International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Hyperoxia-induced acute lung injury (HALI) is a typical complication of oxygen therapy, and can result in acute respiratory distress syndrome (ARDS) (1). In HALI, the hyperoxia can cause apoptosis and necrosis of alveolar epithelial cells (AEC) (2). In addition, apoptosis was associated with hyperoxia toxicity, lung injury and a decrease in survival rate in rats (3). Type II AEC (AEC II) is the cell origin of AEC. AEC II are essential for maintaining homeostatic pulmonary function under normal physiological conditions. Hyperoxia, however, results in loss of epithelial integrity in AEC II, by increasing apoptosis and possibly by enhancing epithelial transdifferentiation (4,5). Loss of AEC integrity then contributes to cytokine release and enhanced immune cell recruitment under HALI conditions (6). HALI (7), ARDS (8), pulmonary fibrosis (9) and other oxidative stress-related lung diseases are the predominant reasons for AEC-II apoptosis. AEC II are the primary target cells of high oxygen (4,7), and AEC II apoptosis is considered to be the underlying mechanism for the pathogenesis of HALI (10,11). The survival or apoptosis of AEC II directly affect the degree of lung injury and repair. For example, transforming growth factor-β receptor interacting protein-1 can reduce AEC apoptosis and increase the resistance to HALI (2). It has previously been reported that inhibiting apoptosis of AEC II effectively decreased HALI in rats (12). Therefore, AEC II apoptosis is a key contributor of HALI, inhibition of which may be an effective way to decrease the incidence of HALI, and ultimately provide a cure.
MicroRNAs (miRNAs) are a type of small non-coding RNAs of 18–22 nucleotides that are widely expressed in tissues and organs throughout the body. miRNAs are involved in cell growth, proliferation, differentiation, apoptosis, metabolism and other biological processes. miRNA-21 has been reported to be associated with multiple pathological conditions, including tumor development (13,14), cardiovascular (15–17), liver (18), lung (19,20) and renal (21) diseases, as well as diabetes (22). Using microarray methods, it was revealed that miR-21-5p was differentially expressed in AEC II cells during hyperoxia, and in specific in the H2O2-induced HALI model (23). miR-21-5p overexpression in AEC II significantly decreased apoptosis (23,24), which may be attributed to inhibition of its target gene PTEN (24). miR-21-5p overexpression in the HALI lung effectively decreased HALI severity in rats (23,25). These results suggest that miR-21-5p could alleviate AEC II apoptosis in HALI and decrease lung damage, but its anti-apoptotic mechanisms are not yet fully understood.
Previous studies (24,26) have suggested that PTEN is one of the target genes of miR-21-5p. PTEN/AKT signaling has been reported to inhibit cell cycle progression, and promote apoptosis (27,28). In addition, it has been widely reported that miR-21 reduces apoptosis by targeting PTEN and inhibiting PTEN/AKT signaling (17,29). The present study investigated the association between miR-21-5p, PTEN, AKT and AEC II apoptosis, and speculated that miR-21-5p may decrease AEC II apoptosis via PTEN and AKT-associated mechanisms.
AAV-6-miR-21-5p-GFP [miR-21-5p mimic (UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA) and green fluorescent protein (GP) encoded in an adeno-associated virus (AAV) type 6 vector] and AAV-6-miR-21-5p negative control (only GFP encoded in the AAV-6 vector) were from Synthgene Biotechnology Co., Ltd. Primers used for reverse transcription-quantitative PCR (RT-qPCR) experiments were from Thermo Fisher Scientific, Inc. Fetal bovine serum (FBS), DMEM/F12 and DMEM-low glucose medium (Gibco; Thermo Fisher Scientific, Inc.), Annexin V-FITC/propidium iodide (PI) cell apoptosis detection kit (BD Biosciences), QuantiTect SYBR Green PCR kit (Takara Bio, Inc.), HiScript® II 1st Strand cDNA Synthesis kit (Vazyme), bicinchoninic acid (BCA) protein quantification kit and SDS-PAGE gel preparation kit (Beyotime Institute of Biotechnology) were utilized in the present study. Antibodies targeting PTEN (cat. no. ab32199), AKT (cat. no. ab8805), phosphorylated (p) AKT (cat. no. ab38449), and GAPDH (cat. no. ab181602), and the secondary horseradish peroxidase (HRP)-labeled antibody, were from Abcam. The unlisted reagents were of analytical grade.
