International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Breast cancer (BC) is a leading cause of cancer-related mortality in women worldwide and remains the most common malignancy among younger patients (1–3). Although treatments have improved, including chemotherapy and radiotherapy, BC prognoses remain poor (4). Therefore, it is important to investigate the molecular mechanisms of BC growth and metastasis to discover novel molecular targets for BC treatment (5).
Long non-coding (lnc)RNAs are defined as non-coding transcripts that are >200 nucleotides in length. Dysregulated lncRNA expression has be observed in numerous types of cancer, which suggests that aberrant lncRNA expression may be a major contributor to tumorigenesis (6–9). lncRNAs also regulate various biological processes, including cell proliferation, apoptosis, differentiation, migration and invasion in the cancer microenvironment (9–11), and therefore provide new opportunities for cancer diagnosis and treatment (9,12). For example, lncRNA RUSC1-AS1 promotes the progression of BC through mediating cyclin-dependent kinase inhibitor 1 and kruppel-like factor 2 (13). Overexpression of lncRNA HOTAIR has been shown to promote the development of retinoblastoma via the miR-613/c-met axis, which modulates the epithelial-mesenchymal transition in retinoblastoma (14). Furthermore, lncRNA in non-homologous end joining pathway 1 may promote BC growth by regulating BC cell metastasis and increasing the expression of epithelial-mesenchymal transition-related markers (15).
lncRNA prostate cancer-associated transcript 1 (PCAT1) was first discovered in 2011 as a prostate-specific regulator of cell proliferation in prostate cancer (16). Recent studies have indicated that PCAT1 serves a role in numerous types of cancer (16–18). It has also been reported that PCAT1 promotes epithelial ovarian cancer by mediating the expression of cyclin D1/CDK4 (17). Furthermore, PCAT1 knockdown may reduce the expression of cyclin B1 and CDC2 kinase activity, inhibiting the growth of esophageal squamous cell carcinoma (ESCC) by sponging miR-326 (19). Therefore, the aim of the present study was to explore the function and molecular mechanism of lncRNA PCAT1/microRNAs (miRNAs/miRs)-134-3p/pituitary homeobox 2 (PITX2) in BC.
This study involved 30 patients who underwent BC resection at Liyang People's Hospital (Liyang, China) between March 2019 and March 2020. All patients were newly diagnosed with primary BC. Patients <18 or >75 years of age, who presented with first distant metastasis, combined with other malignancies, or who received neoadjuvant therapy were excluded from the present study. Tumor and matched adjacent normal tissues were collected and stored in liquid nitrogen. The present study was approved by the Ethics Committee of Liyang People's Hospital (approval no. 2018024), and were conducted in accordance with the Declaration of Helsinki. Written informed consent was obtained from all participants prior to the study.
Human BC cell lines (MDA-MB-231, SKBr-3, MCF-7 and ZR-75-30) and the normal human mammary epithelial MCF10A cell line were purchased from the American Type Culture Collection. MDA-MB-231, MCF10A, SKBr-3 and MCF-7 were cultured in DMEM (Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific, Inc.), 100 U/ml penicillin and 100 µg/ml streptomycin and incubated at 37°C in an atmosphere containing 5% CO2. ZR-75–30 cells were cultured in RPMI-1640 medium (Thermo Fisher Scientific, Inc.) supplemented with 10% FBS, 100 U/ml penicillin and 100 µg/ml streptomycin and incubated at 37°C in an atmosphere containing 5% CO2.
For cell transfection, short hairpin RNAs (shRNAs) targeting lncRNA PCAT1 (sh-PCAT1), PITX2 (sh-PITX2) and the corresponding sh-negative control (NC) were subcloned into the GV248 (hU6-MCS-UbiquitinEGFP-IRES-puromycin) vector (Shanghai GeneChem Co., Ltd.). The following sequences were used: sh-PCAT1, 5′-ATACATAAGACCATGGAAAT-3′; sh-PITX2, 5′-GATGCAATGATGTTTCTGAAA-3′; and sh-NC, 5′-TTCTCCGAACGTGTCACGT-3′. miR-134-3p mimic, miR-134-3p inhibitor and their corresponding NCs (NC mimic and NC inhibitor) were purchased from Thermo Fisher Scientific, Inc.
The sequences were as follows: miR-134-3p mimic, 5′-CCUGUGGGCCACCUAGUCACCAA-3′; miR-134-3p inhibitor, 5′-CCUGUGGGCCACCUAGUCACCAA-3′; NC mimic, 5′-UUCUCCGAACGUGUCACGUTT-3′; and NC inhibitor, 5′ UCACAACCUCCUAGAAAGAGUAGA 3′. For plasmid or miRNA mimic/inhibitor transfection, SKBR-3 and MCF-7 cells were seeded in 6-well plates at a density of 1×106 cells/well and cultured to 80% confluence. Plasmids (1 µg) or miRNA mimic/inhibitor (20 nm) were transfected into cells using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). Cells were then cultured at 37°C for 24 h, and transfection efficiency was assessed. Subsequent experiments were performed 48 h post-transfection.
