Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
November-2022 Volume 26 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2022 Volume 26 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML

  • Supplementary Files
    • Supplementary_Data.pdf
Article Open Access

Hepatic gene expression and functional changes associated with nonalcoholic steatohepatitis

  • Authors:
    • Kana Matsumoto
    • Yumiko Kato
    • Momone Hayashi
    • Risa Miura
    • Satoru Monzen
    • Mitsuru Chiba
  • View Affiliations / Copyright

    Affiliations: Department of Bioscience and Laboratory Medicine, Graduate School of Health Sciences, Hirosaki University, Hirosaki, Aomori 036‑8564, Japan, Department of Medical Technology, School of Health Sciences, Hirosaki University, Hirosaki, Aomori 036‑8564, Japan, Department of Radiation Sciences, Graduate School of Health Sciences, Hirosaki University, Hirosaki, Aomori 036‑8564, Japan
    Copyright: © Matsumoto et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 325
    |
    Published online on: September 1, 2022
       https://doi.org/10.3892/mmr.2022.12841
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Non‑alcoholic steatohepatitis (NASH) is a pathological condition of the liver in which hepatocyte steatosis, invasion of inflammatory cells and hepatic injury occur without alcohol abuse. Despite the known risk of liver cancer and liver fibrosis that may progress to liver cirrhosis that exists with NASH, an understanding of related gene expression and associated functional changes remains insufficient. The present study used a mouse model of NASH induced by a high‑fat diet to examine gene expression in the liver and to search for transcripts that could predict early liver fibrosis in the future. Mice fed a high‑fat diet for 2 weeks showed typical NASH liver histology by hematoxylin and eosin staining, and increased fibrosis was confirmed by Sirius red staining after 6 weeks. Functional changes associated with liver damage, liver inflammation, liver steatosis and liver fibrosis were predicted by toxicological ontology analysis using Ingenuity Pathways Analysis. Downregulated microRNA (miR)‑21 and upregulated collagen type III α1 mRNA in the liver and upregulated exosomal miR‑21 in serum of mice fed a high‑fat diet for 1 and/or 2 weeks were confirmed by reverse transcription‑quantitative PCR, suggesting that these changes occur prior to histological confirmation of fibrosis. Therefore, it may be possible to predict future liver fibrosis by analyzing fibrosis‑related genes that shift prior to pathological findings.

Introduction

Nonalcoholic fatty liver disease (NAFLD) is a disorder involving excess fat buildup in the liver. Causes of NAFLD include insulin resistance, lifestyle diseases, abnormal lipid metabolism, endocrine diseases, etc. Individuals with this condition have fatty deposits in the liver without excessive alcohol use (1). NAFLD is a risk factor for the development of lifestyle-related diseases and should be regarded as a systemic disease since obesity and lifestyle-related diseases are frequently associated (1,2). Classifications of NAFLD include nonalcoholic fatty liver, which develops based on large-drop fat degeneration and rarely progresses, and nonalcoholic steatohepatitis (NASH), which is progressive and can result in liver cirrhosis and hepatocellular carcinoma (3).

NASH is a pathological condition of NAFLD in which fatty degeneration, inflammatory cell infiltration, and hepatocellular injury (balloon-like degeneration) are observed (4–6). Currently, it is estimated that ~25% of the world population has NAFLD, with a high prevalence in obese and diabetic subjects (7,8). The risk of progression to cirrhosis and liver cancer is a problem in cases with highly advanced fibrosis (9,10). Unfortunately, a promising marker of initial fibrosis and a test method that can predict future fibrosis has yet to be discovered.

In our previous study, we showed that various mRNA and non-coding RNA expression changes occur in human liver cancer patient tissues and can be classified by disease stage (11). Previously, it was also suggested that microRNAs are altered in the NASH liver, and miR-122 and miR-192 appear in the blood, which may serve as biomarkers for NASH (12). Therefore, gene expression in NASH liver tissue and blood samples could be examined to predict future fibrosis. In this study, we used a mouse model of NASH induced by a high-fat diet to examine gene expression in the liver and to search for transcripts that could predict early liver fibrosis in the future.

