Open Access

MicroRNA‑141 inhibits the differentiation of bone marrow‑derived mesenchymal stem cells in steroid‑induced osteonecrosis via E2F3

  • Authors:
    • Fei Xue
    • Jian Wu
    • Wei Feng
    • Ting Hao
    • Yuan Liu
    • Wenbo Wang
  • View Affiliations

  • Published online on: May 25, 2022     https://doi.org/10.3892/mmr.2022.12750
  • Article Number: 234
  • Copyright: © Xue et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Osteonecrosis of the femoral head (ONFH) affects the life of patients. MicroRNA‑141 (miR‑141) has been found associated with proliferation of bone marrow‑derived mesenchymal stem cells (BMSCs). E2F transcription factor 3 (E2F3) has been identified as the target of miR‑141 to regulate cell proliferation. The aim of the present study was to investigate whether miR‑141 and E2F3 were involved in the osteogenic differentiation of BMSCs during ONFH. BMSCs from 4‑week‑old Sprague‑Dawley rats were transduced with miR‑141 mimic or inhibitor lentiviruses. Alkaline phosphatase staining was performed to confirm osteogenic differentiation. Reverse transcription‑quantitative PCR, luciferase reporter assays and western blot analysis were also used to examine the interaction between E2F3 and miR‑141 in BMSCs from the control and ONFH rats. The lentiviral transductions were carried out successfully. The mRNA expression levels of miR‑141 in ONFH were upregulated, while those of E2F3 were downregulated compared with the control rat. The luciferase reporter assays indicated that miR‑141 could target E2F3. miR‑141 knockdown upregulated the mRNA expression levels of E2F3. In addition, osteogenic differentiation of BMSCs was inhibited following miR‑141 overexpression, but increased following miR‑141 knockdown, as evidenced by the results of the alkaline phosphatase staining and western blot analysis. In conclusion, miR‑141 inhibits the osteogenic differentiation of BMSCs in ONFH by targeting E2F3. These two molecules may represent novel candidates to examine in order to investigate the mechanism underlying ONFH.

Introduction

Glucocorticoids have been widely used for the treatment of various pathological conditions, such as allergies, inflammatory conditions, malignancies and immunological diseases. Steroid-induced avascular necrosis of the femoral head can be triggered following steroid-pulse therapy and long-term use of glucocorticoids (1,2). It has been found that steroid-induced avascular necrosis of the femoral head is the most common type of non-traumatic osteonecrosis of the femoral head (3). It is estimated that 75,000-150,000 new cases of ONFH are diagnosed every year in China (4). Reduced bone mass and trabecular fracture may occur after the third stage of ONFH as a result of cell death in the femoral head (5). Femoral head collapse and osteoarthritis eventually require artificial joint replacement to improve patient quality of life, which causes a heavy economic burden for society. Therefore, early detection of ONFH and protection of the femoral head are necessary for patient quality of life. However, as the molecular mechanism underlying the cause of ONFH is not entirely clear, effective treatment options are still lacking. The mechanism may be connected with abnormal lipid distribution, which can induce the formation of microemboli in the arteries supplying the femoral head (6). Additionally, apoptosis and autophagy of osteocytes are regulated by glucocorticoids (5,7) which have multiple effects on bone formation through lipid metabolism (8). Previous studies have demonstrated that, following inhibition of the Wnt/β-catenin pathway, peroxisome proliferator-activated receptor levels are increased by sclerostin production, causing pluripotent precursor cells to differentiate into adipocytes, rather than osteoblasts (9,10). Thus, modulating lipid metabolism disorders and improving bone mass may be critical factors in the prevention of ONFH.

Bone marrow-derived mesenchymal stem cells (BMSCs) are primitive cells that have the potential to differentiate into adipocytes, chondrocytes, osteoblasts and osteocytes (11,12). Bone resorption and bone formation are balanced by osteoclasts and osteoblasts in order to maintain bone mass homeostasis (13). Matsuya et al (14) found that autologous BMSC injection into the femoral head can slow down the progression of ONFH. Lipid metabolism and osteogenic differentiation are also strongly associated with BMSC function (15). Another study has confirmed that glucocorticoids can inhibit the osteogenic differentiation and proliferation of BMSCs (16), which can reduce BMSC numbers (16). In addition, in the long-term, BMSC metabolism and differentiation are reduced as a result of an imbalance in bone mass homeostasis, thus increasing bone fragility (17). Tian and Yu (15) have suggested that the proliferation of BMSCs is impaired in ONFH. The results of the aforementioned studies suggest that improved understanding of the mechanisms underlying BMSC proliferation and differentiation may provide insight into the pathogenesis of ONFH.