Total RNA was extracted from BC and adjacent normal tissue samples or cells (MCF10A, MDA-MB-231, SKBr-3, MCF-7 and ZR-75-30). To detect the expression levels of miR-134-3p, the miRNeasy Kit (Shanghai Yeasen Biotechnology Co., Ltd.) was used to extract total RNA. Total RNA was reverse transcribed using the miScript II RT Kit (Qiagen, Inc.) into complementary DNA (cDNA) according to the manufacturer's protocol. qPCR reaction systems were prepared using the miScript SYBR Green PCR Kit (Qiagen, Inc.) with U6 as the internal reference gene. To detect the mRNA expression levels, total RNA was extracted using TRIzol® reagent (Takara Bio, Inc.). Total RNA was reverse transcribed into cDNA using the PrimeScript™ II 1st Strand cDNA Synthesis Kit (Takara Biotechnology Co., Ltd.) according to the manufacturer's protocol. All PCR reactions were carried out using an ABI 7500 System (Applied Biosystems; Thermo Fisher Scientific, Inc.). GAPDH and U6 were used as the internal reference genes. The following primers were used for qPCR: PCAT1 forward (F), 5′-GCTGGCATTGGTCAACATAAC-3′ and reverse (R), 5′-GTGAATATGGCGGATGAGGAA-3′; miR-134-3p F, 5′-CTGTGGGCCACCTAGTCACCAA-3′ and R, 5′-GCTGTCAACGATACGCTACCTA-3′; PITX2 F, 5′-GGCCGCCGCTTCTTACA-3′ and R, 5′-CACTGGCGATTTGGTTCTGATTT-3′; U6 F, 5′-GTGATCACTCCCTGCCTGAG-3′ and R, 5′-GGACTTCACTGGACCAGACG-3′; and GAPDH F, 5′-CCGCATCTTCTTGTGCAGTG-3′ and R, 5′-CCCAATACGGCCAAATCCGT-3′. The thermocycling conditions were as follows: 10 min at 95°C for 1 cycle, followed by denaturation at 95°C for 30 sec, annealing at 56°C for 1 min, and final extension at 72°C for 30 sec for 40 cycles. Relative gene expression was calculated using the 2−ΔΔCq method (20) and were normalized to either GAPDH or U6 levels.
The proliferation rates of SKBr-3 and MCF-7 cells were analyzed using the Cell Counting Kit-8 (CCK-8) assay (Dojindo Laboratories, Inc.) according to the manufacturer's instructions. Cells were seeded into 96-well plates at a density of ~4,000 cells/well. Cells were then incubated for 24, 48 and 72 h. Subsequently, 10 µl CCK-8 reagent was added to each well. The plates were incubated at 37°C for 2 h. The optical density was measured at 450 nm using a ultraviolet spectrophotometer (Thermo Fisher Scientific, Inc.).
The migratory abilities of SKBr-3 and MCF-7 cells were analyzed using wound healing assays. Transfected cells (5×105 cells/well) were inoculated into 6-well plates and incubated in serum-free medium. Subsequently, the confluent cell monolayer (95–100%) was scratched using a 200 µl pipette tip. Cell migration was observed and quantified at 0 and 48 h. Migrated cells were counted in three randomly selected fields using an IX70 inverted optical microscope (magnification, ×100; Olympus Corporation). Cell migration was calculated according to the following formula: Cell migration (%) = (width at 0 h - width at 48 h) / width at 0 h ×100.
The migration and invasion of SKBr-3 and MCF-7 cells were analyzed using Transwell assays. The upper chamber was filled with serum-free DMEM containing 5×104 cells, and the lower chamber was filled with DMEM containing 10% FBS. Following incubation for 24 h at 37°C, cells in the lower chamber were collected and stained with 0.5% crystal violet for 20 min at room temperature. Stained cells were counted using an IX70 inverted optical microscope (magnification, ×100; Olympus Corporation). The invasion assay was carried out using the aforementioned Transwell assay protocol, but the upper chamber was precoated with Matrigel (37°C for 30 min).
The colony forming ability of SKBr-3 and MCF-7 cells was assessed using a colony formation assay. The SKBr-3 or MCF-7 cells were seeded into 6-well plates at a density of 1×103 cells/well. Colonies were formed for 10 days at room temperature and then the culture medium was removed. Following which, the colonies were washed with PBS three times and fixed with methyl alcohol for 10 min at room temperature and stained with 0.5% crystal violet solution for a further 10 min at room temperature. After washing with water, the colonies were imaged and counted under a light microscope (magnification, ×10; Olympus Corporation).