The present study utilized a FACSCalibur flow cytometer (BD Biosciences), an inverted fluorescence microscope (Nikon Corporation), a light microscope (Leica Microsystems GmbH), a fluorescence quantitative PCR instrument (Bio-Rad Laboratories, Inc.), a full-wavelength fluorescent microplate reader (Thermo Fisher Scientific, Inc.) and a transmission electron microscope (TEM; Hitachi, Ltd.).
All experimental procedures were performed according to the ‘Guide for the Care and Use of Laboratory Animals’ in China, and approved by the Experimental Animal Care and Use Committee of Zunyi Medical University. Sprague-Dawley rats (male:female, 1:1 in each experiment; age, 7–8 weeks; weight, 200–220 g) were purchased from the Third Military Medical University (Chongqing, China), and housed under controlled conditions: Food and water supplied ad libitum; a 12 h light/dark cycle; constant temperature (22°C) and humidity (45–55%). The rats were randomly assigned into four groups: i) Control group (n=20), exposed to room air; ii) HALI group (n=20), where rats were exposed to 5.0 l/min pure oxygen for 48 h, performed in an air-tight plastic chamber to maintain the concentration of oxygen (>95%), as previously described (30); iii) miR-21-5p + HALI group (n=20), where rats were sedated with 5% isoflurane and AAV-6-miR-21-5p was endotracheally administered at an MOI of 106 to the lung through an endotracheal tube inserted into the trachea, then 3 weeks later, the rats were exposed to pure oxygen to induce HALI; and iv) miR-21-5p control + HALI group (n=20), where a control AAV-6 was endotracheally administrated to the lung through an endotracheal tube, then 3 weeks, the rats were exposed to pure oxygen in order to induce HALI. No rats showed any signs of adverse weight loss in the four groups, and therefore no rats were excluded from the study.
At 0, 24, 48 and 60 h after hyperoxia exposure, rats from the four groups were sedated with 5% isoflurane. Blood (2 ml) was collected from the carotid artery and subjected to arterial blood gas analysis, and the OI and RI were calculated. The rats were euthanized by exsanguination, and the left lung was collected for the wet/dry weight analysis, then the rats were transcardially perfused with 4% paraformaldehyde prior to collection of the right lung for hematoxylin and eosin (H&E) staining and pathological score calculation.
As previously reported (30), after euthanasia of the rats, the lungs were surgically dissected away from the heart, trachea and main bronchi, then placed into a bottle, weighed, and dried to a constant weight in an oven at 70°C for 48 h. The wet/dry weight ratio was calculated to assess lung edema and to quantify the lung water content. Lung water content was calculated as: Lung water content = [(wet weight-dry weight)/wet weight] ×100%.
As previously reported (30), the lungs collected for histological analyses were fixed with 4% paraformaldehyde at room temperature for 24 h, followed by embedment in paraffin to dehydration, then sectioned (5 µm thickness). The sections were stained with hematoxylin and 0.5% eosin for 5 and 3 min, respectively, in room temperature (~22°C). Tissue sections were observed under a light microscope. Lung injury was scored as previously described by Matute-Bello et al (31). The parameters used to analyze HALI severity were: i) Neutrophils in alveoli; ii) neutrophils in pulmonary interstitium; iii) transparent membrane; iv) areas filled with protein debris; and v) thickness of alveolar septum.
The isolation of AEC II was performed based on a previously described method (24,32). Following anesthesia of the rats, lungs were removed and blood and leukocytes were replaced with PBS. Lungs were minced and digested by 0.25% trypsin for 25 min at 37°C. The effects of trypsin were neutralized with DMEM/F12 containing 10% FBS. The cell suspension was sequentially filtered through 70 µm cell strainers and centrifuged at 110 × g at room temperature for 5 min. The supernatant was then removed, and the cell pellets were resuspended in collagenase and incubated for 15 min at 37°C. Collagenase activity was neutralized by the addition of the same medium containing FBS and the cells were centrifuged again at 110 × g at room temperature for 5 min. Cell pellets were resuspended and cultured in flasks containing DMEM/F12 medium with 10% FBS in a 37°C, 95% air humidity, and 5% CO2 incubator.
AEC II were identified by TEM as previously described (23). AEC II were incubated for 48 h and digested with 0.125% trypsin. The cell suspension was collected and centrifuged at 100 × g for 10 min at 4°C. The supernatant was removed and the cells were fixed with 4% glutaraldehyde at room temperature for 24 h. The cell pellet was rinsed three times for 10 min at 4°C in PBS and fixed at 4°C for 30 min in 1% osmium tetroxide, then rinsed three times with PBS and observed by TEM.