MicroRNA (miRNA/miR) is a type of small non-coding single-stranded RNA molecule which binds to the 3′-untranslated region (UTR) of target genes (18). Sedwick and Ambros were the first to propose that >30% of human genes could be regulated by miRNA (19). It has also been reported that miRNA is involved in the regulation of BMSC differentiation and proliferation (14,16). Moreover, miR-141 has been shown to inhibit proliferation and migration in several tumor cell types, such as osteosarcoma cells, SW480 colorectal cancer cells and hepatocellular carcinoma (HCC) cells (2022). Overexpression of miR-141 inhibits the proliferation, migration and invasion of HCC cells (21). miR-141 is also associated with tissue repair and osteogenic differentiation (23). Indeed, miR-141 inhibits the proliferation of BMSCs; inhibition of miR-141 can promote the proliferation of BMSCs (24) and their osteogenic differentiation (5), possibly by targeting vitamin C transporter 2 (25). Therefore, the inhibition of miR-141 could be harnessed for the prevention and treatment of osteonecrosis caused by glucocorticoids.

E2F transcription factor 3 (E2F3) is a member of the E2F transcription factor family, which is involved in the regulation of cell proliferation (26). E2F3 has been identified as the target of miR-141 in HCC cells, and the overexpression of E2F3 can partially reverse the tumor-suppressive effects of miR-141 (27). It has been demonstrated that E2f3+/− Sprague-Dawley rat embryos develop normally without fatal disease. However, weight loss, delayed growth and skeletal dysplasia were observed, indicating that E2F3 played a key role in muscle and skeletal development (28). However, how E2F3 functions in different tissues and environments remains unclear.

To the best of our knowledge, few studies have evaluated the role of E2F3 in osteogenic differentiation. It may be hypothesized that E2F3 could promote osteogenic differentiation of BMSCs and that miR-141 could inhibit the process by targeting this transcription factor. A previous study has indicated that E2F3 may be the target of microRNA (27). The aim of the present study was to evaluate the role of miR-141 and E2F3 in BMSC proliferation in ONFH. In addition, the role of miR-141 and E2F3 in the femoral head bone tissue changes induced by glucocorticoids was also examined.

Materials and methods

Isolation of rat BMSCs

After 7 days adaptive feeding (26°C, 60% humidity, 12 h of light and 12 h of darkness every day, 200 ml water per day, free access to food), animal health and behavior were monitored every day. In the present study, two 4-week-old male Sprague Dawley rats (SCXK2017-0001) were used (29). Their weights were 70.2 and 70.3 g, respectively. The rats were anesthetized by intraperitoneal injection of pentobarbital sodium (3% solution for a dose of 40 mg/kg), then sacrificed by cervical dislocation. The rats were immersed in 75% ethanol for about 5–10 min, and dissection was carried out under sterile conditions. The bilateral femurs and tibia were removed with sterile surgical instruments, and the attached muscles were removed. Three holes were made in the femur and tibia, and a 10-ml syringe was used to extract medium inserted into the femurs and tibia. The cells in the bone marrow were repeatedly flushed into a Petri dish until the femur and tibia were pale.

The cell suspensions were collected, purified and centrifuged at 100 × g for 5 min at room temperature, then re-suspended in α-MEM (HyClone; Cytiva) and incubated at 37°C with 5% CO2. When the cells reached 80–90% confluence, the culture medium was removed. The cells were trypsinized and washed in PBS (HyClone; Cytiva). Trypsin (HyClone; Cytiva) was used for digestion for 3 min. The cells were then sub-cultured at a 1 in 3 ratio.

Transfection and lentiviral transduction

Transfection was used for luciferase assay.miR-141 mimics were purchased from Shanghai Gemma Pharmaceutical. Lipofectamine® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) was used to transfect BMSCs according to the manufacturer's instructions. A total of 1 µg plasmid (100 nM miRNA mimic) was diluted with 50 µl serum-free Opti-MEM. The plasmid was mixed gently and incubated at room temperature for 5 min. B. Lipo3000 was diluted with 50 µl serum-free OPti-MEM, mix gently and incubate at room temperature for 5 min. MiR-141 mimic and lipo3000 were mixed and stood at room temperature for 20 min before transfection into cells. Subsequent luciferase assay was performed following transfection for 48 h.

The sequences used were as follows: NC, 5′-UUCUCCGAACGUGUCACGUTT-3′ and 5′-ACGUGACACGUUCGGAGAATT-3′; miR-141 mimic.

Lentiviral transduction was used in subsequent experiments including alkaline phosphatase stain and mRNA and protein expression of E2F3The lentivirus was packaged by Shanghai GenePharma, using a 3rd-generation lentiviral packaging system. For lentivirus production, the packaging plasmids (pGag/Pol, pRev, pVSV-G) and shuttle plasmid pLV2 were transfected into 293T cells (Genepharma, Shanghai). The supernatant of the 293T cells was collected by centrifugation at 1,000 g for 4 h at 4°C, then transferred to a syringe and filtered using a 0.45-µm filter. The plasmid was mixed with 1.5 ml serum-free DMEM medium and stood at room temperature for 20 min before transfection. Plasmid ratio 8 µg LV2 shuttle plasmid, 8 µg pGag/Pol, 4 µg pRev, 6 µg PVSV-g. 300 µl liposome was mixed in 1.2 ml serum-free medium, and left at room temperature for 5 min. Plasmid and liposome were mixed and stood at room temperature for 20 min. Then add into 293T cell culture medium. After 6 h incubation, medium was removed, and the medium containing serum was added, and the supernatant was collected after 72 h culture at 37°C The filtrate was centrifuged at 23,000 g for 4 h at 4°C. The plates were shaken evenly, then placed into the incubator for culture. Positive cells were screened with 0.5 µg/ml puromycin and maintained at a concentration of 2 µg/ml After 6 h of cell culture, the medium containing the virus was replaced with fresh medium for another 72 h before subsequent experiments (cell proliferation assays and mRNA analysis).

