Introduction
Postoperative peritoneal adhesion (PPA) represents
one of the most common complications following abdominal and pelvic
surgery, profoundly affecting patients' postoperative recovery and
long-term prognosis. Epidemiological data indicate that the overall
incidence of PPA in patients undergoing intra-abdominal procedures
ranges from 90 to 95% (1,2). PPA is defined as pathological fibrous
connections formed between the peritoneal serosa, intestinal walls,
omentum and other intra-abdominal tissues after surgical trauma.
These adhesions not only cause immediate postoperative discomfort
but also give rise to a spectrum of serious long-term sequelae,
including recurrent chronic abdominal pain, repeated intestinal
obstruction, female infertility due to pelvic adhesions and
increased surgical risks during subsequent reoperations (3–5). In
clinical practice, intra-abdominal adhesions substantially increase
the difficulty of secondary laparoscopic and open surgeries,
prolong operative time, and elevate the risks of intraoperative
bleeding, visceral injury and postoperative infection. These
complications impose immense physical suffering, financial burdens
and psychological stress on patients, while also placing a heavy
strain on healthcare systems worldwide (6,7).
Despite the availability of various preventive strategies in
clinical settings, effective interventions remain limited (8–10).
Therefore, identifying reliable pharmacological targets and
effective therapeutic agents to suppress the formation and
progression of PPA is an urgent and valuable research
direction.
The pathogenesis of PPA is a multifactorial,
multi-stage process involving acute inflammation, fibrin exudation
and abnormal deposition, excessive extracellular matrix (ECM)
accumulation, collagen proliferation and remodeling, and aberrant
angiogenesis. Among these, the imbalance of fibrin metabolism and
subsequent peritoneal overfibrosis represent the core pathological
events leading to irreversible adhesion formation (11,12).
Under normal physiological conditions, the peritoneal mesothelium
possesses robust barrier and fibrinolytic activities, maintaining a
dynamic equilibrium between fibrin production and degradation.
However, surgical mechanical injury, peritoneal ischemia and
inflammatory stimuli disrupt the integrity of the mesothelial
barrier, triggering extensive inflammatory cell infiltration and
the release of proinflammatory cytokines. This promotes massive
fibrin exudation while simultaneously suppressing endogenous
fibrinolysis. The undegraded fibrin matrix subsequently serves as a
scaffold for fibrous tissue proliferation, inducing the activation
and differentiation of peritoneal fibroblasts, which ultimately
culminate in abundant collagen deposition and peritoneal fibrosis,
resulting in permanent postoperative adhesions (13).
Transforming growth factor-β1 (TGF-β1) is widely
recognized as the most critical profibrotic cytokine in peritoneal
fibrosis and PPA formation, playing a dominant regulatory role
throughout the pathological cascade (14). Both clinical and basic research
have consistently demonstrated that surgical peritoneal injury
markedly upregulates the local expression and secretion of TGF-β1
in peritoneal tissues, and that elevated TGF-β1 levels are
positively correlated with the severity of peritoneal adhesions and
fibrosis (15,16). The canonical TGF-β1/Smad signaling
pathway is the major downstream mediator of TGF-β1-induced fibrotic
effects. Upon binding to its specific membrane receptors, TGF-β1
activates the phosphorylation of downstream Smad2 and Smad3
proteins. Phosphorylated Smad2/3 then form complexes with Smad4 and
translocate into the nucleus, where they transcriptionally activate
profibrotic genes. Numerous previous studies have confirmed that
targeted inhibition of aberrant TGF-β1/Smad pathway activation
effectively attenuates peritoneal fibrosis and blocks PPA formation
(17–19).
Aspirin, a classic and widely used non-steroidal
anti-inflammatory drug (NSAID), possesses well-established
anti-inflammatory, analgesic, antipyretic and anticoagulant
pharmacological properties (20).
