International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Human cytomegalovirus (HCMV) is a widespread opportunistic pathogen which is normally controlled by the immune system. Primary infection is usually asymptomatic or may cause mild symptoms in healthy individuals. However, accumulating evidence supports the concept that periodic reactivation of HCMV can cause severe medical conditions in immunocompromised patients such as transplant, cancer or HIV-infected patients. Furthermore, vertical transmission of HCMV during pregnancy is the leading cause of congenital infection resulting in neurologic damage in neonates [reviewed in (1,2)]. The exact mechanisms of establishment, latency and reactivation of HCMV, although fundamental for its successful persistence and dissemination, remain poorly understood.
Lytic HCMV infection is temporally regulated and viral gene expression takes place in three distinct phases, namely the immediate-early (IE), early (E) and late (L) phases, with the onset of each one being induced by the proteins expressed in the previous one. The HCMV immediate-early promoter/enhancer (MIEP) regulates the synthesis of the immediate-early protein 1 (IE1) and immediate-early protein 2 (IE2) which are considered to control all subsequent early and late events in HCMV replication, including reactivation from latency, by antagonizing intrinsic and innate immune responses (3). Both IE proteins are abundantly transcribed and expressed as products of alternative splicing and despite their relative homology, they exert distinct functions; IE1 is essential for efficient viral replication particularly at low multiplicities of infection (4) whereas IE2 has a key role during viral replication (5). HCMV, as a successful opportunistic pathogen, takes control of numerous host pathways such as metabolic and signalling pathways, intrinsic and innate immune responses, apoptosis or even cell cycle arrest strategies to prevent mitotic entry in order to ensure its own maintenance and replication (6). HCMV interrupts the regular order of steps in the cell division machinery by affecting key regulators of cell cycle progression in normal fibroblasts in vitro (7–9). HCMV infected cells have been found to proceed to mitosis but this unscheduled mitotic entry is followed by aberrant spindle formation, early separation of sister chromatids and eventually cell death (10). Interestingly, the HCMV IE1 protein has been known to be associated with condensed chromatin during mitosis (11–20). The C-terminal (a.a. 476–491) of IE1 protein has been mapped as the responsible domain for this intriguing association (17,21) however, the molecular mechanism as well as the outcome of this interaction between IE1 and chromatin remains to be determined.
Rho GTPases constitute a family of molecular switches that control fundamental cellular processes such as signal transduction pathways, cellular architecture and morphogenesis, migration, innate and adaptive immunity while deregulation of Rho GTPases have been associated with various human diseases and disorders [reviewed in (22)]. Members of the Rho family, including the RhoA, RhoB and RhoC isoforms have been shown to facilitate critical functions for a productive HCMV infection such as deregulation of cytoskeleton at early stages of infection, signal transduction, formation of the viral assembly compartment or secretion of IL-11, both in normal fibroblasts, the gold-standard cells for studying HCMV in vitro (23–27) or even in a cancer background (28). Combining the involvement of RhoA isoform in the cell division procedure (29–31) along with the mitotic defect in HCMV infected cells, we investigated the role of RhoA GTPAse in the context of human glioblastoma cells productively infected with HCMV. Our results demonstrate that HCMV infected glioblastoma cells, despite the cell cycle arrest observed in normal fibroblasts, are capable to successfully complete all phases of mitosis and cytokinesis. Furthermore, experiments depleting RhoA revealed the active role of this Rho isoform in glioblastoma cell proliferation and mitosis during HCMV lytic infection.
Human Foreskin Fibroblasts (HFF) and the human glioblastoma U373MG (Uppsala) cell line (kindly provided by Professor Sunyoun Kim, Korea) were authenticated by short tandem repeats DNA profiling and were grown in DMEM (Gibco BRL) supplemented with 10% foetal bovine serum (Gibco BRL), 100 U/ml penicillin and 100 µg/ml streptomycin under 5% CO2 in a humidified incubator at 37°C. All cells were tested periodically for mycoplasma contamination using the Mycoplasma Plus PCR primer set (Stratagene) and found to be negative. The laboratory strain HCMV AD169 strain as well as the the recombinant HCMV CR401 virus expressing the IE1 fused to EGFP (12) were used in this study. The virus stocks were propagated and titrated on HFF cells according to standard protocols (32). For viral infections, the cells were infected with HCMV at the indicated MOI for 2 h and then the inoculum was removed and replaced by fresh medium. The autofluoresecent construct pHcRed1-H2A was transfected in U373MG cells to express histone H2A fused to HcRed1 (12) using Lipofectamine 3000 according to the manufacturer's instructions. The initial HCMV CR401 infection of U373MG cells was subsequently followed by transfection of the cells with the pHcRed1-H2A construct.