Flow cytometry was used for SKBr-3 and MCF-7 cells (1×105) cycle analysis. Cells were collected and centrifuged at 100 × g at room temperature for 5–10 min. Cells were digested using trypsin and fixed in 70% ethanol and incubated at 4°C for 1 h. Subsequently, the cells were incubated with 25 µg/ml PI, 25 µl/ml RNase A and Triton X-100 for 30 min at 4°C. The cell cycle results were detected using a flow cytometer (FACSCalibur; BD Biosciences) and analyzed with FlowJo software (version 10.9; FlowJo LLC).
Flow cytometry was employed for early and late apoptosis analysis, which was completed using an Annexin V-FITC kit (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. SKBr-3 and MCF-7 cells (1×105) were collected and centrifuged at 100 × g at room temperature for 5–10 min. Cells were first stained with 5 µl Annexin V-FITC and 5 µl PI simultaneously at 4°C for 15 min in the dark. Cell apoptosis was detected using a flow cytometer (FACSCalibur; BD Biosciences). The apoptosis results were analyzed with FlowJo software (version 10.9; FlowJo LLC).
Total protein from SKBr-3 and MCF-7 cells after transfection was extracted using RIPA buffer (Invitrogen; Thermo Fisher Scientific, Inc.), followed by quantification using the BCA Assay Kit (Santa Cruz Biotechnology, Inc.). Then, 25 µg protein/lane was separated by SDS-PAGE on an 8–12% gel. The separated proteins were transferred onto a 0.22-µm PVDF membrane and blocked in Tris-buffered saline with 1% Tween-20 and 5% non-fat milk for 1 h at room temperature. Subsequently, the membranes were incubated overnight at 4°C with primary antibodies (all from Abcam) targeted against: Anti-Bax (1:1,000; cat. no. ab32503), anti-Bcl-2 (1:1,000; cat. no. ab32124), anti-cleaved caspase-3 (1:500; cat. no. ab32042), anti-cleaved caspase-9 (1:500; cat. no. ab2324), anti-cyclooxygenase 2 (Cox-2; 1:1,000; cat. no. ab179800), anti-MMP-2 (1:1,000; cat. no. ab92536), anti-MMP-9 (1:1,000; cat. no. ab76003), anti-PITX2 (1:1,000; cat. no. ab221142) and anti-GAPDH (1:2,000; cat. no. ab181602). Following which, membranes were incubated with a HRP-conjugated anti-rabbit secondary antibody (1:10,000; cat. no. ab6721; Abcam) for 2 h at room temperature. Protein bands were visualized via enhanced chemiluminescence (Pierce; Thermo Fisher Scientific, Inc.) and were semi-quantified using ImageJ software (version 1.42; National Institutes of Health).
The starBase database (version 2.0; http://starbase.sysu.edu.cn/starbase2/) was used to predict the potential miRNA and miR-134-3p target genes. Wild-type (WT) and mutant (Mut) PCAT1 3′ untranslated regions (3′UTRs) were integrated into the pGL3 vector (Promega Corporation) to synthesize pGL3-PCAT1-WT and pGL3-PCAT1-Mut. The WT and Mut 3′UTRs of PITX2 were also integrated into the luciferase reporter plasmid psiCHECK-2 (Promega Corporation) to synthesize psiCHECK-2-PITX2-WT and psiCHECK-2-PITX2-Mut. SKBr-3 and MCF-7 cells at 5×104 cells/well in 24-well plates were co-transfected with WT or Mut PCAT1 3′UTR or Mut PITX2 3′UTR reporter plasmids and miR-134-3p mimic or mimic NC using Lipofectamine 2000 at 37°C for 48 h. Luciferase activity was detected using the Dual-Luciferase Reporter Assay System (Promega Corp.). Firefly luciferase activity was normalized to Renilla luciferase activity.
All presented data were obtained from at least three independent experiments. All of the data were carried out using GraphPad Prism 10.0. (GraphPad Software, Inc.). Data are presented as the mean ± standard deviation (SD). Statistical comparisons were determined using unpaired/paired Student's t-tests, Mann-Whitney U test or one-way ANOVA followed by Bonferroni's post hoc test. Pearson's correlation coefficient was used to analyze the correlation between the expression levels of PCAT1 and miR-134-3p in clinical BC samples. P<0.05 was considered to indicate a statistically significant difference.