Materials and methods

Animals

Five-week-old C57BL/6NJcl male mice were purchased from Clea Japan and acclimatized for 1 week before starting the experiment. Food and water were fed ad libitum to the mice and changed every two to three days. The bedding was changed once a week. The mice were fed a choline-deficient, L-amino acid-defined, high-fat diet (CDAHFD, A06071302, RESEARCH DIETS) consisting of 60 kcal% fat and 0.1% methionine by weight to induce the onset of NASH (13). A dietary breeding solid-type feed CE-2 (Clea Japan) was fed to a control mouse group under the same conditions other than the diet. A sampling of six animals in each control and NASH group was performed at 1, 2, and 6 weeks. One mouse from each group had the liver removed after perfusion fixation with 4% paraformaldehyde, and the other four or five had the liver removed after cardiac blood sampling. All experiments were performed under anesthesia with the inhalation anesthetic solution isoflurane (Pfizer Inc.). Anesthesia was introduced by inhalation with a small animal anesthesia machine (Muromachi Kikai) vaporized to a concentration of 4–5% and maintained at 2–3%. Cervical dislocation was used for euthanasia after liver removal, and death was confirmed by cessation of respiration and heartbeat. Liver samples were stored at −80°C immediately after collection, and blood samples were serum separated immediately after collection. All animal experiments were performed in accordance with the Guidelines for Animal Experimentation of Hirosaki University, and complied with the ARRIVE guidelines and the AVMA euthanasia guidelines 2020. The procedures were approved by The Animal Research Committee of Hirosaki University (approval nos. G18002).

Hematoxylin and eosin staining

Paraffin-embedded tissue was thin sliced at 4 µm. The slide glass to which the paraffin-embedded section was attached was deparaffinized, treated for hydrophilicity, and washed with water. After 1 min, Mayer's hematoxylin solution (Wako) was applied to dye the nuclei, and the excess color was rinsed with warm water for 10 min. After staining with 0.5% eosin Y/ethanol solution (Wako) for 10 sec, the slides were washed with water to remove excess staining solution and separated with 75% ethanol. Specimens were dehydrated with ethanol, rendered transparent with xylene, and mounted with Marinol (Muto Chemical Co., Ltd.) and cover glass (Matsunami Glass Industry Co.). The stained slides were visualized under visible light using a BZ-X700 microscope (KEYENCE).

Sirius red staining

Slides with paraffin-embedded sections attached were deparaffinized, treated for hydrophilicity, and washed with running water for 5 min. After dyeing with Sirius red solution for 10 min, the color was rinsed with water for 5 min, then dehydrated with ethanol, rendered transparent with xylene, and mounted with Marinol (Muto Kagaku Co., Ltd.) and cover glass (Matsunami Glass Industry Co.). The stained slides were visualized under visible light using a BZ-X700 microscope (KEYENCE).

Immunohistochemistry staining

Slides with paraffin sections attached were deparaffinized, treated for hydrophilicity, and washed with water for 5 min. Slides were treated with 3% H2O2 for 5 min to inactivate the endogenous peroxidase and washed with water for 5 min. For antigen activation, the slides were placed in a heat-resistant doze filled with citric acid buffer (pH 6.0) and autoclaved at 115°C for 5 min. The slides were washed with TBS buffer (25 mM Tris-HCl and 150 mM NaCl, pH 7.2) for 5 min and treated with blocking solution (5% goat serum in TBS buffer) at room temperature for 30 min. Next, the slides were incubated with the blocking solution containing a primary rabbit monoclonal antibody directed against α-smooth muscle actin (α-SMA) (Cell Signaling Technology) at a 1:500 dilution at room temperature for 60 min, then washed three times with TBS buffer, and incubated at room temperature for 60 min with EnVision +System-HRP Labelled Polymer Anti-Rabbit (Dako). The slides were washed three more times with TBS buffer and stained with 3,3′-diaminobenzidine and Mayer's hematoxylin solutions.

RNA extraction

RNAs from livers, serum and serum exosomes were extracted using the Isogen II reagent (Nippon gene), according to the manufacturer's instructions. The quality and concentration of total RNAs from livers were assessed using a NanoDrop spectrophotometer (NanoDrop Technologies). All RNA samples had 260/280 nm absorbance ratios of 1.8-2.0. The concentration of RNAs from serum and serum exosomes was measured using Qubit™ 4 Fluorometer and Qubit™ microRNA Assay kit (Thermo Fisher Scientific, Inc.).

The peaks of total RNAs were confirmed using an Agilent 2100 Bioanalyzer and an Agilent RNA 6000 Pico Kit (Agilent Technologies), according to the manufacturer's instructions.