At 0, 24, 48 and 60 h after isolation and culture, cells from each group were washed twice with PBS, extracted with 500 µl TRIzol® (Thermo Fished Scientific, Inc.) at room temperature for 5 min, and centrifuged for 5 min (15,000 × g, 4°C). The supernatant was collected, 0.1 ml chloroform was added and mixed at room temperature for 5 min, and the sample was centrifuged again for 15 min (15,000 × g, 4°C). An equal volume of isopropanol was added to the supernatant at room temperature for 10 min, then centrifuged for 10 min (15,000 × g, 4°C). DEPC water was used to dissolve the RNA pellet. The absorbance of the RNA solution was measured at 260 and 280 nm (OD260 and OD280), and the concentration of the RNA was calculated. As previously described (24), the settings for reverse transcription were as follows: 37°C for 15 min and 85°C for 5 sec. The cDNA solution was stored at −80°C. The qPCR settings for miR-21-5p quantification were: 95°C for 5 min; 39 cycles of 95°C for 45 sec, 60°C for 30 sec, 72°C for 45 sec; and 72°C for 10 min. The Cq values of miR-21-5p and U6 (as an internal reference control) were determined. The qPCR settings for PTEN quantification were: 94°C for 5 min; 39 cycles of 94°C for 45 sec, 51°C for 30 sec, 72°C for 44 sec; and 72°C for 10 min. The qPCR settings for β-actin quantification were: 94°C for 5 min; 39 cycles of 94°C for 45 sec, 60°C for 30 sec, 72°C for 44 sec; and 72°C for 10 min. Relative expression levels were calculated using the 2−ΔΔCq method (33). The primer sequences were as follows: miR-21-5p, forward 5′-GTCAATAGCTTATCAGACTGA-3′ and reverse 5′-GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCA-3′; U6, forward 5′-GCTTCGGCAGCACATATACTAAAAT-3′ and reverse 5′-CGCTTCACGAATTTGCGTGTCAT-3′; PTEN, forward 5′-TTTGAAGACCATAACCCACCAC-3′ and reverse 5′-ATTACACCAGTTCGTCCCTTTC-3′; and β-actin, forward 5′-TTCCTCCGCAAGGATGACACGC-3′ and reverse 5′-GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACAAAAATAT-3′.
Western blotting experiments were performed according to previously described standard procedures (34,35). AEC II were lysed with 400 µl lysis buffer (P0013, Beyotime Institute of Biotechnology) containing 100 mmol/l PMSF (ST506, Beyotime Institute of Biotechnology) for 30 min. Proteins were obtained and stored at −80°C. The protein concentration was determined using the BCA method and separated via SDS-PAGE (10% gel). Proteins were transferred to PVDF membrane and blocked with 5% skimmed milk at room temperature for 1 h. The membranes were then incubated with rabbit anti-PTEN (1:2,000), rabbit anti-pan-AKT (1:500) and rabbit anti-pAKT (T308; 1:1,000) primary antibodies overnight at 4°C, followed by goat anti-rabbit secondary antibody (1:5,000) at room temperature for 1 h. Enhanced chemiluminescence was used to detect the results. The strip optical density values were analyzed using a gel image analysis software (Image-Pro Plus; version 6.0; Meyer Instruments, Inc.).
Flow cytometry with Annexin V-FITC/PI staining was used to evaluate early and late apoptosis of AEC II cells (17). Using a FACSCalibur flow cytometer, the apoptosis rates of AEC II cells were detected.
AEC II cells were isolated from the lungs of rats in each of the four groups. Excluding the 0 h time point groups, AEC II cells were seeded in plates and cultured from each time point. On the day of detection, cells were digested with 1 ml 0.125% trypsin/EDTA for 2 min. Digested cells were centrifuged and the supernatant was removed. Cell density was adjusted to 2×105 cells/ml, and 100 µl cell suspensions were cultured for 24 h. A cell suspension for analysis was then prepared at 0, 24, 48 and 60 h after isolation and culture. The cells were collected via centrifugation (100 × g, 5 min), then washed twice with PBS (100 × g, 5 min), and 500 µl binding buffer was added. A total of 5 µl Annexin V-FITC and 5 µl PI were added and mixed at room temperature in the dark for 5–15 min. Apoptosis was detected via flow cytometry 1 h later.
SPSS software (version 23.0; IBM, Corp.) was used for the statistical analysis. Data were expressed as the mean ± standard deviation. One-way ANOVA and post hoc Dunnett's T3 test were performed in order to compare the differences among and between groups, respectively. P<0.05 was considered to indicate a statistically significant difference.