The expression patterns of PCAT1 were determined to investigate its biological function in human BC cell lines. PCAT1 expression levels were evaluated in 30 paired human BC specimens and normal adjacent tissues. The results demonstrated that PCAT1 expression levels were significantly higher in BC specimens compared with those in normal adjacent tissues (Fig. 1A). Furthermore, PCAT1 expression levels in multiple human BC cell lines were upregulated compared with those in MCF10A cells, especially in SKBr-3 and MCF-7 cells (Fig. 1B). Therefore, to further investigate the role of PCAT1 in human BC, sh-PCAT1 and its scrambled control (sh-NC) were transfected into SKBr-3 and MCF-7 cells. The knockdown efficiency of sh-PCAT1 in SKBr-3 and MCF-7 cells was validated using RT-qPCR analysis. The results demonstrated that sh-PCAT1 significantly decreased PCAT1 expression levels compared with sh-NC (Fig. 1C). CCK-8 and colony formation assays demonstrated that PCAT1 knockdown significantly inhibited the proliferation of SKBr-3 and MCF-7 cells compared with the sh-NC group (Fig. 1D and E). Cell proliferation is closely connected with the cell cycle. Therefore, the effects of PCAT1 knockdown on the cell cycle in SKBr-3 and MCF-7 cells were investigated. The results demonstrated that PCAT1 knockdown significantly induced cell cycle arrest in the G1 phase compared with in the sh-NC group (Fig. 1F). At the molecular level, PCAT1 knockdown resulted in significantly downregulated cyclin D1 and significantly upregulated p21 protein expression levels compared with in the sh-NC group (Fig. 1G). Flow cytometry revealed that PCAT1 knockdown significantly promoted the apoptosis of SKBr-3 and MCF-7 cells compared with in the sh-NC group (Fig. 1H). Furthermore, the protein expression levels of apoptosis-related proteins were examined by western blotting. The results demonstrated that PCAT1 knockdown significantly reduced the protein expression levels of antiapoptotic protein Bcl-2, and significantly upregulated the protein expression levels of proapoptotic proteins, Bax, cleaved caspase-3 and cleaved caspase-9 in SKBr-3 and MCF-7 cells (Fig. 1I). Overall, these results indicated that knockdown of PCAT1 may inhibit proliferation and promote the apoptosis of human BC cells.
Wound healing and Transwell assays demonstrated that the migration and invasion of SKBr-3 and MCF-7 cells were significantly reduced in cells transfected with sh-PCAT1 compared with sh-NC (Fig. 2A and B). Western blotting also revealed that the protein expression levels of migration- and invasion-related proteins, Cox-2, MMP-2 and MMP-9, were significantly downregulated by sh-PCAT1 in SKBr-3 and MCF-7 cells compared with in the sh-NC group (Fig. 2C). Overall, these results indicated that sh-PCAT1 may inhibit the migration and invasion of human BC cells.
Subsequently, the molecular mechanism of PCAT1 in BC was investigated. Cytoplasmic and nuclear RNA were extracted from SKBr-3 and MCF-7 cells. The RT-qPCR results demonstrated that PCAT1 was significantly more highly expressed in the cytoplasmic fraction compared with in the nuclear fraction (Fig. 3A). Therefore, the starBase database was used to predict the potential miRNA PCAT1 interacted with, identifying miR-134-3p as a potential target (Fig. 3B). To evaluate the interaction between miR-134-3p and PCAT1, the dual-luciferase reporter assay was performed. The results demonstrated a significant decrease in luciferase activity in cells co-transfected with PCAT1-WT and miR-134-3p mimic compared with the NC-mimic (Fig. 3C). However, no significant difference was observed in luciferase activity between the miR-134-3p mimic group and NC mimic group when the putative binding sites were mutated (Fig. 3C). Furthermore, miR-134-3p expression levels in multiple human BC cell lines were significantly downregulated compared with those in MCF10A cells (Fig. 3D). miR-134-3p expression levels were upregulated when SKBr-3 and MCF-7 cells were transfected with sh-PCAT1 compared with sh-NC (Fig. 3E). These results indicated that PCAT1 may function as a sponge for miR-134-3p in SKBr-3 and MCF-7 cells.
In order to investigate the biological function of miR-134-3p in BC progression, miR-134-3p mimic and NC mimic were transfected into SKBr-3 and MCF-7 cells. RT-qPCR was performed to confirm the overexpression efficiency of miR-134-3p mimic in SKBr-3 and MCF-7 cells. Compared with the NC mimic, miR-134-3p expression levels were significantly upregulated by miR-134-3p mimic transfection (Fig. 4A). CCK-8 and colony formation assays demonstrated that miR-134-3p mimic significantly inhibited the proliferation of SKBr-3 and MCF-7 cells compared with the NC mimic (Fig. 4B and C). Furthermore, flow cytometry elucidated that miR-134-3p overexpression significantly promoted cell apoptosis in SKBr-3 and MCF-7 cells compared with the NC mimic (Fig. 4D). The Transwell assay further demonstrated that migration and invasion were significantly reduced in SKBr-3 and MCF-7 cells transfected with miR-134-3p mimic compared with the NC mimic (Fig. 4E). These data indicated that miR-134-3p overexpression may inhibit cell proliferation, migration and invasion but promote apoptosis in human BC cells.