Microarray analysis

Cyanine 3 (Cy3)-labeled complementary RNA (cRNA) was synthesized from 150 ng of liver total RNA using a Low Input Quick Amp Labeling Kit (Agilent Technologies), according to the manufacturer's instructions. The synthesized Cy3-labeled cRNA was hybridized with a microarray slide (SurePrint G3 Mouse GE 8×60 K Microarray Kit; Agilent Technologies) at 65°C for 17 h. After hybridization, the slides were washed with the Gene Expression Wash Pack (Agilent Technologies). Cy3 fluorescence signals were detected with a SureScan Microarray Scanner (Agilent Technologies). Fluorescent images were quantified using Feature Extraction software (Agilent Technologies). GeneSpring 14.5 software (Agilent Technologies) was used for normalization and expression analysis. Genes showing an expression level fold change >1.5 or higher were analyzed by comparing the control and NASH groups. Function prediction was performed using Ingenuity Pathway Analysis (IPA) (Qiagen).

Real-time PCR

The expression of mouse collagen type III α1 (Col3a1) and glyceraldehyde-3-phosphate dehydrogenase (Gapdh) mRNAs in mouse liver was determined by real-time PCR. Complementary DNA (cDNA) was synthesized from total RNA using the Applied Biosystems™ High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. Quantitative polymerase chain reaction (qPCR) was performed using a Power SYBR Green PCR Master Mix (Thermo Fisher Scientific, Inc.), 10 µM of forward and reverse primer pairs, and the StepOne Plus Real-time PCR System (Thermo Fisher Scientific, Inc.) under the following conditions: 10 min at 95°C, followed by 45 cycles each of 95°C for 15 sec, and 60°C for 60 sec with Gapdh used as an internal control.

The expression level of miR-21 in mouse liver, serum and serum exosomes was examined by real-time PCR. Exosomes from serum were extracted using Total Exosome Isolation from serum (Thermo Fisher Scientific, Inc.). The cDNAs from miR-21 were synthesized using the TaqMan™ miRNA RT Kit and the prescribed 5× RT primer (both from Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. The qPCR for miR-21 was performed using a FastStart TaqMan probe master (Roche Diagnostics), a 20× probe, and the StepOne Plus Real-Time PCR System (Thermo Fisher Scientific, Inc.) under the following conditions: 10 min at 95°C, followed by 45 cycles at 95°C for 15 sec, and 60°C for 60 sec with U6 snRNA as an internal control and cel-miR-39 as an external control. The comparative Ct method was used to determine expression levels.

Statistical analysis

Statcel 3 software (OMS Publishing Inc., Saitama, Japan) was used to perform all statistical analyses. Unpaired Student's t-test was performed to compare the results of the two groups. P<0.05 was considered a statistically significant difference.

Results

Histological changes in mouse NASH livers

We harvested the livers of control and NASH mice at 1, 2, and 6 weeks after high-fat diet intake for histological analysis to confirm the model. The livers of the control group mice were histologically normal at all time points. In contrast, the livers of the NASH mice showed hepatocellular damage and fat droplets and the appearance of inflammatory cells by hematoxylin and eosin staining after 2 and 6 weeks. At 1 week, some of the NASH group showed changes (Fig. 1A). Sirius red staining and α-SMA immunostaining revealed increasing fibers and activated star cells in NASH mice 6 weeks after ingesting the high-fat diet (Fig. 1B and C). These results indicate that the entire liver is in a NASH state after 2 weeks of high-fat diet intake and that liver fibrosis occurs at 6 weeks.

Figure 1.

Histological liver images of control and NASH groups at 1, 2 and 6 weeks. (A) Hematoxylin and eosin staining: In the NASH group, numerous small vacuoles in the liver parenchyma and fatty degeneration were observed. The NASH group also showed hepatocyte ballooning and inflammatory cell infiltration. The three characteristics of NASH were confirmed after 2 weeks. (B) Sirius red staining: In the NASH group, fibrosis was observed in the liver parenchyma at 6 weeks. (C) α-SMA immunostaining: In the NASH group, partial activation of astrocytes was observed at 2 weeks and overall activation at 6 weeks. Scale bars, 100 µm. NASH, non-alcoholic steatohepatitis.