When rats were exposed to >95% oxygen, the OI decreased significantly after hyperoxia exposure, while the RI and wet/dry weight ratio of the lung increased significantly from 24 to 60 h after hyperoxia exposure (Fig. 1). Endotracheally administered AAV-6-miR-21-5p to the lung reversed these changes induced by HALI, as evidenced by increased OI and decreased RI and wet/dry weight ratio, compared with that of the miR-21-5p control + HALI group (Fig. 1).
The microscopic results of H&E-stained lung tissue sections revealed that neutrophils were rare in the alveolar pulmonary interstitium in the group control (Fig. 2A). In the HALI and the miR-21-5p control + HALI group, neutrophils were occasionally observed and were gradually increased in alveolar pulmonary interstitium at 60 h after hyperoxia (Fig. 2A). In addition, protein fragments and occasional hyaline membrane were observed in the alveolar interstitium at 48 and 60 h after hyperoxia (Fig. 2A), which indicated that HALI rats possessed severe lung injury. In the miR-21-5p + HALI group, the frequency of neutrophil occurrence, protein fragments and hyaline membrane decreased compared with the HALI or miR-21-5p control + HALI groups (Fig. 2A). Endotracheally administered AAV-6-miR-21-5p to the lung significantly decreased pathological changes in the lung of HALI rats, as evidenced by the decreased pathological score (Fig. 2B).
After 24 h culture, the AEC II cells revealed adherent, island-like and spindle-like growth. After 48 h culture, AEC II cells were polygonal and up to 95% adherent (Fig. 3A). The presence of osmiophilic lamellar corpuscles and microvilli, both of which are characteristic structures of AEC II, was confirmed by TEM (Fig. 3C). RT-qPCR results demonstrated that both HALI and AAV-6-miR-21-5p administration in the lung induced miR-21-5p upregulation (Fig. 3D). However, AAV-6-miR-1-5p administration significantly increased miR-21-5p expression compared with the HALI group (Fig. 3D).
The expression levels of PTEN were detected via RT-qPCR and western blotting following isolation and culture of AEC II from HALI rats. The results revealed that both mRNA and protein PTEN expression were decreased in AEC II from the HALI rats (Fig. 4). However, in the miR-21-5p + HALI group, PTEN expression levels were significantly decreased compared with the HALI group, while the expression of PTEN in AEC II from rats receiving the negative control virus did not exhibit any change compared with the HALI rats (Fig. 4).
The protein expression levels of AKT and pAKT in AEC II from HALI rats were detected via western blotting following different culture times. pAKT/AKT ratios were calculated, and the results revealed that in the control group, pAKT/AKT demonstrated no difference between 0 and 24 h; however, this ratio decreased significantly at 48 and 60 h compared with the 0 and 24 h time points (P<0.05; Fig. 5). In HALI and miR-21-5p control + HALI groups, pAKT/AKT ratio was increased at 24 h of hyperoxia compared with their 0 h time points (Fig. 5). Of note, the miR-21-5p + HALI group exhibited the highest levels of p-AKT/AKT ratio among the four groups, which was significantly higher compared with that of group HALI and group miR-21-5p control + HALI (Fig. 5).
Flow cytometry (Fig. 6A) was employed in order to detect the apoptosis rate of AEC II cells isolated from the HALI lung that were cultured for different times. Control AEC II cells isolated from the normal lung exhibited low early and late apoptosis rates, 0.93–2.53 and 0.23–1.33% respectively (Fig. 6B and C). Cells isolated from the HALI lung exhibited gradually increased early and late apoptosis after 24, 48 or 60 h culture (Fig. 6B and C). AAV-miR-21-5p administrated to the lung decreased the early and late apoptosis rate of AEC II cells isolated from HALI lung compared with that of the HALI group and the miR-21-5p control + HALI group (Fig. 6B and C).
It has previously been reported that miR-21-5p expression decreased in AEC II cells when cells underwent H2O2 insult (23), but the specific underlying molecular mechanism is not yet fully understood. In the present study, rats were endotracheally administered AAV-6-miR-21-5p to the lung before a HALI model was established in these rats. miR-21-5p overexpression ameliorated HALI and decreased apoptosis of AEC II cells isolated from HALI rats. Molecular experiments demonstrated that miR-21-5p overexpression in the lung decreased PTEN mRNA and protein expression levels in AEC II cells isolated from HALI rats. In addition, the pAKT/AKT ratio increased following miR-21-5p intervention in lung of HALI rats. These results indicate that miR-21-5p targeted PTEN and decreased HALI via apoptosis-associated mechanisms.