RhoA protein was knocked down using small interfering RNA (siRNA) oligonucleotides against RhoA mRNA. The siRNA sequence for RhoA was CGGAATGATGAGCACACAATT and the siRNA sequence for the negative control was GAATAGACCCGTGATAGTACA. U373MG cells were transfected with 2 µg of siRNA against RhoA mRNA or the control siRNA using Lipofectamine 3000 according to the manufacturer's recommended protocol. Western blot analysis was used in order to determine the efficient knockdown of RhoA. After 48 h, the culture medium was changed to 1% serum DMEM and the cells were infected with HCMV AD169 wild type virus. All experiments were in triplicates.
The protein lysates from cells were separated by 12% Tris-glycine SDS-PAGE and electrophoretically transferred onto PVDF membrane. The membrane was incubated in blocking solution at room temperature for 1 h and subsequently with primary antibodies against RhoA and β-actin overnight at 4°C. Visualization of proteins was verified by a chemiluminesence detection method, using the Image Lab Software 6.0.1 (Bio-Rad Laboratories, Inc.).
MTT assay was performed to determine the cell proliferation rate of mock and HCMV infected U373MG after the knockdown of RhoA protein. 1×105 cells were transfected with the siRNA scrambled or the siRNA for RhoA and afterwards were infected with HCMV AD169 wild type virus (MOI 2 pfu/cell) or mock infected, in order to quantify the proliferation rate at 1, 2 and 3 days after the infection. The MTT reagent (3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide) (Sigma Aldrich) was used and the cells were incubated for 4 h at 37°C followed by the addition of 150 µl MTT solvent (dimethyl sulfoxide-DMSO) for 15 min and finally the measurement of the absorbance at 590 nm with a reference filter of 620 nm.
For immunofluorescence, 1×105 U373MG cells were transfected with the siRNA for RhoA or with the siRNA scrambled on glass coverslips, were infected with the HCMV AD169 wild type virus at MOI 2 pfu/cell and after 1 day cells were fixed with 4% PFA and permeabilized with 0.1% TritonX-100, for 10 min. Cells were stained with the rabbit polyclonal antibody RhoA (sc-179, Santa Cruz Biotechnology, Inc.), followed by a secondary Cy5-labeled goat anti-rabbit antibody (Santa Cruz Biotechnology, Inc.). The nuclei were stained with DAPI. The number of mitotic cells were counted in randomly selected microscopy fields from each condition and acquired with an epifluorescent Leica DMIRE2 microscope equipped with a Leica DFC300FX digital camera.
All data shown represent independent experiments carried out in triplicate and are presented as the mean ± standard deviation. Data were analyzed by one-way ANOVA followed by Tukey post hoc test using GraphPad 8.3.1 software (GraphPad Software, Inc.). P<0.05 was considered to indicate a statistically significant difference.
Previous studies have shown that HCMV IE1 associates with condensed chromatin of the host cell during mitosis and cells engaged in viral replication enter into unscheduled mitosis (10–20). Τhe recombinant HCMV CR401 virus expressing IE1 fused to EGFP serves as an excellent tool for the visualization of the IE1 protein in live infected cells, exhibiting perfect colocalization with histone H2A in mitotic cells (12).
The direct interaction between HCMV IE1 and H2A-H2B histones has been documented, precisely mapping the chromatin-tethering domain (CTD) of IE1 and identifying that several negatively charged H2A residues (E56, E61, E64, and D90) composing the nucleosomal acidic pocket, but not acidic residues outside the pocket, selectively direct the H2A interaction with the IE1 CTD (21).