Gene expression changes in mouse NASH livers

To investigate the changes in gene expression associated with NASH development, we performed mRNA microarray analysis. We investigated genes with >1.5-fold difference in expression in the NASH group compared to the control group. Mice at 1 week without complete NASH, 2 weeks with NASH, and 6 weeks with advanced fibrosis were selected for analysis.

The numbers of genes upregulated more than 1.5-fold in the livers of NASH mice compared to control mice were 2912, 2684 and 2791 in 1, 2 and 6 weeks, respectively (Fig. S1). Whereas, the numbers of genes downregulated more than 1.5-fold in the livers of NASH mice compared to control mice were 5243, 4288 and 4591 in 1, 2 and 6 weeks, respectively (Fig. S1). These suggest that numerous gene expressions are altered by the onset of NASH. The microarray data used in this study were registered with Gene Expression Omnibus (GSE200409).

Functional change prediction by IPA

Based on the mRNA expression data of mouse livers at 1, 2, and 6 weeks, we used IPA toxicity ontology analysis to predict functional changes and determine which expressed genes affect biological functions and diseases. Increased liver damage, liver inflammation, liver steatosis and liver fibrosis was shown as a predicted function. In addition, when we compared the histological findings with the time when the cells started to show hyperfunction by gene expression, there was a general agreement between the two (Table I). Interestingly, fibrosis was not clearly visible in the histological findings until 6 weeks, but functional prediction by gene expression was forecast to increase at 2 weeks.

Table I.

Comparison of histological findings and functional prediction by Ingenuity Pathway Analysis.

Table I.

Comparison of histological findings and functional prediction by Ingenuity Pathway Analysis.

Time after high-fat diet intakeLiver damageLiver inflammationLiver steatosisLiver fibrosis




Histological findingsFunctional predictionHistological findingsFunctional predictionHistological findingsFunctional predictionHistological findingsFunctional prediction
1 weekDamageHyperfunctionPartial fatidationNo signNon-fibrosisMild hyperfunctionNon-fibrosisMild hyperfunction
2 weeksDamageHyperfunctionFatidationHyperfunctionMild fibrosisHyperfunctionMild fibrosisHyperfunction
6 weeksSignificant damageHyperfunctionFatidationHyperfunctionFibrosisHyperfunctionFibrosisHyperfunction

As for liver fibrosis, the increase in the number of molecules associated with fibrosis between 1 and 2 weeks was more pronounced than at 6 weeks when histological findings confirmed fibrosis. In addition, the Venn diagram of common liver fibrosis-related expressed genes showed that there were 11 genes common in all weeks (Fig. 2). Changes in common genes and expression levels at 1, 2, and 6 weeks are shown in Table II. There were 54 genes in common between 2 and 6 weeks, and there was little difference in the number of genes between 2 and 6 weeks. This finding suggests that changes in gene expression associated with the pathogenesis of NASH occur as early as 1 week and the expression of fibrosis-associated molecules is already increased from 1 or 2 weeks when a clear fibrosis image is observed on pathological examination at 6 weeks.

Figure 2.

Toxic ontology analysis of diseases and functions by Ingenuity Pathway Analysis. Venn diagram of liver fibrosis-related genes. The genes associated with liver fibrosis in Table II are presented in the Venn diagram. NASH, non-alcoholic steatohepatitis; Adk, adenosine kinase; Adora2a, adenosine A2a receptor; Col3a1, collagen type III α1; Golm1, golgi membrane protein 1; Gstp1, glutathione S-transferase, pi1; Ifnar2, interferon (α and β) receptor 2; Impdh1, inosine monophosphate dehydrogenase 1; Pdgfrb, platelet derived growth factor receptor, β polypeptide; Srebf1, sterol regulatory element binding transcription factor 1; Tgfb1, transforming growth factor, β1; Tlr4, toll-like receptor 4.

Table II.

Changes in gene expression of fibrosis-related genes at 1, 2 and 6 weeks.

Table II.

Changes in gene expression of fibrosis-related genes at 1, 2 and 6 weeks.