To explore the regulatory mechanism of miR-134-3p in BC progression, the starBase database was used to predict miR-134-3p target genes and identified PITX2 as a potential target (Fig. 5A). The dual-luciferase reporter assay was used to determine the interaction between miR-134-3p and PITX2. The results demonstrated that luciferase activity was significantly reduced when the cells were co-transfected with PITX2-WT and miR-134-3p mimics. However, there was no significant difference in luciferase activity of PITX2-Mut between cells transfected with miR-134-3p mimic or NC mimic (Fig. 5B). To further analyze the association between PITX2 and miR-134-3p, RT-qPCR and western blotting were used. The results demonstrated that PITX2 mRNA and protein expression levels were significantly decreased by miR-134-3p mimic in SKBr-3 and MCF-7 cells compared with the NC mimic (Fig. 5C and D). Furthermore, PITX2 mRNA expression levels were significantly increased in BC cells (MDA-MB-231, ZR-75-30, SKBr-3 and MCF-7) compared with those in MCF10A cells (Fig. 5E). Pearson's correlation coefficient analysis demonstrated a negative correlation between PCAT1 and miR-134-3p expression levels, and between miR-134-3p and PITX2 expression levels in clinical BC samples (Fig. 5F and G). These results indicated that PITX2 may be a downstream target gene of miR-134-3p and that PCAT1 may regulate PITX2 expression via miR-134-3p.
Rescue experiments were performed to investigate the functions of PCAT1, miR-134-3p and PITX2 in human BC cells. Transfection efficiency is shown in Fig. S1A and B. miR-134-3p expression levels were significantly downregulated when cells were co-transfected with miR-134-3p inhibitor and sh-PCAT1, in SKBr-3 and MCF-7 cells, compared with NC inhibitor and sh-PCAT1. PITX2 mRNA expression levels were also significantly downregulated when cells were co-transfected with sh-PITX2 and sh-PCAT1 in SKBr-3 and MCF-7 cells, compared with sh-NC and sh-PCAT1 (Fig. 6A). Colony formation and CCK-8 assays demonstrated PITX2 knockdown significantly reversed the effect of miR-134-3p inhibition on the proliferation of SKBr-3 and MCF-7 cells transfected with sh-PCAT1 compared with the miR-134-3p inhibitor + sh-NC group (Fig. 6B and C). Subsequently, an apoptotic assay was performed via flow cytometry. Compared with miR-134-3p inhibitor + sh-NC, the results demonstrated that sh-PITX2 significantly reversed the suppressive effects of miR-134-3p inhibitor on cell apoptosis in SKBr-3 and MCF-7 cells following PCAT1 knockdown (Fig. 6D). Moreover, Transwell assays demonstrated that sh-PITX2 significantly reversed miR-134-3p inhibitor-enhanced cell migration and invasion of PCAT1-knockdown SKBr-3 and MCF-7 cells compared with the miR-134-3p inhibitor + sh-NC group (Fig. 6E). Overall, these results demonstrated that sh-PITX2 could reverse the function of the miR-134-3p inhibitor on SKBr-3 and MCF-7 cells, suggesting that PITX2 serves a role in BC tumorigenesis via the miRNA ‘sponge’ mechanism.
BC is one of the most common types of cancer in women (21,22), with ~500,000 BC-related deaths each year. Traditional therapeutic approaches, such as surgery and chemotherapy, rarely completely cure BC and the treatment process is painful; in addition, most patients will develop recurrence following treatment (23). Therefore, the identification of novel treatment strategies is important and urgently needed. Previous studies have reported that lncRNAs are crucial regulators involved in cancer-related gene expression and cancer development (8,17,24). Consequently, lncRNAs may become new potential therapeutic targets in clinical applications (25).
lncRNA PCAT1 was first discovered to be upregulated in patients with prostate cancer, whereby it was demonstrated to promote prostate cell proliferation (17). Previous studies have reported that PCAT1 knockdown may inhibit malignant phenotypes in numerous types of human cancer, including gastric cancer, lung cancer and hepatocellular carcinoma (26–28). lncRNA PCAT1 has been shown to be upregulated in human non-small cell lung cancer (NSCLC), and knockdown of PCAT1 can markedly suppress cell growth by inducing cell cycle arrest and apoptosis in NSCLC cells (28). In the present study, PCAT1 expression levels were found to be significantly upregulated in BC cell lines in comparison with the non-tumorigenic epithelial MCF10A cell line. Downregulation of PCAT1 expression levels was significantly associated with the inhibition of BC cell proliferation and an increase in apoptosis-related protein expression levels. These data demonstrated that PCAT1 possibly promotes the progression of BC.