Given that HCMV arrests cell cycle progression, we attempted to identify the step in the mitotic process that is impeded by timelapse microscopy. Single cells co-expressing CR401 EGFP-IE1 and HcRed1-H2A, presenting identical localization onto condensed chromosomes, were monitored throughout the course of mitosis. In contrast to the normal cultured fibroblasts, in which mitosis lasts approximately for 1 h, HCMV infected fibroblasts remained at several mitotic phases for prolonged times. The IE1-EGFP protein evidently became associated with condensing chromosomes altering its initial diffuse nuclear localization to a compacted pattern alike H2A in prophase and prometaphase (Fig. 1Aa-d). IE1-EGFP mitotic chromosomes were properly aligned in metaphase (Fig. 1Ae) however, a severe defect was apparent in anaphase, revealing irregular chromosomal migration which results in a significant number of lagging chromosomes (Fig. 1Af-h) and consequently in failure to complete the cell division. Detailed analysis examining a large number of randomly selected HCMV CR401 EGFP-IE1 mitotic cells, determined their distribution in relation to all mitotic phases (Fig. 1B). The vast majority of the mitotic cells were accumulated in prophase and prometaphase followed by cells progressing to metaphase. A minimal number of cells had advanced to an aberrant anaphase whilst telophase cells were completely absent. Therefore, the progression from metaphase to anaphase appears to be the critical transition step, blocking the efficient cell division and rendering the cells as non-productively infected cells.
The abortive infection observed in mitotic normal fibroblasts prompted us to investigate the fate of cell division in HCMV-infected glioblastoma cells. HCMV expression has been detected in a high percentage of human glioblastomas, the most malignant primary brain tumor [reviewed in (33)] while human glioblastoma cell lines are permissive and support HCMV gene expression (34–36). U373MG glioblastoma cells were infected with HCMV CR401 EGFP-IE1 virus while HcRed1-H2A in those cells served as a marker for condensed chromosomes. Live cell imaging showed that glioblastoma infected cells were capable of successfully completing mitosis. As shown in Fig. 2, IE1-EGFP in tight association with H2A was readily detectable in mitotic chromosomes, following the strict sequential order of all phases of cell division and cytokinesis, without encountering the defect observed in fibroblasts. The above experiments demonstrate that there is an apparent differentiation regarding mitotic progression, depending on the cell line background, normal or cancerous.
Several viruses have evolved strategies to arrest cycle progress and inhibit entry to mitosis, presumably in favour of their own functions and overall successful replication and propagation. HCMV represents a characteristic example of a virus causing unscheduled cell division entry and distortion of mitotic structures and subsequent mitotic blockade (10,12,20). Remarkably, the HCMV-induced mitotic restrain observed in normal fibroblasts is entirely abrogated in human glioblastoma cells which unconditionally succeed to divide. In line with our finding, efficient cell division has been observed in an additional glioblastoma cell line permissive to HCMV, T98G cells, which continue to divide, expressing all classes of viral genes. The ability of HCMV to persist within U373MG cells may provide insights into a mechanism for the sustained shedding of the virus. Interestingly, the nuclear antigen 1 of Epstein-Barr virus and the latency-associated nuclear antigen of the Kaposi sarcoma herpes virus (HHV-8), both proteins expressed by gamma herpes viruses, tether metaphase chromosomes, promoting viral genome maintenance during latency and regulation of viral replication (37,38). The specific role of IE1 binding onto condensed chromosomes remains to be determined, however it is intriguing to suggest that the chromatin-tethering activity of IE1 facilitates persistence of the viral genomes in dividing cells. Furthermore, the chromosome association properties of IE1 may have an additive role in the uniform segregation of the HCMV genomes into daughter cells.
RhoA GTPase has been shown to actively be involved in several aspects of HCMV infection (23–28). In addition, RhoA displays crucial roles in several stages of mitosis such as cell cortex stiffening during cell rounding, mitotic spindle formation [reviewed in (39)]. Combining the above, we tested the implication of RhoA in cell division and proliferation of mock or HCMV-infected U373MG cells by knocking down RhoA using the siRNA approach. The successful silencing of RhoA in U373MG cells used as a cell model in the current study, was determined by western blot analysis (Fig. 3A). The proliferation rate of RhoA-depleted cells was significantly decreased for a period of 3 days compared to both parental U373MG and siRNA scramble-treated cells (Fig. 3B). Super-infection of the same set of cells with HCMV AD169 further confirmed the successful replication rate of the RhoA-expressing cells in contrast to the restricted cell division observed in the virally infected RhoA-depleted cells (Fig. 3C).
