor signaling pathway is an important signaling pathway associated with sepsis. In the present study, 4 sepsis-related mRNAs were found in this pathway including CD8a, CD247, Zap70 and inhibitor of nuclear factor κ B kinase subunit β (Ikbkb; Table IV; Fig. 4).

Figure 4.

T-cell receptor signaling pathway. Red regions represent the location of four sepsis-related mRNAs. Pathway map from the Kyoto Encyclopedia of Genes and Genomes published with permission from the copyright owner (13).

Table IV.

The top 5 signaling pathways of differentially expressed genes.

Table IV.

The top 5 signaling pathways of differentially expressed genes.

KEGG pathwayNameCountP-valueFDRGenes
mmu04660T-cell receptor signaling pathway40.02222.085CD8a, CD247, Zap70, Ikbkb
mmu00380Tryptophan metabolism30.03230.270Kynu, Haao, Aanat
mmu05205Proteoglycans in cancer50.03230.696Wnt2, Cblc, Ank1, Wnt7a, Wnt2b
mmu05217Basal cell carcinoma30.04137.321Wnt2, Wnt7a, Wnt2b
mmu04550Signaling pathways regulating pluripotency of stem cells40.04942.819Wnt2, Dusp9, Wnt7a, Wnt2b

[i] KEGG, Kyoto Encyclopedia of Genes and Genomes; FDR, false discovery rate; CD, cluster of differentiation.

miRNA-mRNA network construction

A total of 126 candidate mRNAs and 6 miRNAs were analyzed using Cytoscape software. A total of 147 miRNA-mRNA pairs were presented in the network. Based on this, 4 sepsis-related mRNAs and 4 sepsis-related miRNA-mRNA pairs were obtained (Fig. 5).

Figure 5.

miRNA-mRNA-network. Diamonds represent miRNAs; circles represent mRNA; red nodes and edges represent sepsis-related miRNA-mRNA pairs. miRNA, microRNA.

RT-qPCR validation

To confirm the reliability of the findings from the bioinformatics microarray analysis, 4 mRNAs [cluster of differentiation (CD)8a, CD247, Zap70 and Ikbkb] were selected for validation by RT-qPCR in 6 pairs of matched sepsis and control C57BL/6 mice. According to the experimental results, the relative expression levels were similar between microarray and RT-qPCR experiments. In sepsis model mice, the expression level of CD8a, CD247, Zap70 and Ikbkb were significantly downregulated (P<0.05; Fig. 6).

Figure 6.

Validation by reverse transcription-quantitative PCR of the 4 selected mRNAs. Control indicates sham group samples. Sepsis indicates samples of CLP group. *P<0.05 and **P<0.01 vs. the control. CLP, cecal ligation and puncture; CD, cluster of differentiation.

Discussion

Numerous studies have been performed to reveal the underlying mechanisms of sepsis formation and progression in the past several decades; however, the mortality rates of sepsis are still very high worldwide (3,5). The majority of previous studies have indicated that the high mortality of sepsis is correlated with immune dysfunction, which may be due to T-cell dysfunction (16,17). However, which molecules change and how they interact during sepsis are still unclear. The present study integrated two datasets including miRNA and mRNA microarrays from different groups, using bioinformatics methods to analyze data. Through DEG screening, miRNA gene target prediction, GO terms and KEGG pathway analysis, 1 sepsis-related miRNA and 4 sepsis-related mRNAs including mmu-miR-370-3p, CD8a, CD247, Zap70 and Ikbkb were obtained, of which mmu-miR-370 was upregulated and the others were downregulated. Subsequent RT-qPCR analysis validated this finding. Through the construction of the miRNA-mRNA network, 4 sepsis-related miRNA-mRNA pairs were identified.

A septic event triggers high levels apoptosis in immune cells such as T-cells, resulting in suppressed immune functions, often inducing an increased susceptibility to secondary infections (5,15,18,19). The CLP mouse model of sepsis is considered the gold standard in experimental sepsis research. However, sepsis induction varies among different research groups, making it a challenge to compare data among different studies. Despite the variation in sepsis induction, the majority of studies have demonstrated that sepsis leads to a significant decrease in immune factors. For instance, Condotta et al (20) demonstrated that polymicrobial sepsis exacerbated CD8+ T-cell exhaustion and reduced interferon-γ production. In addition, Hotchkiss et al (21) indicated that there is a significant loss of B and CD4 T-cells in sepsis, which may contribute to immunosuppression.