lncRNAs are considered to play an important regulatory role in carcinogenesis and cancer development. They regulate the interaction between proteins and genes as a scaffold or guide, and act as a bait for binding proteins or miRNA (29). The interaction between lncRNA and miRNA functional networks has attracted much attention (30). lncRNAs can function by sponging miRNAs to regulate the expression of specific genes (19) and can therefore affect cancer progression. For example, lncRNA nuclear paraspeckle assembly transcript 1 has been reported to be upregulated in BC and to inhibit the activation of the miR-133b/translocase of inner mitochondrial membrane 17A axis (29). lncRNA PCAT1 was also shown to promote ESCC cell proliferation by sponging miR-326 and may therefore serve as a non-invasive biomarker for ESCC (19). Increasing evidence has indicated that miR-134 is essential for human carcinoma, including lung, BC and colorectal cancer, and that it participates in tumor cell proliferation, apoptosis, invasion and metastasis (31–35). miR-134-3p, as a member of the miR-134 family, has been reported to have a significant regulatory role in non-small cell lung cancer proliferation and invasion (31). Although the downstream mechanism of miR-134-3p in cancer progression has been extensively studied, to the best of our knowledge, the upstream regulatory mechanism of miR-134-3p has not been elucidated until now. In the present study, miR-134-3p was identified as a target of PCAT1 and miR-134-3p expression levels were significantly downregulated in BC cell lines, which was negatively associated with PCAT1 expression levels. Moreover, miR-134-3p mimic significantly inhibited cell proliferation, migration and invasion, but significantly increased the apoptotic rate of BC cell lines. Together, these results demonstrated that PCAT1 may regulate BC progression by sponging miR-134-3p.
PITX2 was predicted to be a possible target of miR-134-3p by bioinformatics analysis, but the mechanisms of miR-134-3p and PITX2 in BC remain unclear. Previous studies have highlighted the association of PITX2 with the progression of numerous types of human cancer, including gonadotroph tumors and colorectal cancer (36–38). In the present study, PITX2 was experimentally confirmed as a target of miR-134-3p. PITX2 mRNA expression levels were negatively associated with miR-134-3p expression levels. Moreover, sh-PITX2 partially significantly reduced the lncRNA PCAT1/miR-134-3p knockdown-mediated effects on cell proliferation, migration, invasion and apoptosis in BC cell lines.
Overall, these findings demonstrated that PCAT1 may induce the downregulation of PITX2 expression levels in BC progression possibly via the upregulation of miR-134-3p expression levels. Each of the three molecules in the PCAT1/miR-134-3p/PITX2 axis may become a novel therapeutic target for the treatment of BC, which is of crucial significance for the clinical prevention and diagnosis of BC. However, the detailed mechanisms of how PITX2 functions in BC requires further investigation.
Not applicable.
Funding: No funding was received.
All data generated or analyzed during this study are included in this published article.
YX, WT, GL and YJ contributed to the conception and design of the present study, and were responsible for the acquisition, analysis and interpretation of the data. YX and WT confirm the authenticity of all the raw data. YX and WT drafted and critically revised the work for important intellectual content. YX gave final approval of the version to be published. YX and WT agree to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All authors read and approved the final manuscript.
The experimental protocol of the present study was in accordance with the Declaration of Helsinki and was approved by the Ethics Committee of the Liyang People's Hospital (Liyang, China; approval no. 2018024). Written informed consent was obtained from all patients.
Not applicable.
The authors declare that they have no competing interests.