The present study isolated the AEC II cells from the modeled rats and molecular changes in the isolated cells were investigated ex vivo; therefore, it can be concluded that the PTEN, AKT, pAKT expression and apoptosis results obtained from the HALI rats were due to the effects on the AEC II cells. The data from the present study demonstrated that miR-21-5p overexpression, as a result of administering AAV-6 carrying an miR-21-5p-expression vector, decreased the severity of HALI in vivo, and decreased the apoptosis rate of ACE II cells ex vivo. Further experiments revealed that PTEN mRNA and protein expression levels were negatively regulated by the expression of miR-21-5p. By using dual-luciferase reporter gene assay, it has previously been demonstrated that PTEN is one of the target genes of miR-21-5p (24,36,37). Previous studies have revealed that miR-21 regulates cell proliferation and apoptosis in different disease models. For instance, in human hepatocellular carcinoma cells, downregulation of miR-21 increased the expression of PTEN, and decrease the proliferation, invasion and metastasis of hepatocarcinoma cells (38,39). miR-21 overexpression inhibited the apoptosis of nasopharyngeal carcinoma cells, and dual-luciferase reporter assay revealed that miR-21-5p targeted the 3′ untranslated region of the PTEN mRNA (36). miR-21-5p from mesenchymal stem cell-derived exosomes also inhibited hypoxia/reoxygenation-induced lung microvascular endothelial cell apoptosis in vitro, and decreased lung ischemia/reperfusion injury in vivo (40). Although no agonist/inhibitor of PTEN or AKT were used in the present study, our group has previously used the PTEN inhibitor Phen in an in vitro HALI model and found that PTEN inhibition partially offset H2O2-induced AECII apoptosis (24). In a previous study of H2O-induced apoptosis in cardiac stem cells, it was found that the PTEN inhibitor Phen or the PI3K inhibitor LY294002 efficiently attenuated the antiapoptotic effect of miR-21/PTEN/AKT signaling (17).
A number of studies have reported that the PTEN/AKT axis is associated with apoptosis (41–43). In cancer research, PTEN is known to inhibit the growth of cancer cells and lead to apoptosis (44). HALI induces a pathological condition in lung tissues, and PTEN overexpression in HALI AEC II may accelerate cell apoptosis, although no study has reported that miR-21-5p decreases ACE II apoptosis through PTEN/AKT. miR-21-5p overexpression promotes non-small cell lung cancer cell growth and mobility through the PTEN-AKT axis (45). miR-21-5p overexpression also enhanced the invasion and sphere forming abilities of keratinocytes through PTEN/AKT signaling (46). Finally, it was previously demonstrated that miR-21-5p decreased ACE II apoptosis through the PTEN/AKT pathway in vitro using an H2O2-induced HALI model (24). The results from the present study confirmed that miR-21-5p overexpression ameliorated HALI in vivo via PTEN/AKT-associated antiapoptotic pathways.
Although miRNA-21-associated therapies have not been applied to clinical use, it is believed that gene therapy is an effective strategy for ARDS/acute lung injury (ALI) treatment (47). In the present study, miR-21-5p was successfully administered to the lung through the trachea. In fact, cells in the lung, such as alveolar epithelial cells, can be specifically targeted through endotracheal intubation management (48), or through antibodies, pulmonary endothelial cell surface antigen and selective targeting intravenous injection (49). These data indicated the operability of miRNA-based therapy in ARDS/ALI. Although studies regarding the protective effects of miR-21-5p in pulmonary diseases are still in the laboratory research phase, it can be speculated that the elucidation of the antiapoptotic mechanism of miR-21-5p may bring opportunities for the application of miR-21-5p-associated therapies to the clinic.
Not applicable.
The present study was supported by the National Natural Science Foundation of China (grant no. 8156010205).
The datasets analyzed/generated during the present study are available from the corresponding author upon reasonable request.
SQ, HW, HM and GL performed the experiments, wrote the article and prepared figures. MC conceived and designed the experiments, and provided the reagents, materials and analysis tools. All authors read and approved the final manuscript.
All experimental procedures were performed according to the Guide for the Care and Use of Laboratory Animals. The protocol of the present study was approved by the Experimental Animal Care and Use Committee of Zunyi Medical University.
Not applicable.