In the pathological progression of sepsis, the host response is disturbed by excessive inflammation and immune suppression, and fails to return to normal homeostasis (22). The T-cell receptor signaling pathway is an important pathway involved in immune responses. Previous studies have suggested that the impairment of the T-cell receptor signaling pathway was one of important factors for immunosuppression in sepsis (23,24).

Based on KEGG pathway analysis, the hub genes including CD8a, CD247, Zap70 and Ikbkb were enriched in the T-cell receptor signaling pathway. These genes play an important role in immunity to fight against foreign pathogens. CD8a encodes the CD8α chain of the dimeric CD8 protein. CD8 is a coreceptor for the T-cell receptor (TCR)-mediated recognition of major histocompatibility complex class I, which involved cytotoxic T lymphocyte activation and target cell lysis (25). Therefore, CD8+ T-cells play an important role in the control and eradication of invading pathogens (26). CD8 deficiency increases susceptibility to infection (27). Harland et al (28) revealed that CpG methylation of the CD8a locus has a potential role in the downregulation of CD8. However, whether this epigenetic modification is involved in the process of sepsis is still unclear. CD247 (also known as CD3z) is a part of the TCR complex, which plays a key role in receptor expression and signaling associated to T-cell functions (29,30). Eldor et al (31) reported that CD247 downregulation is associated with immunosuppression in T-cells and was correlated with disease progression and severity in patients with type 2 diabetes. Zap70 was enriched in the TCR signaling pathway. The functional deletion of Zap70 can lead to a serious immunodeficiency (32). In these patients, T-cells are inadequately supervised by the thymus microenvironment, exhibit decreased apoptosis and cannot differentiate into Th2 T-cells (33). Huang et al (34) reported that the downregulation of Zap70 accelerated disease progression of neonatal sepsis. IKBKB encodes IKB kinase 2 (also known as IKKβ /IKK2), a component of the nuclear factor-κB signaling pathway. IKKβ can phosphorylate and degrade the inhibitors of κB, and then improve target gene transcription (35,36). A number of studies have indicated that a mutation in IKBKB can lead to a lack of IKKβ and IKKβ deficiency leads to an inadequate response to stimuli in immune cells, finally resulting in immune impairment (37,38).

In the present study, using mRNA and miRNA microarray datasets and bioinformatics analysis, 4 sepsis-related miRNA-mRNA pairs were obtained, which were enriched in the TCR signaling pathway. The differences in the expression levels also reflect functional changes in sepsis, which may contribute to immune deficiency. These results could improve understanding of the underlying molecular events in sepsis and these candidate miRNA-mRNA pairs may be predictors of, or therapy targets for sepsis. However, there were certain limitations in the present study. Firstly, the number of samples in the two datasets was small. Secondly, the CLP model mice of the two datasets were not established by the same research group. Thirdly, mmu-miR-370-3p was not verified and the causal regulatory relationship between miRNA and mRNA was not further confirmed. This causal regulation relationship may be verified using miR-mimics, in vitro inhibitors or mutant generation and adenoviral-mediated miRNA delivery in vivo. These experiments are important for future studies.

In conclusion, using miRNA and mRNA microarray datasets and multi-step bioinformatics analysis, four significant miRNA-mRNA pairs were found in sepsis model mice. These hub genes were enriched in the TCR signaling pathway, played an important role in immunity and may be markers or therapeutic targets for sepsis.

Acknowledgements

Not applicable.

Funding

The present study was supported by the National Natural Science Foundation of China (grant. no. 81860334) and Fujian Provincial Natural Science Foundation (grant. no. 2019J01585).

Availability of data and materials

The datasets analyzed (GSE74952 and GSE55238) during the present study are available in the Gene Expression Omnibus database.