Apart from the growth rate, we were also interested in exploring the mitotic behavior of RhoA-expressing and silenced HCMV infected cells. For that purpose, parental U373MG cells, siRNA scramble and siRNA RhoA cells, were cultured for 2 days and multiple random optical fields were monitored for the detection of mitotic cells. Independently of the siRNA target (siscr or siRhoA), all cells successfully accomplished cell division, with RhoA-depleted cells presenting a significant reduction in the number of mitotic cells compared to the parental and scramble cells (Fig. 3D). The ability of both siRNA scramble and siRNA targeting RhoA to successfully bring about mitosis was also confirmed by immunofluorescence microscopy (Fig. 3E and F). The mitotic rate of the aforementioned siRNA silenced cells was further assessed in the context of HCMV infection. In line with the proliferation rates, all groups of infected cells (siscr or siRhoA) proceeded and successfully completed mitosis and cytokinesis. However, the number of mitotic cells with RhoA-depletion was statistically significantly reduced compared to the parental and scramble cells (Fig. 3G). The difference between the HCMV-infected parental and siRNA scramble cells was of less statistical significance, indicating a relative effect of the RNA interference process on the mitotic cells. The aforementioned observation that the siRNA scramble affected mitosis confirmed that although non-targeting controls activate the RNAi machinery allowing a baseline assessment of the effect of the introduction of duplex RNA on gene expression, they can induce a stress response within cells. In addition, considering that HCMV is known to trigger multiple cellular stress responses, the difference in number of mitotic cells between the parental and siRNA scramble groups could be due to siRNA/HCMV-induced stress. Moreover, the HCMV shedding was also determined by standard plaque assay, showing an efficient egress of the virus from the glioblastoma cells, presenting no statistically significant difference between siRNA treated and non-treated cells (Fig. 3H). These findings provide a clear evidence for an active role of RhoA GTPase during cell proliferation of uninfected but also remarkably of HCMV infected glioblastoma cells which despite the silencing of RhoA they are still capable of dividing properly. Moreover, cellular DNA synthesis is ongoing, although restrained in RhoA-knockdown cells, even in the presence of the HCMV genomes.
Previous studies have shown an active involvement of RhoA GTPase during several aspects of HCMV cell cycle including cytoskeleton reorganization, viral replication, assembly and egress of the progeny virus (23–28). The current study provides evidence for an additional implication of RhoA in cell proliferation and mitosis of glioblastoma HCMV-infected cells. RhoA is a critical regulator and ensures the proper formation of mitotic spindle and inhibition of RhoA activity is known to affect distinct phases of the mitotic progression (29–31). We show that glioblastoma cells are cable in overcoming the cell cycle arrest induced by HCMV and our findings on cell proliferation and division after RhoA depletion further expands our knowledge regarding the role of this particular Rho GTPase for viral genome maintenance and shedding.
The authors would like thank Dr Melpomeni Tseliou and Dr Panagiota Dimitropolou (Medical School, University of Crete, Greece) for technical assistance.
This project was funded by the National Plan for Science, Technology, and Innovation (MAARIFAH), King Abdulaziz City for Science and Technology, Kingdom of Saudi Arabia (grant no. 12-MED2652-02).
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
SaudA and SaadA were involved in methodology, data curation and writing the original draft of the manuscript. AAAQ was involved in methodology, data curation and writing the manuscript. CS and GS were involved in conceptualization of the study, supervised the study, and wrote, reviewed and edited the manuscript. All authors read and approved the final manuscript.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
|
Griffiths P: The direct and indirect consequences of cytomegalovirus infection and potential benefits of vaccination. Antiviral Res. 176:30662020. View Article : Google Scholar | |
|
Mocarski ES Jr: Immunomodulation by cytomegaloviruses: Manipulative strategies beyond evasion. Trends Microbiol. 10:332–339. 2002. View Article : Google Scholar : PubMed/NCBI | |
|