Cell osteogenesis induction

BMSCs were inoculated at a density of 1×105 cells and infected with lentivirus. BMSCs were collected from the control and the ONFH rat. Cell osteogenesis induction was carried out as previously reported by Yaghoobi et al (30). The BMSCs were digested with trypsin (HyClone; Cytiva) when they reached 80–90% confluence, then centrifuged at 100 × g for 5 min at room temperature. The supernatant was removed, and α-MEM (HyClone; Cytiva) was added to resuspended the BMSCs in a 24-well culture plate. The BMSCs were cultured to 70% confluence, then the culture medium was removed and replaced with osteogenic induction culture medium (Cyagen; cat. no. RASMX-90021). The medium was changed every 3 days thereafter. The osteogenesis levels were examined at day 3, 7 and 14 using alkaline phosphatase staining (31). Images were taken and saved for ALP assay.

Alkaline phosphatase staining

A total of 1×105 cells were inoculated in 24-well plates. The cells were cultured to 60–70% confluence, then the culture medium was replaced with osteogenic induction culture medium. The osteogenic medium was changed every 3 days, and the cells were washed with PBS at the end of the osteogenic induction process. On days 3, 7 and 14, the BMSCs were fixed with 10% formaldehyde solution at room temperature for 30 min, then washed with PBS twice. The fixed cells were then stained with 50 µl alkaline phosphatase solution at 37°C for 2 h (32).

Luciferase assays

For luciferase assays, the pGL6-mir reporter plasmid (Beyotime Institute of Biotechnology; cat. no. D2106) and the Renilla prL-TK plasmid (Promega; cat. no. E2241) were transfected using Lipofectamine 3000 (Invitrogen; Thermo Fisher Scientific, Inc.; cat. no. L30000015). The 3′-UTR of E2F3 was amplified by PCR as previously described (33), then cloned into the pGL6-mir reporter vector (Beyotime Institute of Biotechnology; cat. no. D2106). BMSCs were co-transfected with the wild-type or mutant pGL6-mir reporter vector (100 ng/well), and either miR-141 mimic or NC (100 ng/well). The cells were lysed 48 h post-transfection in order to measure luciferase activity (34) using the Dual Luciferase Reporter Assay System (Promega Corporation). Renilla luciferase activity was used for normalization.

RT-qPCR

Total RNA from cells was isolated using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. cDNA was reverse transcribed using Prime Script RT Reagent kit at 42°C for 60 min and 70°C for 10 min (Takara Biotechnology Co., Ltd.). qPCR was carried out using SYBR Premix Ex Taq (Takara Biotechnology Co., Ltd.) on an ABI StepOne Plus Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). The thermocycling protocol consisted of an initial denaturation for 5 min at 95°C followed by 40 cycles at 95°C for 10 sec and 60°C for 34 sec (3537). The relative mRNA levels were obtained using the 2−ΔΔCt method (38). Reverse transcription of miRNA and quantitative PCR primers were purchased from Guangzhou Ribobio Co., Ltd. The experiments were repeated five times. The reference gene for miR-141 was U6 and the reference gene for E2F3 was GAPDH. Primers (General Biosystems) were as follows: E2F3 forward, 5′-CGAGAGTGGCCATCAGTACC-3′ and reverse, 5′-CCTCTTCTGCACCTTGAGCA-3′ and GAPDH F-5′ TTCACCACCATGGAGAAGGC 3′ R-5′ AGTGATGGCATGGACTGTG 3′.