Authors' contributions

JC analyzed the microarray data, performed the experiments and was a major contributor in writing the manuscript. ML downloaded the datasets and performed statistical analysis. SZ designed the study and edited the manuscript. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

The present study was approved by the Animal Care Committee of Guangxi Medical University (approval no. 201904001).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

miRNA

microRNA

DEGs

differentially expressed genes

DAVID

Database for Annotation, Visualization and Integration Discovery

GEO

Gene Expression Omnibus

CLP

cecal ligation and puncture

GO

Gene Ontology

KEGG

Kyoto Encyclopedia of Genes and Genomes

FC

fold-change

TCR

T-cell receptor

References

1 

Singer M, Deutschman CS, Seymour CW, Shankar-Hari M, Annane D, Bauer M, Bellomo R, Bernard GR, Chiche JD, Coopersmith CM, et al: The third international consensus definitions for sepsis and septic shock (Sepsis-3). JAMA. 315:801–810. 2016. View Article : Google Scholar : PubMed/NCBI

2 

Cecconi M, Evans L, Levy M and Rhodes A: Sepsis and septic shock. Lancet. 392:75–87. 2018. View Article : Google Scholar : PubMed/NCBI

3 

Gobatto AL, Besen BA and Azevedo LC: How can we estimate sepsis incidence and mortality? Shock 47 (1S Suppl 1). S6–S11. 2017.

4 

Martin GS: Sepsis, severe sepsis and septic shock: Changes in incidence, pathogens and outcomes. Expert Rev Anti Infect Ther. 10:701–706. 2012. View Article : Google Scholar : PubMed/NCBI

5 

Mayr FB, Yende S and Angus DC: Epidemiology of severe sepsis. Virulence. 5:4–11. 2014. View Article : Google Scholar : PubMed/NCBI

6 

Vincent JL: Individual gene expression and personalised medicine in sepsis. Lancet Respir Med. 4:242–243. 2016. View Article : Google Scholar : PubMed/NCBI

7 

Maslove DM and Wong HR: Gene expression profiling in sepsis: Timing, tissue, and translational considerations. Trends Mol Med. 20:204–213. 2014. View Article : Google Scholar : PubMed/NCBI

8 

Ullah S, John P and Bhatti A: MicroRNAs with a role in gene regulation and in human diseases. Mol Biol Rep. 41:225–232. 2014. View Article : Google Scholar : PubMed/NCBI

9 

Eledge MR and Yeruva L: Host and pathogen interface: MicroRNAs are modulators of disease outcome. Microbes Infect. 20:410–415. 2018. View Article : Google Scholar : PubMed/NCBI

10 

Chen J, Jiang S, Cao Y and Yang Y: Altered miRNAs expression profiles and modulation of immune response genes and proteins during neonatal sepsis. J Clin Immunol. 34:340–348. 2014. View Article : Google Scholar : PubMed/NCBI

11 

Barrett T, Wilhite SE, Ledoux P, Evangelista C, Kim IF, Tomashevsky M, Marshall KA, Phillippy KH, Sherman PM, Holko M, et al: NCBI GEO: Archive for functional genomics data sets-update. Nucleic Acids Res. 41:D991–D995. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Rittirsch D, Huber-Lang MS, Flierl MA and Ward PA: Immunodesign of experimental sepsis by cecal ligation and puncture. Nat Protoc. 4:31–36. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Kanehisa M, Sato Y, Furumichi M, Morishima K and Tanabe M: New approach for understanding genome variations in KEGG. Nucleic Acids Res. 47:D590–D595. 2019. View Article : Google Scholar : PubMed/NCBI

14 

Schmittgen TD and Livak KJ: Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 3:1101–1108. 2008. View Article : Google Scholar : PubMed/NCBI

15 

Borken F, Markwart R, Requardt RP, Schubert K, Spacek M, Verner M, Rückriem S, Scherag A, Oehmichen F, Brunkhorst FM and Rubio I: Chronic critical illness from sepsis is associated with an enhanced TCR response. J Immunol. 198:4781–4791. 2017. View Article : Google Scholar : PubMed/NCBI

16 

Patil NK, Bohannon JK, Luan L, Guo Y, Fensterheim B, Hernandez A, Wang J and Sherwood ER: Flt3 ligand treatment attenuates T cell dysfunction and improves survival in a murine model of burn wound sepsis. Shock. 47:40–51. 2017. View Article : Google Scholar : PubMed/NCBI