Fold-change

Genes1 week2 weeks6 weeks
Adk48.87−1.75−1.94
Adora2a1.591.593.27
Col3a14.746.749.61
Golm12.624.974.88
Gstp1−3.28−2.50−2.57
Ifnar2−1.66−1.63−1.63
Impdh11.862.162.02
Pdgfrb1.802.003.33
Srebf1−2.56−2.66−2.05
Tgfb11.932.352.67
Tlr41.802.732.64

[i] Adk, adenosine kinase; Adora2a, adenosine A2a receptor; Col3a1, collagen type III α1; Golm1, golgi membrane protein 1; Gstp1, glutathione S-transferase, pi1; Ifnar2, interferon (α and β) receptor 2; Impdh1, inosine monophosphate dehydrogenase 1; Pdgfrb, platelet derived growth factor receptor, β polypeptide; Srebf1, sterol regulatory element binding transcription factor 1; Tgfb1, transforming growth factor, β1; Tlr4, toll-like receptor 4.

Prediction of upstream regulatory molecules by IPA upstream analysis

To investigate the upstream molecules involved in the changes in gene expression, we performed IPA upstream analysis. The upstream molecules predicted to be involved in the activation or repression of gene expression are shown in Fig. S2. Among the upstream molecules, transcription regulators, kinase, and enzyme changes were particularly common. Among the upstream regulatory molecules, we focused on miRNAs as promising biomarkers that can be measured in the blood (Table III and Fig. S2). The findings suggest that various upstream regulatory molecules, including microRNAs, are involved in the expression changes of NASH-related genes.

Table III.

Prediction of upstream regulatory miRNAs by upstream analysis.

Table III.

Prediction of upstream regulatory miRNAs by upstream analysis.

Prediction1 week2 weeks6 weeks
ActivatedNonemiR-223miR-223
let-7let-7miR-122
miR-122miR-122miR-181
miR-17miR-135miR-196
InhibitedmiR-148miR-148miR-21
miR-196miR-196miR-30
miR-21miR-7
miR-7

[i] miRNA/miR, microRNA; let-7, lethal-7.

Integrated pathway analysis

From Table III, we focused on miR-223, which was predicted to be active in expression, and miR-21, which was predicted to be repressed. The gene numbers for which these microRNAs were predicted to be involved in the regulation of gene expression were evaluated (Table IV). Based on an integrated pathway between upstream molecules and gene expression and function prediction in IPA (Fig. 3), miR-223 upregulation was predicted to enhance hepatocyte adipogenesis, cell death, inflammation, and hepatocellular injury. In contrast, miR-21 downregulation was predicted to enhance fibrosis.

Figure 3.

Integrated pathway analysis of upstream molecules, gene expression and function predictions. (A) miR-223, (B) miR-21. The top row shows each miRNA, the middle row shows the gene predicted to be regulated by each miRNA and the bottom row shows the function predicted to be involved. Orange miRNAs are upregulated, blue miRNAs are downregulated, peach genes are upregulated, green genes are downregulated and orange predicted functions are upregulated. miR, microRNA.

Table IV.

Number of genes expected to be regulated by miR-223 and miR-21 in non-alcoholic steatohepatitis liver.

Table IV.

Number of genes expected to be regulated by miR-223 and miR-21 in non-alcoholic steatohepatitis liver.

microRNA (prediction)1 week2 weeks6 weeks
miR-223 (activated)None5457
miR-21 (inhibited)None7173

[i] miR, microRNA.

Altered expression of miR-21 and fibrosis-related gene Col3a1

Real-time PCR was performed for miR-21, which was predicted to be associated with liver fibrosis. Significant downregulation of miR-21 expression was observed in NASH liver tissues at 1 and 2 weeks (Fig. 4A). For Col3a1, a gene predicted to be regulated by miR-21 and whose expression was predicted to increase over time, real-time PCR using the primers in Table V showed a significant increase in expression in NASH liver tissue at weeks 1 and 2 (Fig. 4B). This finding suggests that the expression of miR-21 in liver tissue decreased and the expression of its target, Col3a1, increased.

Figure 4.

Gene expression of miR-21 and Col3a1 in NASH livers and serum. Expression changes of (A) miR-21 and (B) Col3a1 in liver tissues, and (C) miR-21 and (D) exosomal miR-21 in serum of control and NASH groups at 1 and 2 weeks. U6 snRNA and Gapdh were used as an internal control. Cel-miR-39 was used as an external control. Four control animals and four animals in the NASH group were evaluated. White bar presents control group, and black bar presents NASH group. *P<0.05 and **P<0.01. miR, microRNA; NASH, non-alcoholic steatohepatitis; Col3a1, collagen type III α1.

Table V.

Primer pairs for reverse transcription-quantitative PCR.

Table V.

Primer pairs for reverse transcription-quantitative PCR.