The authors declare that they have no competing interests.
|
Dos Santos CC: Hyperoxic acute lung injury and ventilator-induced/associated lung injury: New insights into intracellular signaling pathways. Crit Care. 11:1262007. View Article : Google Scholar : PubMed/NCBI | |
|
Nyp MF, Mabry SM, Navarro A, Menden H, Perez RE, Sampath V and Ekekezie II: Lung epithelial-specific TRIP-1 overexpression maintains epithelial integrity during hyperoxia exposure. Physiol Rep. 6:e135852018. View Article : Google Scholar : | |
|
Budinger GR, Mutlu GM, Urich D, Soberanes S, Buccellato LJ, Hawkins K, Chiarella SE, Radigan KA, Eisenbart J, Agrawal H, et al: Epithelial cell death is an important contributor to oxidant-mediated acute lung injury. Am J Respir Crit Care Med. 183:1043–1054. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Lee HS and Kim CK: Cathepsin B is activated as an executive protease in fetal rat alveolar type II cells exposed to hyperoxia. Exp Mol Med. 43:223–229. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Kalluri R and Neilson EG: Epithelial-mesenchymal transition and its implications for fibrosis. J Clin Invest. 112:1776–1784. 2003. View Article : Google Scholar : PubMed/NCBI | |
|
Barazzone C, Horowitz S, Donati YR, Rodriguez I and Piguet PF: Oxygen toxicity in mouse lung: Pathways to cell death. Am J Respir Cell Mol Biol. 19:573–581. 1998. View Article : Google Scholar : PubMed/NCBI | |
|
Lee HS and Kim CK: Effect of recombinant IL-10 on cultured fetal rat alveolar type II cells exposed to 65%-hyperoxia. Respir Res. 12:682011. View Article : Google Scholar : PubMed/NCBI | |
|
Ma X, Xu D, Ai Y, Ming G and Zhao S: Fas inhibition attenuates lipopolysaccharide-induced apoptosis and cytokine release of rat type II alveolar epithelial cells. Mol Biol Rep. 37:3051–3056. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Kamp DW, Liu G, Cheresh P, Kim SJ, Mueller A, Lam AP, Trejo H, Williams D, Tulasiram S, Baker M, et al: Asbestos-induced alveolar epithelial cell apoptosis. The role of endoplasmic reticulum stress response. Am J Respir Cell Mol Biol. 49:892–901. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Liang X, Wei SQ, Lee SJ, Fung JK, Zhang M, Tanaka A, Choi AM and Jin Y: P62 sequestosome 1/light Chain 3b complex confers cytoprotection on lung epithelial cells after hyperoxia. Am J Respir Cell Mol Biol. 48:489–496. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Hengartner MO: The biochemistry of apoptosis. Nature. 407:770–776. 2000. View Article : Google Scholar : PubMed/NCBI | |
|
Husari AW, Khayat A, Awdeh H, Hatoum H, Nasser M, Mroueh SM, Zaatari G, El-Sabban M and Dbaibo GS: Activated protein C attenuates acute lung injury and apoptosis in a hyperoxic animal model. Shock. 33:467–472. 2010.PubMed/NCBI | |
|
Xu G, Zhang Y, Wei J, Jia W, Ge Z, Zhang Z and Liu X: MicroRNA-21 promotes hepatocellular carcinoma HepG2 cell proliferation through repression of mitogen-activated protein kinase-kinase 3. BMC Cancer. 13:4692013. View Article : Google Scholar : PubMed/NCBI | |
|
Teng Y, Radde BN, Litchfield LM, Ivanova MM, Prough RA, Clark BJ, Doll MA, Hein DW and Klinge CM: Dehydroepiandrosterone activation of G-protein-coupled estrogen receptor rapidly stimulates MicroRNA-21 transcription in human hepatocellular carcinoma cells. J Biol Chem. 290:15799–15811. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Dong S, Ma W, Hao B, Hu F, Yan L, Yan X, Wang Y, Chen Z and Wang Z: MicroRNA-21 promotes cardiac fibrosis and development of heart failure with preserved left ventricular ejection fraction by up-regulating Bcl-2. Int J Clin Exp Pathol. 7:565–574. 2014.PubMed/NCBI | |
|
Richart A, Loyer X, Neri T, Howangyin K, Guérin CL, Ngkelo A, Bakker W, Zlatanova I, Rouanet M, Vilar J, et al: MicroRNA-21 coordinates human multipotent cardiovascular progenitors therapeutic potential. Stem Cells. 32:2908–2922. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Deng W, Wang Y, Long X, Zhao R, Wang Z, Liu Z, Cao S and Shi B: miR-21 reduces hydrogen peroxide-induced apoptosis in c-kit+ cardiac stem cells in vitro through PTEN/PI3K/Akt signaling. Oxid Med Cell Longev. 2016:53891812016. View Article : Google Scholar : PubMed/NCBI | |