Adamson CS and Nevels MM: Bright and early: Inhibiting human cytomegalovirus by targeting major immediate-early gene expression or protein function. Viruses. 12:1102020. View Article : Google Scholar | |
|
Greaves RF and Mocarski ES: Defective growth correlates with reduced accumulation of a viral DNA replication protein after low-multiplicity infection by a human cytomegalovirus ie1 mutant. J Virol. 72:366–379. 1998. View Article : Google Scholar : PubMed/NCBI | |
|
Marchini A, Liu H and Zhu H: Human cytomegalovirus with IE-2 (UL122) deleted fails to express early lytic genes. J Virol. 75:1870–1878. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Sanchez V and Spector DH: Subversion of cell cycle regulatory pathways. Curr Top Microbiol Immunol. 325:243–262. 2008.PubMed/NCBI | |
|
Salvant BS, Fortunato EA and Spector DH: Cell cycle dysregulation by human cytomegalovirus: Influence of the cell cycle phase at the time of infection and effects on cyclin transcription. J Virol. 72:3729–3741. 1998. View Article : Google Scholar : PubMed/NCBI | |
|
Kalejta RF and Shenk T: Proteasome-dependent, ubiquitin-independent degradation of the Rb family of tumor suppressors by the human cytomegalovirus pp71 protein. Proc Natl Acad Sci USA. 100:3263–3268. 2003. View Article : Google Scholar : PubMed/NCBI | |
|
Song YJ and Stinski MF: Effect of the human cytomegalovirus IE86 protein on expression of E2F-responsive genes: A DNA microarray analysis. Proc Natl Acad Sci USA. 99:2836–2841. 2002. View Article : Google Scholar : PubMed/NCBI | |
|
Eifler M, Uecker R, Weisbach H, Bogdanow B, Richter E, König L, Vetter B, Lenac-Rovis T, Jonjic S, Neitzel H, et al: PUL21a-cyclin A2 interaction is required to protect human cytomegalovirus-infected cells from the deleterious consequences of mitotic entry. PLoS Pathog. 10:e10045142014. View Article : Google Scholar : PubMed/NCBI | |
|
Ahn JH, Brignole EJ III and Hayward GS: Disruption of PML subnuclear domains by the acidic IE1 protein of human cytomegalovirus is mediated through interaction with PML and may modulate a RING finger-dependent cryptic transactivator function of PML. Mol Cell Biol. 18:4899–4913. 1998. View Article : Google Scholar : PubMed/NCBI | |
|
Dimitropoulou P, Caswell R, McSharry BP, Greaves RF, Spandidos DA, Wilkinson GW and Sourvinos G: Differential relocation and stability of PML-body components during productive human cytomegalovirus infection: Detailed characterization by live-cell imaging. Eur J Cell Biol. 89:757–768. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Huh YH, Kim YE, Kim ET, Park JJ, Song MJ, Zhu H, Hayward GS and Ahn JH: Binding STAT2 by the acidic domain of human cytomegalovirus IE1 promotes viral growth and is negatively regulated by SUMO. J Virol. 82:10444–10454. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Krauss S, Kaps J, Czech N, Paulus C and Nevels M: Physical requirements and functional consequences of complex formation between the cytomegalovirus IE1 protein and human STAT2. J Virol. 83:12854–12870. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Lafemina RL, Pizzorno MC, Mosca JD and Hayward GS: Expression of the acidic nuclear immediate-early protein (IE1) of human cytomegalovirus in stable cell lines and its preferential association with metaphase chromosomes. Virology. 172:584–600. 1989. View Article : Google Scholar : PubMed/NCBI | |
|
Nevels M, Brune W and Shenk T: SUMOylation of the human cytomegalovirus 72-kilodalton IE1 protein facilitates expression of the 86-kilodalton IE2 protein and promotes viral replication. J Virol. 78:7803–7812. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Reinhardt J, Smith GB, Himmelheber CT, Azizkhan-Clifford J and Mocarski ES: The carboxyl-terminal region of human cytomegalovirus IE1491aa contains an acidic domain that plays a regulatory role and a chromatin-tethering domain that is dispensable during viral replication. J Virol. 79:225–233. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Shin HJ, Kim YE, Kim ET and Ahn JH: The chromatin-tethering domain of human cytomegalovirus immediate-early (IE) 1 mediates associations of IE1, PML and STAT2 with mitotic chromosomes, but is not essential for viral replication. J Gen Virol. 93:716–721. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Wilkinson GW, Kelly C, Sinclair JH and Rickards C: Disruption of PML-associated nuclear bodies mediated by the human cytomegalovirus major immediate early gene product. J Gen Virol. 79:1233–1245. 1998. View Article : Google Scholar : PubMed/NCBI | |
|