PrimerSequence (5′-3′)Amplicon size, bp
Gapdh forward GGGTTCCTATAAATACGGACTGC112
Gapdh reverse CCATTTTGTCTACGGGACGA
Col3a1 forward GCCCACAGCCTTCTACAC109
Col3a1 reverse CCAGGGTCACCATTTCTC

[i] Col3a1, collagen type III α1.

Interestingly, serum miR-21 expression and serum exosomal miR-21 were significantly increased at 1 and 2 weeks of high fat diet feeding compared to controls (Fig. 4C and D). These results suggest that miR-21 may leak from the liver into the blood during the early phase of NASH, and that fibrosis may be enhanced thereafter.

Discussion

In the study, liver fibrosis was predicted by mRNA microarray analysis using mice fed a high-fat diet (CDAHFD) to induce NASH. Hematoxylin and eosin staining after 2 weeks showed features of NASH (inflammatory cell infiltration, fatty degeneration, and hepatocellular damage). Sirius red staining after 6 weeks showed fibrosis, and α-SMA immunohistochemical staining showed activation of hepatic stellate cells. In addition to inflammation, fibrosis was observed in mice fed CDAHFD at 6 weeks in a previous study (14). These results suggest that 2 weeks of feeding is suitable for the NASH model before fibrosis occurs and 6 weeks or later for advanced fibrosis development when the high-fat diet is used in this model.

We performed liver mRNA microarray analysis at 1, 2, and 6 weeks after high-fat diet intake and analyzed the function of genes with significant differences in IPA. When we compared histological findings with the predicted time of increased function, there was a general agreement, but the gene expression changes in liver fibrosis preceded the histological changes. The number of genes associated with liver fibrosis markedly increased from the first to 2 weeks of feeding, suggesting that gene expression changes prior to the time when fibrosis can be confirmed by pathological examination and that examining changes in fibrosis genes in liver biopsy specimens will enable prediction of future fibrosis.

The upstream regulatory molecules were selected as a relevant upstream regulatory molecule from the gene expression results. Among the upstream regulatory molecules, we focused on microRNAs, which can be analyzed using minimally invasive blood samples since the goal is to use microRNAs as fibrosis biomarkers in the future. We selected miR-223 and miR-21 as NASH-associated microRNAs. Previously, it has been reported that miR-223 is involved in cholesterol metabolism and cell apoptosis in the liver (15,16) and expression of miR-223 is altered in various liver diseases, and miR-223 expression is upregulated in liver tissue of NASH model mice (17).

Among the genes regulated by miR-21 that were predicted to be associated with liver fibrosis, we examined the expression of Col3a1, which was predicted to be upregulated. We found a significant increase in expression in liver tissue. Col3a1 is a gene for type III collagen, a major component of tissues with elongation function, and accumulation of type III collagen is observed in diseases associated with fibrosis (18). In this study, Col3a1 expression was significantly increased in the NASH group after 1 week of feeding, suggesting that fibrosis gene expression increases before 2 weeks when the onset of NASH can be confirmed by histological findings.

Decreased expression of liver miR-21 was observed very early in the development of NASH. However, it has been previously reported that increased expression of miR-21 promotes fibroblast proliferation and is associated with the development of fibrosis due to abnormal deposition of extracellular matrix (19). It is also known that miR-21 is generally overexpressed in NASH, as inhibition of liver miR-21 reduces hepatocyte damage, inflammation, and fibrogenesis (20). These reports are inconsistent with our results in the present study, suggesting that miR-21 expression in the liver may differ depending on the timing of NASH onset and the model used. On the other hand, the increase in serum miR-21 with the onset of NASH was consistent with reports by other investigators (21). Therefore, monitoring blood miR-21 or exosomal miR-21 expression may be more important for fibrosis detection than miR-21 expression in the liver.

In this study, we newly showed that exosomal miR-21 in serum is increased in the blood of early NASH mice after 1 week of high-fat diet intake, suggesting the emergence of fibrosis. In the future, we would like to investigate the usefulness of serum exosomal miR-21 as a fibrosis marker.

Supplementary Material

Supporting Data

Acknowledgements

Not applicable.

Funding

The present study was supported in part by The JSPS KAKENHI (grant nos. 21H04844 and 20K21692).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

KM and MC were major contributors in performing the experiments and writing the manuscript. YK, MH, RM and SM helped conduct the experiments. All authors read and approved the final manuscript. KM and MC confirmed the authenticity of all the raw data.