|
Lu G, Li Y, Ma Y, Lu J, Chen Y, Jiang Q, Qin Q, Zhao L, Huang Q, Luo Z, et al: Long noncoding RNA LINC00511 contributes to breast cancer tumourigenesis and stemness by inducing the miR-185-3p/E2F1/Nanog axis. J Exp Clin Cancer Res. 37:2892018. View Article : Google Scholar : PubMed/NCBI | |
|
Xia W, Liu Y, Cheng T, Xu T, Dong M and Hu X: Down-regulated lncRNA SBF2-AS1 inhibits tumorigenesis and progression of breast cancer by sponging microRNA-143 and repressing RRS1. J Exp Clin Cancer Res. 39:182020. View Article : Google Scholar : PubMed/NCBI | |
|
Corey B, Smania MA, Spotts H and Andersen M: Young Women With Breast Cancer: Treatment, Care, and Nursing Implications. Clin J Oncol Nurs. 24:139–147. 2020. View Article : Google Scholar : PubMed/NCBI | |
|
Guo Q, Lv S, Wang B, Li Y, Cha N, Zhao R, Bao W and Jia B: Long non-coding RNA PRNCR1 has an oncogenic role in breast cancer. Exp Ther Med. 18:4547–4554. 2019.PubMed/NCBI | |
|
Zhou Y, Meng X, Chen S, Li W, Li D, Singer R and Gu W: IMP1 regulates UCA1-mediated cell invasion through facilitating UCA1 decay and decreasing the sponge effect of UCA1 for miR-122-5p. Breast Cancer Res. 20:322018. View Article : Google Scholar : PubMed/NCBI | |
|
Huang Z, Zhou JK, Peng Y, He W and Huang C: The role of long noncoding RNAs in hepatocellular carcinoma. Mol Cancer. 19:772020. View Article : Google Scholar : PubMed/NCBI | |
|
Gugnoni M and Ciarrocchi A: Long Noncoding RNA and Epithelial Mesenchymal Transition in Cancer. Int J Mol Sci. 20:202019. View Article : Google Scholar | |
|
Guo Q, Zhang Q, Lu L and Xu Y: Long noncoding RNA RUSC1-AS1 promotes tumorigenesis in cervical cancer by acting as a competing endogenous RNA of microRNA-744 and consequently increasing Bcl-2 expression. Cell Cycle. 19:1222–1235. 2020. View Article : Google Scholar : PubMed/NCBI | |
|
Schmitt AM and Chang HY: Long Noncoding RNAs in Cancer Pathways. Cancer Cell. 29:452–463. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Fan S, Yang Z, Ke Z, Huang K, Liu N, Fang X and Wang K: Downregulation of the long non-coding RNA TUG1 is associated with cell proliferation, migration, and invasion in breast cancer. Biomed Pharmacother. 95:1636–1643. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Zeng H, Wang J, Chen T, Zhang K, Chen J, Wang L, Li H, Tuluhong D, Li J and Wang S: Downregulation of long non-coding RNA Opa interacting protein 5-antisense RNA 1 inhibits breast cancer progression by targeting sex-determining region Y-box 2 by microRNA-129-5p upregulation. Cancer Sci. 110:289–302. 2019.PubMed/NCBI | |
|
Davalos V and Esteller M: Disruption of Long Noncoding RNAs Targets Cancer Hallmark Pathways in Lung Tumorigenesis. Cancer Res. 79:3028–3030. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Hu CC, Liang YW, Hu JL, Liu LF, Liang JW and Wang R: lncRNA RUSC1-AS1 promotes the proliferation of breast cancer cells by epigenetic silence of KLF2 and CDKN1A. Eur Rev Med Pharmacol Sci. 23:6602–6611. 2019.PubMed/NCBI | |
|
Yang G, Fu Y, Lu X, Wang M, Dong H and Li Q: lncRNA HOTAIR/miR-613/c-met axis modulated epithelial-mesenchymal transition of retinoblastoma cells. J Cell Mol Med. 22:5083–5096. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Liang Y, Li Y, Song X, Zhang N, Sang Y, Zhang H, Liu Y, Chen B, Zhao W, Wang L, et al: Long noncoding RNA LINP1 acts as an oncogene and promotes chemoresistance in breast cancer. Cancer Biol Ther. 19:120–131. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Shang Z, Yu J, Sun L, Tian J, Zhu S, Zhang B, Dong Q, Jiang N, Flores-Morales A, Chang C, et al: lncRNA PCAT1 activates AKT and NF-κB signaling in castration-resistant prostate cancer by regulating the PHLPP/FKBP51/IKKα complex. Nucleic Acids Res. 47:4211–4225. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Ding C, Wei R, Rodríguez RA and Del Mar Requena Mullor M: lncRNA PCAT-1 plays an oncogenic role in epithelial ovarian cancer by modulating cyclinD1/CDK4 expression. Int J Clin Exp Pathol. 12:2148–2156. 2019.PubMed/NCBI | |
|
Zhen Q, Gao LN, Wang RF, Chu WW, Zhang YX, Zhao XJ, Lv BL and Liu JB: lncRNA PCAT-1 promotes tumour growth and chemoresistance of oesophageal cancer to cisplatin. Cell Biochem Funct. 36:27–33. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Huang L, Wang Y, Chen J, Wang Y, Zhao Y, Wang Y, Ma Y, Chen X, Liu W, Li Z, et al: Long noncoding RNA PCAT1, a novel serum-based biomarker, enhances cell growth by sponging miR-326 in oesophageal squamous cell carcinoma. Cell Death Dis. 10:5132019. View Article : Google Scholar : PubMed/NCBI | |