Western blot analysis of E2F3 protein expression

At day 3, 7 and 14, after discarding the RASMX-90021 medium (Cyagen; cat. no. RASMX-90021) and α-MEM (HyClone; Cytiva; SH30265) the cells were lysed in RIPA lysis buffer at 4°C overnight. The total protein was harvested via centrifugation at 13,600 g and the protein concentration was determined using the BCA method (Beyotime Institute of Biotechnology; cat. no. P0010). RIPA buffer included 50 mmol/l Tris-HCl, pH8.0, 150 mmol/L NaCl, 1% TritonX-100, 100 µg/ml PMSF.: A total of 30 µg protein per lane was separated using SDS-PAGE on 8% gels, then transferred to a PVDF membrane (MilliporeSigma; cat. no. ISEQ00010). The membrane was then blocked with 5% skim milk in 0.1% Tween-20 Tris-buffered saline at room temperature for 1 h. The membranes were incubated with anti-E2F3 (ProteinTech Group, Inc.; cat. no. 12344-1-AP; diluted 1:1,000) or rabbit anti-GAPDH (Abbkine Scientific Co., Ltd.; cat. no. A01020; diluted 1:5,000) antibodies at 4°C overnight. This was followed by incubation with HRP-conjugated anti-mouse (Beyotime Institute of Biotechnology; cat. no. A0216; diluted at 1:5,000) or anti-rabbit (Beyotime Institute of Biotechnology; cat. no. A0208; diluted 1:5,000) at room temperature for 2 h. The bands were visualized using ECL reagent (Tanon Science and Technology Co., Ltd.; cat. no. 180-5001) (39). GAPDH was used as loading control. Chemiluminescence instrument (Tanon, 5200) was used for densitometry. The software for densitometry was GelCap 1.0 (Tanon).

Statistical analysis

Each experiment was performed three times, and the results are shown as the mean ± standard deviation. SPSS 23.0 software (SPSS, Inc.) was used for statistical analysis. The differences between two groups were compared by unpaired Student's t test. The differences between three or more groups were compared using one-way analysis of variance followed by Tukey's post hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

Identification of BMSCs and osteogenic induction

The morphology of BMSCs at day 0 under an optical microscope is shown in Fig. 1. BMSCs were round in shape, with strong refraction, and varied in size. In addition, osteogenesis was examined at days 3, 7 and 14. Osteogenesis levels were higher in the control than in the ONFH group, as evidenced by cell density and osteogenic capability (Fig. 1).

Alkaline phosphatase staining

Alkaline phosphatase staining is shown in Fig. 2. The results suggested that the control group was markedly darker than the ONFH group at days 3, 7 and 14 days (Fig. 2A). BMSCs from the normal rat were then transduced with, miR-141 mimic lentivirus (miR-141), whereas those of the ONFH rat were transduced with miR-141 inhibitor lentivirus. Following transduction with the miR-141-3p mimic lentivirus, alkaline phosphatase staining in BMSCs from the normal was reduced compared with the NC. Following transduction with the miR-141 inhibitor lentivirus, alkaline phosphatase staining in BMSCs from the ONFH rat was increased compared with the inhibitor NC. These results suggest that miR-141 expression is associated with osteogenesis.

Association between E2F3 and miR-141

In order to examine the regulatory relationship between E2F3 and miR-141, luciferase reporter assays were used to determine whether miR-141 could target E2F3 expression directly through its UTR. In the wild-type group, the average E2F3 luciferase activity was significantly lower than that of the NC group (P<0.005; Fig. 3). However, average E2F3 luciferase activity in the mutant remained unchanged following transduction the miR-141-3p overexpression lentivirus.

Successful miR-141 mimic transduction in normal BMSCs and miR-141 inhibitor transduction in BMSCs from the ONFH rat are shown in Fig. 4A (left; all P<0.01). Furthermore, RT-qPCR demonstrated that the expression levels of miR-141 in the ONFH group were significantly higher than those of the control group at days 3, 7 and 14 (all P<0.01; Fig. 4A, right). The mRNA expression of E2F3 was significantly lower in the ONFH group than in the control group at all time points (all P<0.01; Fig. 4B). This suggests that the expression of E2F3 is inversely associated with that of miR-141.

Protein expression levels of E2F3

The protein expression levels of E2F3 were determined using western blotting. E2F3 expression was significantly reduced BMSCs from the ONFH rat than those from the control rat (Fig. 5A). The protein expression levels of E2F3 were significantly downregulated following transduction with the miR-141 overexpression lentivirus, compared with BMSCs transduced with the NC lentivirus. However, E2F3 was upregulated in BMSCs from the OPNFH rat transduced with the miR-141 inhibitor lentivirus, compared with miR-141 inhibitor Nc lentivirus (Fig. 5B). This confirmed that miR-141 significantly downregulated the protein expression levels of E2F3.

Discussion

ONFH is a progressive and painful hip joint disorder affecting individuals in the 30–50 year age range (40). Previous studies have suggested that glucocorticoids are associated with lipid metabolism. Glucocorticoids facilitate decomposition of lipid into glycerol and free fatty acids via direct action. Glucocorticoids inhibit phosphodiesterase and CMP conversion to 5-terminal AMP. Glucocorticoids increase fatty acids by upregulating the activity of phenethylamylmethyltransferase, and adipose tissue. (41). Lipid metabolism and osteogenic differentiation are associated with BMSCs since BMSCs undergo adipose differentiation and osteogenic differentiation. Differentiation of BMSCs is regulated by miRNA (15,42). Lipid metabolism could lead to the collapse of the trabecular bone, causing empty lacunae and microfractures in ONFH (43). Osteocytes, which differentiate from BMSCs, are associated with ONFH; death of osteocytes lead to ONFH A previous study has demonstrated that the osteogenic differentiation of BMSCs in cells from human ONFH tissue is downregulated, whereas adipocyte differentiation is upregulated (44). The autophagy and apoptosis rates of osteocytes were also increased in ONFH (45). It has been observed that the number of osteoblasts, which are cells that differentiate from BMSCs, are reduced in ONFH, whereas lipid differentiation is increased (44). Thus, BMSCs play an important role in the pathological changes associated with ONFH, and it is important to investigate the factors that may affect BMSCs in this disease.