Ethics approval and consent to participate

All experiments were performed in accordance with The Guidelines for Animal Experimentation of the Hirosaki University. The procedures were approved and monitored by The Animal Research Committee of Hirosaki University (approval no. G18002).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Ratziu V, Bellentani S, Cortez-Pinto H, Day C and Marchesini G: A position statement on NAFLD/NASH based on the EASL 2009 special conference. J Hepatol. 53:372–384. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Cotter TG and Rinella M: Nonalcoholic fatty liver disease 2020: The state of the disease. Gastroenterology. 158:1851–1864. 2020. View Article : Google Scholar : PubMed/NCBI

3 

Balakrishnan M and Loomba R: The role of noninvasive tests for differentiating NASH from NAFL and diagnosing advanced fibrosis among patients with NAFLD. J Clin Gastroenterol. 54:107–113. 2020. View Article : Google Scholar : PubMed/NCBI

4 

Ludwig J, Viggiano TR, McGill DB and Oh BJ: Nonalcoholic steatohepatitis: Mayo clinic experiences with a hitherto unnamed disease. Mayo Clin Proc. 55:434–438. 1980.PubMed/NCBI

5 

Matteoni CA, Younossi ZM, Gramlich T, Boparai N, Liu YC and McCullough AJ: Nonalcoholic fatty liver disease: A spectrum of clinical and pathological severity. Gastroenterology. 116:1413–1419. 1999. View Article : Google Scholar : PubMed/NCBI

6 

Brunt EM, Janney CG, Di Bisceglie AM, Neuschwander-Tetri BA and Bacon BR: Nonalcoholic steatohepatitis: A proposal for grading and staging the histological lesions. Am J Gastroenterol. 94:2467–2474. 1999. View Article : Google Scholar : PubMed/NCBI

7 

Huang DQ, El-Serag HB and Loomba R: Global epidemiology of NAFLD-related HCC: Trends, predictions, risk factors and prevention. Nat Rev Gastroenterol Hepatol. 18:223–238. 2021. View Article : Google Scholar : PubMed/NCBI

8 

Younossi Z, Tacke F, Arrese M, Chander Sharma B, Mostafa I, Bugianesi E, Wai-Sun Wong V, Yilmaz Y, George J, Fan J and Vos MB: Global perspectives on nonalcoholic fatty liver disease and nonalcoholic steatohepatitis. Hepatology. 69:2672–2682. 2019. View Article : Google Scholar : PubMed/NCBI

9 

Argo CK, Northup PG, Al-Osaimi AM and Caldwell SH: Systematic review of risk factors for fibrosis progression in non-alcoholic steatohepatitis. J Hepatol. 51:371–379. 2009. View Article : Google Scholar : PubMed/NCBI

10 

Yatsuji S, Hashimoto E, Tobari M, Taniai M, Tokushige K and Shiratori K: Clinical features and outcomes of cirrhosis due to non-alcoholic steatohepatitis compared with cirrhosis caused by chronic hepatitis C. J Gastroenterol Hepatol. 24:248–254. 2009. View Article : Google Scholar : PubMed/NCBI

11 

Nagai K, Kohno K, Chiba M, Pak S, Murata S, Fukunaga K, Kobayashi A, Yasue H and Ohkohchi N: Differential expression profiles of sense and antisense transcripts between HCV-associated hepatocellular carcinoma and corresponding non-cancerous liver tissue. Int J Oncol. 40:1813–1820. 2012.PubMed/NCBI

12 

Tan Y, Ge G, Pan T, Wen D and Gan J: A pilot study of serum microRNAs panel as potential biomarkers for diagnosis of nonalcoholic fatty liver disease. PLoS One. 9:e1051922014. View Article : Google Scholar : PubMed/NCBI

13 

Matsumoto M, Hada N, Sakamaki Y, Uno A, Shiga T, Tanaka C, Ito T, Katsume A and Sudoh M: An improved mouse model that rapidly develops fibrosis in non-alcoholic steatohepatitis. Int J Exp Pathol. 94:93–103. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Toita R and Kang JH: Long-term profile of serological biomarkers, hepatic inflammation, and fibrosis in a mouse model of non-alcoholic fatty liver disease. Toxicol Lett. 332:1–6. 2020. View Article : Google Scholar : PubMed/NCBI