17 

Ramonell KM, Zhang W, Hadley A, Chen CW, Fay KT, Lyons JD, Klingensmith NJ, McConnell KW, Coopersmith CM and Ford M: CXCR4 blockade decreases CD4+ T cell exhaustion and improves survival in a murine model of polymicrobial sepsis. PLoS One. 12:e01888822017. View Article : Google Scholar : PubMed/NCBI

18 

Oami T, Watanabe E, Hatano M, Sunahara S, Fujimura L, Sakamoto A, Ito C, Toshimori K and Oda S: Suppression of T cell autophagy results in decreased viability and function of T cells through accelerated apoptosis in a murine sepsis model. Crit Care Med. 45:e77–e85. 2017. View Article : Google Scholar : PubMed/NCBI

19 

Cao C, Chai Y, Shou S, Wang J, Huang Y and Ma T: Toll-like receptor 4 deficiency increases resistance in sepsis-induced immune dysfunction. Int Immunopharmacol. 54:169–176. 2018. View Article : Google Scholar : PubMed/NCBI

20 

Condotta SA, Khan SH, Rai D, Griffith TS and Badovinac VP: Polymicrobial sepsis increases susceptibility to chronic viral infection and exacerbates CD8+ T cell exhaustion. J Immunol. 195:116–125. 2015. View Article : Google Scholar : PubMed/NCBI

21 

Hotchkiss RS, Tinsley KW, Swanson PE, Schmieg RE Jr, Hui JJ, Chang KC, Osborne DF, Freeman BD, Cobb JP, Buchman TG and Karl IE: Sepsis-induced apoptosis causes progressive profound depletion of B and CD4+ T lymphocytes in humans. J Immunol. 166:6952–6963. 2001. View Article : Google Scholar : PubMed/NCBI

22 

van der Poll T, van de Veerdonk FL, Scicluna BP and Netea MG: The immunopathology of sepsis and potential therapeutic targets. Nat Rev Immunol. 17:407–420. 2017. View Article : Google Scholar : PubMed/NCBI

23 

Boomer JS, To K, Chang KC, Takasu O, Osborne DF, Walton AH, Bricker TL, Jarman SD II, Kreisel D, Krupnick AS, et al: Immunosuppression in patients who die of sepsis and multiple organ failure. JAMA. 306:2594–2605. 2011. View Article : Google Scholar : PubMed/NCBI

24 

Inoue S, Suzuki K, Komori Y, Morishita Y, Suzuki-Utsunomiya K, Hozumi K, Inokuchi S and Sato T: Persistent inflammation and T cell exhaustion in severe sepsis in the elderly. Crit Care. 18:R1302014. View Article : Google Scholar : PubMed/NCBI

25 

Gil D, Schrum AG, Daniels MA and Palmer E: A role for CD8 in the developmental tuning of antigen recognition and CD3 conformational change. J Immunol. 180:3900–3909. 2008. View Article : Google Scholar : PubMed/NCBI

26 

Harty JT, Tvinnereim AR and White DW: CD8+ T cell effector mechanisms in resistance to infection. Annu Rev Immunol. 18:275–308. 2000. View Article : Google Scholar : PubMed/NCBI

27 

Dumontet E, Osman J, Guillemont-Lambert N, Cros G, Moshous D and Picard C: Recurrent respiratory infections revealing CD8α Deficiency. J Clin Immunol. 35:692–695. 2015. View Article : Google Scholar : PubMed/NCBI

28 

Harland KL, Day EB, Apte SH, Russ BE, Doherty PC, Turner SJ and Kelso A: Epigenetic plasticity of Cd8a locus during CD8(+) T-cell development and effector differentiation and reprogramming. Nat Commun. 5:35472014. View Article : Google Scholar : PubMed/NCBI

29 

Irving BA and Weiss A: The cytoplasmic domain of the T cell receptor zeta chain is sufficient to couple to receptor-associated signal transduction pathways. Cell. 64:891–901. 1991. View Article : Google Scholar : PubMed/NCBI

30 

D'Oro U, Munitic I, Chacko G, Karpova T, McNally J and Ashwell JD: Regulation of constitutive TCR internalization by the zeta-chain. J Immunol. 169:6269–6278. 2002. View Article : Google Scholar : PubMed/NCBI