miR-141 has been implicated in tissue repair and osteogenic differentiation (23). A previous study has indicated that miRNA plays an crucial role in the osteogenic differentiation of BMSCs, and abnormal expression of miRNA molecules may affect this process (46). Our previous study revealed that miR-141 can inhibit proliferation in BMSCs (24). Nevertheless, the role of this miRNA in osteogenic differentiation is not clear. The inhibition of miR-141 may promote the osteogenic differentiation of BMSCs (5) by targeting vitamin C transporter 2 (25). In acute kidney injury, it has been reported that miR-141 expression in mesenchymal stromal cells promotes tissue repair (47). miR-141 overexpression can also occur as a result of epigenetic regulation during senescence, which may lead to a declines in physiological function and tissue regeneration (48). miR-141 is a member of the miR-200c/141 cluster and expression of the miR-200c/141 cluster is regulated by DNA methylation, suggesting epigenetic regulation of this miRNA locus in aggressive breast cancer cell lines as well as untransformed mammary epithelial cells. (49). Increasing evidence suggests that several miRNA molecules participate in the development and progression of ONFH, acting either as stimulators or as suppressors (50). In the present study, miR-141 was overexpressed in BMSCs. The results demonstrated that miR-141 suppressed BMSC proliferation and osteogenic differentiation.

E2F3 participates in the regulation of cellular metastasis (26). Numerous miRNA molecules have been found to be able to modulate E2F3 expression (51), including miR-141. Indeed, E2F3 has been identified as the target of miR-141 in HCC cells, and the overexpression of E2F3 could partially reverse the tumor-suppressive effects of miR-141 (27). E2F3 expression is altered in several tumor types, and this transcription factor plays an important role in tumor development (52,53). Therefore, it was hypothesized in the present study that E2F3 and miR-141 could interact to modulate BMSC differentiation in ONFH and play a crucial role in the pathogenesis of this disease. The results suggested that miR-141 and E2F3 are potentially relevant factors of BMSC. The overexpression of miR-141 reduced the expression levels of E2F3 and inhibited osteogenic differentiation. Following miR-141 inhibition using lentiviral transduction, E2F3 expression and osteogenic differentiation significantly increased in ONFH group cells. Increased E2F3 mRNA levels may partially reverse the suppressive effects of ONFH on osteogenic differentiation. Altogether, these observations suggest that miR-141 suppresses osteogenic differentiation.

In conclusion, ONFH is a complex biological process involving diverse mechanisms. The present study demonstrated that miR-141 could suppress the osteogenic differentiation of BMSCs by reducing E2F3 mRNA expression levels.

Acknowledgements

Not applicable.

Funding

Funding: No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

FX, JW, WF, TH, YL and WW participated in the design of the study and contributed to drafting and revising the manuscript. WF, YL and TH collected the data and performed the statistical analyses. All authors read and approved the manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved. FX and WBW confirm the authenticity of all the raw data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

All animal experiments were approved by The Inner Mongolia Medical University Animal Ethics Committee and performed according to the Guidelines for the Care and Use of Laboratory Animals.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Vreden SG, Hermus AR, van Liessum PA, Pieters GF, Smals AG and Kloppenborg PWC: Aseptic bone necrosis in patients on glucocorticoid replacement therapy. Neth J Med. 39:153–157. 1991.PubMed/NCBI

2 

Shigemura T, Nakamura J, Kishida S, Harada Y, Ohtori S, Kamikawa K, Ochiai N and Takahashi K: Incidence of osteonecrosis associated with corticosteroid therapy among different underlying diseases: Prospective MRI study. Rheumatology (Oxford). 50:2023–2028. 2011. View Article : Google Scholar : PubMed/NCBI

3 

Cui Q, Jo WL, Koo KH, Cheng EY, Drescher W, Goodman SB, Ha YC, Hernigou P, Jones LC, Kim SY, et al: ARCO consensus on the pathogenesis of non-traumatic osteonecrosis of the femoral head. J Korean Med Sci. 36:e652021. View Article : Google Scholar

4 

Liu Y, Jia Y, Cao Y, Zhao Y, Du J, An F, Qi Y, Feng X, Jin T, Shi J and Wang J: MMP9 polymorphism is associated with susceptibility to non-traumatic osteonecrosis of femoral head in a Chinese Han population. Oncotarget. 8:82835–82841. 2017. View Article : Google Scholar

5 

Liu W, Zhao Z, Na Y, Meng C, Wang J and Bai R: Dexamethasone-induced production of reactive oxygen species promotes apoptosis via endoplasmic reticulum stress and autophagy in MC3T3-E1 cells. Int J Mol Med. 41:2028–2036. 2018.PubMed/NCBI