15 

Wang L, Jia XJ, Jiang HJ, Du Y, Yang F, Si SY and Hong B: MicroRNAs 185, 96, and 223 repress selective high-density lipoprotein cholesterol uptake through posttranscriptional inhibition. Mol Cell Biol. 33:1956–1964. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Qadir XV, Chen W, Han C, Song K, Zhang J and Wu T: miR-223 deficiency protects against fas-induced hepatocyte apoptosis and liver injury through targeting insulin-like growth factor 1 receptor. Am J Pathol. 185:3141–3151. 2015. View Article : Google Scholar : PubMed/NCBI

17 

Katsura A, Morishita A, Iwama H, Tani J, Sakamoto T, Tatsuta M, Toyota Y, Fujita K, Kato K, Maeda E, et al: MicroRNA profiles following metformin treatment in a mouse model of non-alcoholic steatohepatitis. Int J Mol Med. 35:877–884. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Kuivaniemi H and Tromp G: Type III collagen (COL3A1): Gene and protein structure, tissue distribution, and associated diseases. Gene. 707:151–171. 2019. View Article : Google Scholar : PubMed/NCBI

19 

Huang Y, He Y and Li J: MicroRNA-21: A central regulator of fibrotic diseases via various targets. Curr Pharm Des. 21:2236–2242. 2015. View Article : Google Scholar : PubMed/NCBI

20 

Loyer X, Paradis V, Hénique C, Vion AC, Colnot N, Guerin CL, Devue C, On S, Scetbun J, Romain M, et al: Liver microRNA-21 is overexpressed in non-alcoholic steatohepatitis and contributes to the disease in experimental models by inhibiting PPARα expression. Gut. 65:1882–1894. 2016. View Article : Google Scholar : PubMed/NCBI

21 

Becker PP, Rau M, Schmitt J, Malsch C, Hammer C, Bantel H, Müllhaupt B and Geier A: Performance of serum microRNAs −122, −192 and −21 as biomarkers in patients with non-alcoholic steatohepatitis. PLoS One. 10:e01426612015. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Matsumoto K, Kato Y, Hayashi M, Miura R, Monzen S and Chiba M: Hepatic gene expression and functional changes associated with nonalcoholic steatohepatitis. Mol Med Rep 26: 325, 2022.
APA
Matsumoto, K., Kato, Y., Hayashi, M., Miura, R., Monzen, S., & Chiba, M. (2022). Hepatic gene expression and functional changes associated with nonalcoholic steatohepatitis. Molecular Medicine Reports, 26, 325. https://doi.org/10.3892/mmr.2022.12841
MLA
Matsumoto, K., Kato, Y., Hayashi, M., Miura, R., Monzen, S., Chiba, M."Hepatic gene expression and functional changes associated with nonalcoholic steatohepatitis". Molecular Medicine Reports 26.5 (2022): 325.
Chicago
Matsumoto, K., Kato, Y., Hayashi, M., Miura, R., Monzen, S., Chiba, M."Hepatic gene expression and functional changes associated with nonalcoholic steatohepatitis". Molecular Medicine Reports 26, no. 5 (2022): 325. https://doi.org/10.3892/mmr.2022.12841
Copy and paste a formatted citation
x
Spandidos Publications style
Matsumoto K, Kato Y, Hayashi M, Miura R, Monzen S and Chiba M: Hepatic gene expression and functional changes associated with nonalcoholic steatohepatitis. Mol Med Rep 26: 325, 2022.
APA
Matsumoto, K., Kato, Y., Hayashi, M., Miura, R., Monzen, S., & Chiba, M. (2022). Hepatic gene expression and functional changes associated with nonalcoholic steatohepatitis. Molecular Medicine Reports, 26, 325. https://doi.org/10.3892/mmr.2022.12841
MLA
Matsumoto, K., Kato, Y., Hayashi, M., Miura, R., Monzen, S., Chiba, M."Hepatic gene expression and functional changes associated with nonalcoholic steatohepatitis". Molecular Medicine Reports 26.5 (2022): 325.
Chicago
Matsumoto, K., Kato, Y., Hayashi, M., Miura, R., Monzen, S., Chiba, M."Hepatic gene expression and functional changes associated with nonalcoholic steatohepatitis". Molecular Medicine Reports 26, no. 5 (2022): 325. https://doi.org/10.3892/mmr.2022.12841
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team