31 

Eldor R, Klieger Y, Sade-Feldman M, Vaknin I, Varfolomeev I, Fuchs C and Baniyash M: CD247, a novel T cell-derived diagnostic and prognostic biomarker for detecting disease progression and severity in patients with type 2 diabetes. Diabetes Care. 38:113–118. 2015. View Article : Google Scholar : PubMed/NCBI

32 

Picard C, Dogniaux S, Chemin K, Maciorowski Z, Lim A, Mazerolles F, Rieux-Laucat F, Stolzenberg MC, Debre M, Magny JP, et al: Hypomorphic mutation of ZAP70 in human results in a late onset immunodeficiency and no autoimmunity. Eur J Immunol. 39:1966–1976. 2009. View Article : Google Scholar : PubMed/NCBI

33 

Roifman CM, Dadi H, Somech R, Nahum A and Sharfe N: Characterization of ζ-associated protein, 70 kd (ZAP70)-deficient human lymphocytes. J Allergy Clin Immunol. 126:1226–1233.e1. 2010. View Article : Google Scholar : PubMed/NCBI

34 

Huang L, Qiao L, Zhu H, Jiang L and Yin L: Genomics of neonatal sepsis: Has-miR-150 targeting BCL11B functions in disease progression. Ital J Pediatr. 44:1452018. View Article : Google Scholar : PubMed/NCBI

35 

Hayden MS and Ghosh S: Shared principles in NF-kappaB signaling. Cell. 132:344–362. 2008. View Article : Google Scholar : PubMed/NCBI

36 

Perkins ND: Integrating cell-signalling pathways with NF-kappaB and IKK function. Nat Rev Mol Cell Biol. 8:49–62. 2007. View Article : Google Scholar : PubMed/NCBI

37 

Pannicke U, Baumann B, Fuchs S, Henneke P, Rensing-Ehl A, Rizzi M, Janda A, Hese K, Schlesier M, Holzmann K, et al: Deficiency of innate and acquired immunity caused by an IKBKB mutation. N Engl J Med. 369:2504–2514. 2013. View Article : Google Scholar : PubMed/NCBI

38 

Mousallem T, Yang J, Urban TJ, Wang H, Adeli M, Parrott RE, Roberts JL, Goldstein DB, Buckley RH and Zhong XP: A nonsense mutation in IKBKB causes combined immunodeficiency. Blood. 124:2046–2050. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Chen J, Lin M and Zhang S: Identification of key miRNA‑mRNA pairs in septic mice by bioinformatics analysis. Mol Med Rep 20: 3858-3866, 2019.
APA
Chen, J., Lin, M., & Zhang, S. (2019). Identification of key miRNA‑mRNA pairs in septic mice by bioinformatics analysis. Molecular Medicine Reports, 20, 3858-3866. https://doi.org/10.3892/mmr.2019.10594
MLA
Chen, J., Lin, M., Zhang, S."Identification of key miRNA‑mRNA pairs in septic mice by bioinformatics analysis". Molecular Medicine Reports 20.4 (2019): 3858-3866.
Chicago
Chen, J., Lin, M., Zhang, S."Identification of key miRNA‑mRNA pairs in septic mice by bioinformatics analysis". Molecular Medicine Reports 20, no. 4 (2019): 3858-3866. https://doi.org/10.3892/mmr.2019.10594
Copy and paste a formatted citation
x
Spandidos Publications style
Chen J, Lin M and Zhang S: Identification of key miRNA‑mRNA pairs in septic mice by bioinformatics analysis. Mol Med Rep 20: 3858-3866, 2019.
APA
Chen, J., Lin, M., & Zhang, S. (2019). Identification of key miRNA‑mRNA pairs in septic mice by bioinformatics analysis. Molecular Medicine Reports, 20, 3858-3866. https://doi.org/10.3892/mmr.2019.10594
MLA
Chen, J., Lin, M., Zhang, S."Identification of key miRNA‑mRNA pairs in septic mice by bioinformatics analysis". Molecular Medicine Reports 20.4 (2019): 3858-3866.
Chicago
Chen, J., Lin, M., Zhang, S."Identification of key miRNA‑mRNA pairs in septic mice by bioinformatics analysis". Molecular Medicine Reports 20, no. 4 (2019): 3858-3866. https://doi.org/10.3892/mmr.2019.10594
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team