6 

Jones JP Jr: Fat embolism, intravascular coagulation, and osteonecrosis. Clin Orthop Relat Res. 294–308. 1993. View Article : Google Scholar

7 

Xu X, Wen H, Hu Y, Yu H, Zhang Y, Chen C and Pan X: STAT1-caspase 3 pathway in the apoptotic process associated with steroid-induced necrosis of the femoral head. J Mol Histol. 45:473–485. 2014. View Article : Google Scholar

8 

Tack L, Tatsi C, Stratakis CA and Lodish MB: Effects of glucocorticoids on bone: What we can learn from pediatric endogenous cushing's syndrome. Horm Metab Res. 48:764–770. 2016. View Article : Google Scholar : PubMed/NCBI

9 

Wu Q, Xiong X, Zhang X, Lu J, Zhang X, Chen W, Wu T, Cui L, Liu Y and Xu B: Secondary osteoporosis in collagen-induced arthritis rats. J Bone Miner Metab. 34:500–516. 2016. View Article : Google Scholar : PubMed/NCBI

10 

Wu Z, Bucher NL and Farmer SR: Induction of peroxisome proliferator-activated receptor gamma during the conversion of 3T3 fibroblasts into adipocytes is mediated by C/EBPbeta, C/EBPdelta, and glucocorticoids. Mol Cell Biol. 16:4128–4136. 1996. View Article : Google Scholar

11 

Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman MA, Simonetti DW, Craig S and Marshak DR: Multilineage potential of adult human mesenchymal stem cells. Science. 284:143. 1999. View Article : Google Scholar : PubMed/NCBI

12 

Prockop DJ: Marrow stromal cells as stem cells for nonhematopoietic tissues. Science. 276:71–74. 1997. View Article : Google Scholar : PubMed/NCBI

13 

Gao Y, Patil S and Jia J: The development of molecular biology of osteoporosis. Int J Mol Sci. 22:81822021. View Article : Google Scholar

14 

Matsuya H, Kushida T, Asada T, Umeda M, Wada T and Iida H: Regenerative effects of transplanting autologous mesenchymal stem cells on corticosteroid-induced osteonecrosis in rabbits. Mod Rheumatol. 18:132–139. 2008. View Article : Google Scholar

15 

Tian L and Yu X: Lipid metabolism disorders and bone dysfunction-interrelated and mutually regulated (Review). Mol Med Rep. 12:783–794. 2015. View Article : Google Scholar : PubMed/NCBI

16 

Lee JS, Lee JS, Roh HL, Kim CH, Jin SJ and Suh KT: Alterations in the differentiation ability of mesenchymal stem cells in patients with nontraumatic osteonecrosis of the femoral head: Comparative analysis according to the risk factor. J Orthop Res. 24:604–609. 2006. View Article : Google Scholar : PubMed/NCBI

17 

Liu K, Wen G, Liu R, Liang XU, Feng LI and Tao S: Research progress of the treatment of regional osteoporosis with BMSCs transplantation. Chin J Osteoporos. 11:1203–1206. 2013.(In Chinese).

18 

Lewis H, Lance R, Troyer D, Beydoun H, Hadley M, Orians J, Benzine T, Madric K, Semmes OJ, Drake R and Esquela-Kerscher A: MiR-888 is an expressed prostatic secretions-derived microRNA that promotes prostate cell growth and migration. Cell Cycle. 13:227–239. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Ambros V: Victor Ambros: The broad scope of microRNAs. Interview by Caitlin Sedwick. J Cell Biol. 201:492–493. 2013. View Article : Google Scholar

20 

Long ZH, Bai ZG, Song JN, Zheng Z, Li J, Zhang J, Cai J, Yao HW, Wang J, Yang YC, et al: MiR-141 inhibits proliferation and migration of colorectal cancer SW480 Cells. Anticancer Res. 37:4345–4352. 2017.PubMed/NCBI

21 

Hou X, Yang L, Jiang X, Liu Z, Li X, Xie S, Li G and Liu J: Role of microRNA-141-3p in the progression and metastasis of hepatocellular carcinoma cell. Int J Biol Macromol. 128:331–339. 2019. View Article : Google Scholar

22 

Xu H, Mei Q, Xiong C and Zhao J: Tumor-suppressing effects of miR-141 in human osteosarcoma. Cell Biochem Biophys. 69:319–325. 2014. View Article : Google Scholar : PubMed/NCBI

23 

Yaman Agaoglu F, Kovancilar M, Dizdar Y, Darendeliler E, Holdenrieder S, Dalay N and Gezer U: Investigation of miR-21, miR-141, and miR-221 in blood circulation of patients with prostate cancer. Tumour Biol. 32:583–588. 2011. View Article : Google Scholar