|
Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA and Jemal A: Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 68:394–424. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Feng RM, Zong YN, Cao SM and Xu RH: Current cancer situation in China: Good or bad news from the 2018 Global Cancer Statistics? Cancer Commun (Lond). 39:222019. View Article : Google Scholar : PubMed/NCBI | |
|
Tang R, Wu JC, Zheng LM, Li ZR, Zhou KL, Zhang ZS, Xu DF and Chen C: Long noncoding RNA RUSC1-AS-N indicates poor prognosis and increases cell viability in hepatocellular carcinoma. Eur Rev Med Pharmacol Sci. 22:388–396. 2018.PubMed/NCBI | |
|
Shen WJ, Zhang F, Zhao X and Xu J: lncRNAs and Esophageal Squamous Cell Carcinoma - Implications for Pathogenesis and Drug Development. J Cancer. 7:1258–1264. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Hou J, Wang L, Wu Q, Zheng G, Long H, Wu H, Zhou C, Guo T, Zhong T, Wang L, et al: Long noncoding RNA H19 upregulates vascular endothelial growth factor A to enhance mesenchymal stem cells survival and angiogenic capacity by inhibiting miR-199a-5p. Stem Cell Res Ther. 9:1092018. View Article : Google Scholar : PubMed/NCBI | |
|
Bi M, Yu H, Huang B and Tang C: Long non-coding RNA PCAT-1 over-expression promotes proliferation and metastasis in gastric cancer cells through regulating CDKN1A. Gene. 626:337–343. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Wen J, Xu J, Sun Q, Xing C and Yin W: Upregulation of long non coding RNA PCAT-1 contributes to cell proliferation, migration and apoptosis in hepatocellular carcinoma. Mol Med Rep. 13:4481–4486. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Li J, Li Y, Wang B, Ma Y and Chen P: lncRNA-PCAT-1 promotes non-small cell lung cancer progression by regulating miR-149-5p/LRIG2 axis. J Cell Biochem. Dec 19–2018.(Epub ahead of print). doi: 10.1002/jcb.28046. | |
|
Li X, Deng S, Pang X, Song Y, Luo S, Jin L and Pan Y: lncRNA NEAT1 Silenced miR-133b Promotes Migration and Invasion of Breast Cancer Cells. Int J Mol Sci. 20:202019. | |
|
Chen L, Zhou Y and Li H: lncRNA, miRNA and lncRNA-miRNA interaction in viral infection. Virus Res. 257:25–32. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Qin Q, Wei F, Zhang J and Li B: miR-134 suppresses the migration and invasion of non small cell lung cancer by targeting ITGB1. Oncol Rep. 37:823–830. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Qin Q, Wei F, Zhang J, Wang X and Li B: miR-134 inhibits non-small cell lung cancer growth by targeting the epidermal growth factor receptor. J Cell Mol Med. 20:1974–1983. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Xie Y, Song J, Zong Q, Wang A, Yang Y, Liu F and Meng X: Decreased Expression of MIR-134 and its Clinical Significance in Human Colorectal Cancer. Hepatogastroenterology. 62:615–619. 2015.PubMed/NCBI | |
|
Zhang J, Ma Y, Wang S, Chen F and Gu Y: C/EBPα inhibits proliferation of breast cancer cells via a novel pathway of miR-134/CREB. Int J Clin Exp Pathol. 8:14472–14478. 2015.PubMed/NCBI | |
|
Pan JY, Zhang F, Sun CC, Li SJ, Li G, Gong FY, Bo T, He J, Hua RX, Hu WD, et al: miR-134: A Human Cancer Suppressor? Mol Ther Nucleic Acids. 6:140–149. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Acunzo J, Roche C, Defilles C, Thirion S, Quentien MH, Figarella-Branger D, Graillon T, Dufour H, Brue T, Pellegrini I, et al: Inactivation of PITX2 transcription factor induced apoptosis of gonadotroph tumoral cells. Endocrinology. 152:3884–3892. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Hirose H, Ishii H, Mimori K, Tanaka F, Takemasa I, Mizushima T, Ikeda M, Yamamoto H, Sekimoto M, Doki Y, et al: The significance of PITX2 overexpression in human colorectal cancer. Ann Surg Oncol. 18:3005–3012. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Zhang JX, Chen ZH, Xu Y, Chen JW, Weng HW, Yun M, Zheng ZS, Chen C, Wu BL, Li EM, et al: Downregulation of MicroRNA-644a Promotes Esophageal Squamous Cell Carcinoma Aggressiveness and Stem Cell-like Phenotype via Dysregulation of PITX2. Clin Cancer Res. 23:298–310. 2017. View Article : Google Scholar : PubMed/NCBI |