|
Otsuka M, Kishikawa T, Yoshikawa T, Ohno M, Takata A, Shibata C and Koike K: The role of microRNAs in hepatocarcinogenesis: Current knowledge and future prospects. J Gastroenterol. 49:173–184. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Yehya N, Yerrapureddy A, Tobias J and Margulies SS: MicroRNA modulate alveolar epithelial response to cyclic stretch. BMC Genomics. 13:1542012. View Article : Google Scholar : PubMed/NCBI | |
|
Li X, Mei ZJ, Wang YC, Chen J, Sun SX, Yau Y, Li Z and Xie C: Antagonism of miR-21 reverses radiation-induced EMT in alveolar epithelial cells via PI3K/Akt pathway. Int J Clin Exp Pathol. 9:1158–1167. 2016. | |
|
Gomez IG, MacKenna DA, Johnson BG, Kaimal V, Roach AM, Ren S, Nakagawa N, Xin C, Newitt R, Pandya S, et al: Anti-microRNA-21 oligonucleotides prevent Alport nephropathy progression by stimulating metabolic pathways. J Clin Invest. 125:141–156. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Dong L, Wang X, Tan J, Li H, Qian W, Chen J, Chen Q, Wang J, Xu W, Tao C and Wang S: Decreased expression of microRNA-21 correlates with the imbalance of Th17 and Treg cells in patients with rheumatoid arthritis. J Cell Mol Med. 18:2213–2224. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Qin S, Chen M, Ji H, Liu GY, Mei H, Li K and Chen T: miR-21-5p regulates type II alveolar epithelial cell apoptosis in hyperoxic acute lung injury. Mol Med Rep. 17:5796–5804. 2018.PubMed/NCBI | |
|
Qin S, Hui Y, Liu G, Mei H and Chen M: miR-21-5p targets PTEN and reduces H2O2-induced apoptosis in rat AECII cells. Int J Clin Exp Med. 12:5630–5637. 2019. | |
|
Shi L, He Y, Bai B and Chen M: Effects of microRNA-21 inhibitor on apoptosis of type II alveolar epithelial cells in rats with hyperoxia-induced acute lung injury. Zhonghua Wei Zhong Bing Ji Jiu Yi Xue. 29:244–248. 2017.(In Chinese). PubMed/NCBI | |
|
Tang C, Gu Y, Wang H, Wu H, Wang Y, Meng Y, Han Z, Gu Y, Ma W, Jiang Z, et al: Targeting of microRNA-21-5p protects against seizure damage in a kainic acid-induced status epilepticus model via PTEN-mTOR. Epilepsy Res. 144:34–42. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Small EM, O'Rourke JR, Moresi V, Sutherland LB, McAnally J, Gerard RD, Richardson JA and Olson EN: Regulation of PI3-kinase/Akt signaling by muscle-enriched microRNA-486. Proc Natl Acad Sci USA. 107:4218–4223. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Poliseno L, Salmena L, Zhang J, Carver B, Haveman WJ and Pandolfi PP: A coding-independent function of gene and pseudogene mRNAs regulates tumour biology. Nature. 465:1033–1038. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Hao XJ, Xu CZ, Wang JT, Li XJ, Wang MM, Gu YH and Liang ZG: miR-21 promotes proliferation and inhibits apoptosis of hepatic stellate cells through targeting PTEN/PI3K/AKT pathway. J Recept Signal Transduct Res. 38:455–461. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Liu G, Mei H, Chen M, Qin S, Li K, Zhang W and Chen T: Protective effect of agmatine against hyperoxia-induced acute lung injury via regulating lncRNA gadd7. Biochem Biophys Res Commun. 13:68–74. 2019. View Article : Google Scholar | |
|
Matute-Bello G, Downey G, Moore BB, Groshong SD, Matthay MA, Slutsky AS and Kuebler WM; Acute Lung Injury in Animals Study Group, : An official american thoracic society workshop report: Features and measurements of experimental acute lung injury in animals. Am J Respir Cell Mol Biol. 44:725–738. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Lin J, Tian J, Wang L, Wu W, Li H, Wang X, Zeng X and Zhang W: Apoptosis and surfactant protein-C expression inhibition induced by lipopolysaccharide in AEC II cell may associate with NF-κB pathway. J Toxicol Sci. 42:53–61. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Cao S, Xiao Z, Sun M and Li Y: D-serine in the midbrain periaqueductal gray contributes to morphine tolerance in rats. Mol Pain. 12(pii): 17448069166467862016.PubMed/NCBI | |