24 

Meng CY, Xue F, Zhao ZQ, Hao T, Guo SB and Feng W: Influence of MicroRNA-141 on inhibition of the proliferation of bone marrow mesenchymal stem cells in steroid-Induced Osteonecrosis via SOX11. Orthop Surg. 12:277–285. 2020. View Article : Google Scholar : PubMed/NCBI

25 

Sangani R, Periyasamy-Thandavan S, Kolhe R, Bhattacharyya MH, Chutkan N, Hunter M, Isales C, Hamrick M, Hill WD and Fulzele S: MicroRNAs-141 and 200a regulate the SVCT2 transporter in bone marrow stromal cells. Mol Cell Endocrinol. 410:19–26. 2015. View Article : Google Scholar

26 

Rady B, Chen Y, Vaca P, Wang Q, Wang Y, Salmon P and Oberholzer J: Overexpression of E2F3 promotes proliferation of functional human β cells without induction of apoptosis. Cell Cycle. 12:2691–2702. 2013. View Article : Google Scholar : PubMed/NCBI

27 

Xue J, Niu YF, Huang J, Peng G, Wang LX, Yang YH and Li YQ: MiR-141 suppresses the growth and metastasis of HCC cells by targeting E2F3. Tumour Biol. 35:12103–12107. 2014. View Article : Google Scholar

28 

Kim HR, Rahman FU, Kim KS, Kim EK, Cho SM, Lee K, Moon OS, Seo YW, Yoon WK, Won YS, et al: Critical roles of E2F3 in growth and musculo-skeletal phenotype in mice. Int J Med Sci. 16:1557–1563. 2019. View Article : Google Scholar

29 

Farag MR, Anter RGA, Elhady WM, Khalil SR, Abou-Zeid SM and Hassanen EAA: Diversity, succession pattern and colonization of forensic entomofauna on indoor rat carrions concerning the manner of death. Rend Fis Acc Lincei. 32:521–538. 2021. View Article : Google Scholar

30 

Yaghoobi M, Hashemi-Najafabadi S, Soleimani M and Vasheghani-Farahani E: Osteogenic induction of human mesenchymal stem cells in multilayered electrospun scaffolds at different flow rates and configurations in a perfusion bioreactor. J Biosci Bioeng. 128:495–503. 2019. View Article : Google Scholar : PubMed/NCBI

31 

Adibkia K, Ehsani A, Jodaei A, Fathi E, Farahzadi R and Barzegar-Jalali M: Silver nanoparticles induce the cardiomyogenic differentiation of bone marrow derived mesenchymal stem cells via telomere length extension. Beilstein J Nanotechnol. 12:786–797. 2021. View Article : Google Scholar

32 

Li X, Wang L, Su Q, Ye L, Zhou X, Zhang L, Song D and Huang D: Potential roles of bone morphogenetic protein 9 in the odontogenic differentiation of dental pulp cells. J Endod. 47:436–443. 2021. View Article : Google Scholar : PubMed/NCBI

33 

Langkilde A, Raaby L, Johansen C and Iversen L: MicroRNA normalization candidates for quantitative reverse-transcriptase polymerase chain reaction in real time in lesional and nonlesional psoriatic skin. Br J Dermatol. 169:677–681. 2013. View Article : Google Scholar

34 

Nicolas FE: Experimental validation of MicroRNA targets using a luciferase reporter system. Methods Mol Biol. 732:139–152. 2011. View Article : Google Scholar

35 

Wang Y, Sun J, Guo X, Zhang D, Cui Y, Li W, Liu G, Li Y and Jiang S: TaqMan-based real-time polymerase chain reaction assay for specific detection of bocavirus-1 in domestic cats. Mol Cell Probes. 53:1016472020. View Article : Google Scholar : PubMed/NCBI

36 

Fathi E, Farahzadi R, Vietor I and Javanmardi S: Cardiac differentiation of bone-marrow-resident c-kit+ stem cells by L-carnitine increases through secretion of VEGF, IL6, IGF-1 and TGF-β. as clinical agents in cardiac regeneration. J Biosci. 45:922020. View Article : Google Scholar

37 

Fathi E, Farahzadi R and Valipour B: Alginate/gelatin encapsulation promotes NK cells differentiation potential of bone marrow resident C-kit+ hematopoietic stem cells. Int J Biol Macromol. 177:317–327. 2021. View Article : Google Scholar

38 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

39 

Kurien BT and Scofield RH: Western blotting. Methods. 38:283–293. 2006. View Article : Google Scholar : PubMed/NCBI

40 

Lau RL, Perruccio AV, Evans HM, Mahomed SR, Mahomed NN and Gandhi R: Stem cell therapy for the treatment of early stage avascular necrosis of the femoral head: A systematic review. BMC Musculoskelet Disord. 15:1562014. View Article : Google Scholar : PubMed/NCBI

41 

Peckett AJ, Wright DC and Riddell MC: The effects of glucocorticoids on adipose tissue lipid metabolism. Metabolism. 60:1500–1510. 2011. View Article : Google Scholar : PubMed/NCBI

42 

Pansky A, Roitzheim B and Tobiasch E: Differentiation potential of adult human mesenchymal stem cells. Clin Lab. 53:81–84. 2011.