Fang Q, Chen P, Wang M, Fang J, Yang N, Li G and Xu RM: Human cytomegalovirus IE1 protein alters the higher-order chromatin structure by targeting the acidic patch of the nucleosome. Elife. 5:e119112016. View Article : Google Scholar : PubMed/NCBI | |
|
Mücke K, Paulus C, Bernhardt K, Gerrer K, Schön K, Fink A, Sauer EM, Asbach-Nitzsche A, Harwardt T, Kieninger B, et al: Human cytomegalovirus major immediate early 1 protein targets host chromosomes by docking to the acidic pocket on the nucleosome surface. J Virol. 88:1228–1248. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Hall A: Rho family GTPases. Biochem Soc Trans. 40:1378–1382. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Wang X, Huang DY, Huong SM and Huang ES: Integrin alphavbeta3 is a coreceptor for human cytomegalovirus. Nat Med. 11:515–521. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Seo JY, Yaneva R, Hinson ER and Cresswell P: Human cytomegalovirus directly induces the antiviral protein viperin to enhance infectivity. Science. 332:1093–1097. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Poncet D, Pauleau AL, Szabadkai G, Vozza A, Scholz SR, Le Bras M, Brière JJ, Jalil A, Le Moigne R, Brenner C, et al: Cytopathic effects of the cytomegalovirus-encoded apoptosis inhibitory protein vMIA. J Cell Biol. 174:985–996. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Goulidaki N, Alarifi S, Alkahtani SH, Al-Qahtani A, Spandidos DA, Stournaras C and Sourvinos G: RhoB is a component of the human cytomegalovirus assembly complex and is required for efficient viral production. Cell Cycle. 14:2748–2763. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Alarifi S, Alkahtani S, Al-Qahtani AA, Stournaras C and Sourvinos G: Induction of interleukin-11 mediated by RhoA GTPase during human cytomegalovirus lytic infection. Cell Signal. 70:1095992020. View Article : Google Scholar : PubMed/NCBI | |
|
Tseliou M, Al-Qahtani A, Alarifi S, Alkahtani SH, Stournaras C and Sourvinos G: The role of RhoA, RhoB and RhoC GTPases in cell morphology, proliferation and migration in human cytomegalovirus (HCMV) infected glioblastoma cells. Cell Physiol Biochem. 38:94–109. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Derksen PWB and van de Ven RAH: Shared mechanisms regulate spatiotemporal RhoA-dependent actomyosin contractility during adhesion and cell division. Small GTPases. 11:113–121. 2020. View Article : Google Scholar : PubMed/NCBI | |
|
Nakayama Y, Saito Y, Soeda S, Iwamoto E, Ogawa S, Yamagishi N, Kuga T and Yamaguchi N: Genistein induces cytokinesis failure through RhoA delocalization and anaphase chromosome bridging. J Cell Biochem. 115:763–771. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Lian G, Wong T, Lu J, Hu J, Zhang J and Sheen V: Cytoskeletal associated filamin A and RhoA affect neural progenitor specification during mitosis. Cereb Cortex. 29:1280–1290. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Filippakis H, Dimitropoulou P, Eliopoulos AG, Spandidos DA and Sourvinos G: The enhanced host-cell permissiveness of human cytomegalovirus is mediated by the Ras signaling pathway. Biochim Biophys Acta. 1813:1872–1882. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Cobbs CS: Cytomegalovirus and brain tumor: Epidemiology, biology and therapeutic aspects. Curr Opin Oncol. 25:682–688. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Awasthi S, Isler JA and Alwine JC: Analysis of splice variants of the immediate-early 1 region of human cytomegalovirus. J Virol. 78:8191–8200. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Lee K, Jeon K, Kim JM, Kim VN, Choi DH, Kim SU and Kim S: Downregulation of GFAP, TSP-1, and p53 in human glioblastoma cell line, U373MG, by IE1 protein from human cytomegalovirus. Glia. 51:1–12. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Luo MH and Fortunato EA: Long-term infection and shedding of human cytomegalovirus in T98G glioblastoma cells. J Virol. 81:10424–10436. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Marechal V, Dehee A, Chikhi-Brachet R, Piolot T, Coppey-Moisan M and Nicolas JC: Mapping EBNA-1 domains involved in binding to metaphase chromosomes. J Virol. 73:4385–4392. 1999. View Article : Google Scholar : PubMed/NCBI | |
|
Piolot T, Tramier M, Coppey M, Nicolas JC and Marechal V: Close but distinct regions of human herpesvirus 8 latency-associated nuclear antigen 1 are responsible for nuclear targeting and binding to human mitotic chromosomes. J Virol. 75:3948–3959. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Chircop M: Rho GTPases as regulators of mitosis and cytokinesis in mammalian cells. Small GTPases. 5:e297702014. View Article : Google Scholar : PubMed/NCBI |