|
Cao S, Li Q, Hou J, Li Z, Cao X, Liu X and Qin B: Intrathecal TRPM8 blocking attenuates cold hyperalgesia via PKC and NF-κB signaling in the dorsal root ganglion of rats with neuropathic pain. J Pain Res. 12:1287–1296. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Ou H, Li Y and Kang M: Activation of miR-21 by STAT3 induces proliferation and suppresses apoptosis in nasopharyngeal carcinoma by targeting PTEN gene. PLoS One. 9:e1099292014. View Article : Google Scholar : PubMed/NCBI | |
|
Fang L, Wang X, Sun Q, Papakonstantinou E, S'ng C, Tamm M, Stolz D and Roth M: IgE downregulates PTEN through microRNA-21-5p and stimulates airway smooth muscle cell remodeling. Int J Mol Sci. 20(pii): E8752019. View Article : Google Scholar : PubMed/NCBI | |
|
Meng F, Henson R, Lang M, Wehbe H, Maheshwari S, Mendell JT, Jiang J, Schmittgen TD and Patel T: Involvement of human micro-RNA in growth and response to chemotherapy in human cholangiocarcinoma cell lines. Gastroenterology. 130:2113–2129. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Meng F, Henson R, Wehbe-Janek H, Ghoshal K, Jacob ST and Patel T: MicroRNA-21 regulates expression of the PTEN tumor suppressor gene in human hepatocellular cancer. Gastroenterology. 133:647–658. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Li JW, Wei L, Han Z and Chen Z: Mesenchymal stromal cells-derived exosomes alleviate ischemia/reperfusion injury in mouse lung by transporting anti-apoptotic miR-21-5p. Eur J Pharmacol. 852:68–76. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Hu M, Zhu S, Xiong S, Xue X and Zhou X: MicroRNAs and the PTEN/PI3K/Akt pathway in gastric cancer (Review). Oncol Rep. 41:1439–1454. 2019.PubMed/NCBI | |
|
Matsuda S, Nakagawa Y, Kitagishi Y, Nakanishi A and Murai T: Reactive oxygen species, superoxide dimutases, and PTEN-p53-AKT-MDM2 signaling loop network in mesenchymal stem/stromal cells regulation. Cells. 7(pii): E362018. View Article : Google Scholar : PubMed/NCBI | |
|
Gao X, Qin T, Mao J, Zhang J, Fan S, Lu Y, Sun Z, Zhang Q, Song B and Li L: PTENP1/miR-20a/PTEN axis contributes to breast cancer progression by regulating PTEN via PI3K/AKT pathway. J Exp Clin Cancer Res. 38:2562019. View Article : Google Scholar : PubMed/NCBI | |
|
Carnero A, Blanco-Aparicio C, Renner O, Link W and Leal JF: The PTEN/PI3K/AKT signalling pathway in cancer, therapeutic implications. Curr Cancer Drug Targets. 8:187–198. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Ren W, Hou J, Yang C, Wang H, Wu S, Wu Y, Zhao X and Lu C: Extracellular vesicles secreted by hypoxia pre-challenged mesenchymal stem cells promote non-small cell lung cancer cell growth and mobility as well as macrophage M2 polarization via miR-21-5p delivery. J Exp Clin Cancer Res. 38:622019. View Article : Google Scholar : PubMed/NCBI | |
|
Yan L, Cao R, Liu Y, Wang L, Pan B, Lv X, Jiao H, Zhuang Q, Sun X and Xiao R: miR-21-5p links epithelial-mesenchymal transition phenotype with stem-like cell signatures via AKT signaling in keloid keratinocytes. Sci Rep. 6:282812016. View Article : Google Scholar : PubMed/NCBI | |
|
Devaney J, Contreras M and Laffey JG: Clinical review: Gene-based therapies for ALI/ARDS: Where are we now? Crit Care. 15:2242011. View Article : Google Scholar : PubMed/NCBI | |
|
MacLoughlin RJ, Higgins BD, Laffey JG and O'Brien T: Optimized aerosol delivery to a mechanically ventilated rodent. J Aerosol Med Pulm Drug Deliv. 22:323–332. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Suen CM, Mei SH, Kugathasan L and Stewart DJ: Targeted delivery of genes to endothelial cells and cell- and gene-based therapy in pulmonary vascular diseases. Compr Physiol. 3:1749–1779. 2013. View Article : Google Scholar : PubMed/NCBI |