43 

Yu Y, Wei N, Stanford C, Schmidt T and Hong L: In vitro effects of RU486 on proliferation and differentiation capabilities of human bone marrow mesenchymal stromal cells. Steroids. 77:132–137. 2012. View Article : Google Scholar : PubMed/NCBI

44 

Wang T, Teng S, Zhang Y, Wang F, Ding H and Guo L: Role of mesenchymal stem cells on differentiation in steroid-induced avascular necrosis of the femoral head. Exp Ther Med. 13:669–675. 2017. View Article : Google Scholar : PubMed/NCBI

45 

Bai R, Feng W, Liu WL, Zhao ZH, Zhao AQ, Wang Y, Wang WX, Sun L, Wu LS and Cui SH: Roles of osteocyte apoptosis in steroid-induced avascular necrosis of the femoral head. Genet Mol Res. 15:2016. View Article : Google Scholar

46 

Wang J, Liu S, Li J, Zhao S and Yi Z: Roles for miRNAs in osteogenic differentiation of bone marrow mesenchymal stem cells. Stem Cell Res Ther. 10:1972019. View Article : Google Scholar : PubMed/NCBI

47 

de Almeida DC, Bassi ÊJ, Azevedo H, Anderson L, Origassa CS, Cenedeze MA, de Andrade-Oliveira V, Felizardo RJ, da Silva RC, Hiyane MI, et al: A Regulatory miRNA-mRNA network is associated with tissue repair induced by mesenchymal stromal cells in acute kidney injury. Front Immunol. 7:6452017. View Article : Google Scholar

48 

Yu KR, Lee S, Jung JW, Hong IS, Kim HS, Seo Y, Shin TH and Kang KS: MicroRNA-141-3p plays a role in human mesenchymal stem cell aging by directly targeting ZMPSTE24. J Cell Sci. 126((Pt 23)): 5422–5431. 2013.

49 

Neves R, Scheel C, Weinhold S, Honisch E, Iwaniuk KM, Trompeter HI, Niederacher D, Wernet P, Santourlidis S and Uhrberg M: Role of DNA methylation in miR-200c/141 cluster silencing in invasive breast cancer cells. BMC Res Notes. 3:2192010. View Article : Google Scholar : PubMed/NCBI

50 

Pizzini S, Bisognin A, Mandruzzato S, Biasiolo M, Facciolli A, Perilli L, Rossi E, Esposito G, Rugge M, Pilati P, et al: Impact of microRNAs on regulatory networks and pathways in human colorectal carcinogenesis and development of metastasis. BMC Genomics. 14:5892013. View Article : Google Scholar : PubMed/NCBI

51 

Miles WO, Tschop K, Herr A, Ji JY and Dyson NJ: Pumilio facilitates miRNA regulation of the E2F3 oncogene. Genes Dev. 26:356–368. 2012. View Article : Google Scholar : PubMed/NCBI

52 

Zeng X, Yin F, Liu X, Xu J, Xu Y, Huang J, Nan Y and Qiu X: Upregulation of E2F transcription factor 3 is associated with poor prognosis in hepatocellular carcinoma. Oncol Rep. 31:1139–1146. 2014. View Article : Google Scholar : PubMed/NCBI

53 

Bilke S, Schwentner R, Yang F, Kauer M, Jug G, Walker RL, Davis S, Zhu YJ, Pineda M, Meltzer PS and Kovar H: Oncogenic ETS fusions deregulate E2F3 target genes in Ewing sarcoma and prostate cancer. Genome Res. 23:1797–1809. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

July-2022
Volume 26 Issue 1

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Xue F, Wu J, Feng W, Hao T, Liu Y and Wang W: MicroRNA‑141 inhibits the differentiation of bone marrow‑derived mesenchymal stem cells in steroid‑induced osteonecrosis via E2F3. Mol Med Rep 26: 234, 2022
APA
Xue, F., Wu, J., Feng, W., Hao, T., Liu, Y., & Wang, W. (2022). MicroRNA‑141 inhibits the differentiation of bone marrow‑derived mesenchymal stem cells in steroid‑induced osteonecrosis via E2F3. Molecular Medicine Reports, 26, 234. https://doi.org/10.3892/mmr.2022.12750
MLA
Xue, F., Wu, J., Feng, W., Hao, T., Liu, Y., Wang, W."MicroRNA‑141 inhibits the differentiation of bone marrow‑derived mesenchymal stem cells in steroid‑induced osteonecrosis via E2F3". Molecular Medicine Reports 26.1 (2022): 234.
Chicago
Xue, F., Wu, J., Feng, W., Hao, T., Liu, Y., Wang, W."MicroRNA‑141 inhibits the differentiation of bone marrow‑derived mesenchymal stem cells in steroid‑induced osteonecrosis via E2F3". Molecular Medicine Reports 26, no. 1 (2022): 234. https://doi.org/10.3892/mmr.2022.12750