In recent years, growing evidence has revealed that aspirin exerts
significant antifibrotic bioactivity in various organ fibrosis
models. Clinical studies have demonstrated that aspirin can reduce
hepatic fibrosis markers in patients with chronic liver disease
(21) and ameliorate cardiac
fibrosis (22,23), These findings collectively
highlight the broad-spectrum antifibrotic potential of aspirin
across diverse tissue microenvironments. Given that peritoneal
fibrosis is the central pathological mechanism underlying PPA, we
hypothesized that aspirin may alleviate adhesion formation by
inhibiting postoperative peritoneal fibrosis. However, the effect
of aspirin on PPA and its regulatory role in the TGF-β1/Smad
pathway remain largely unexplored.
In the present study, a stable rat PPA model was
established using the cecal abrasion method. Through both in
vivo animal experiments and in vitro cellular assays,
the preventive efficacy of different doses of aspirin on PPA in
rats was systematically evaluated. Concurrently, the study focused
on the core TGF-β1/Smad signaling cascade and examined the
expression levels of key pathway proteins and fibrosis-related
markers to elucidate the molecular mechanisms by which aspirin
inhibits peritoneal fibrosis and ameliorates PPA. The findings aim
to provide robust experimental evidence and theoretical support for
the clinical translation and application of aspirin as an
affordable, safe and effective agent for the prevention of
postoperative peritoneal adhesions.
Materials and methods
Animals
A total of 32 healthy male Sprague-Dawley rats
(6-week-old, weighing 200–220 g) were supplied by Speyford
Biotechnology Co., Ltd. The animals were housed under standard
conditions at a temperature of 20–25°C and relative humidity of
40–50%, with a 12/12-h light/dark cycle. Food and water were
provided ad libitum. The present study was approved by the
Animal Ethics Committee of the First Affiliated Hospital of Yangtze
University (approval no. KY20435; Jingzhou, China).
Drugs
Aspirin was purchased from Bayer AG. It was
dissolved in dimethyl sulfoxide (DMSO) and subsequently diluted in
culture medium to final concentrations of 1 mmol/l and 3 µmol/l,
respectively.
Cell culture
Rat primary peritoneal mesothelial cells (RPMCs; cat
no. CP-R157) were obtained from Wuhan Pricella Biotechnology Co.,
Ltd. (https://www.biomart.cn/infosupply/119487195.htm). The
cells were received at passage 1. They were cultured in RPMI-1640
medium supplemented with 10% fetal bovine serum (Gibco; Thermo
Fisher Scientific, Inc.), 100 U/ml penicillin and 100 µg/ml
streptomycin (Beyotime Institute of Biotechnology) at 37°C in a
humidified atmosphere containing 5% CO2. Based on a
previous study (24) and cell
viability assays (Fig. S1), the
cells at passages 2–4 were treated with 1 mmol/l or 3 mmol/l
aspirin for 24 h. Control cells were treated with an equal volume
of culture medium containing 0.1% DMSO.
Establishment of PPA model and drug
administration
SD rats were randomly assigned to four groups (n=8
per group). Following fasting for 12 h, the rats were anesthetized
by intraperitoneal injection of 3% sodium pentobarbital at a dose
of 30 mg/kg (0.1 ml/100 g). Following hair removal and
disinfection, a midline abdominal incision (~2 cm) was made to
expose the cecum. In the model group and in the aspirin-treated
groups, a sterile dry gauze (2×2 cm, 12 layers) was used to rub the
cecal wall and the corresponding parietal peritoneum back and forth
15 times under moderate pressure (~0.5 N) until petechiae appeared
on the surface. The abraded tissues were left exposed for 5 min
prior returning to the abdominal cavity. The muscle layer and skin
were sutured layer by layer. In the sham-operated group, only
laparotomy and closure were performed without any cecal abrasion.
Based on previous findings (25),
the postoperative treatments were as follows: Both the sham and
model groups were administered 2 ml normal saline daily by gavage
for 8 consecutive days; the low-dose aspirin group received aspirin
at 10 mg/kg (dissolved in 2 ml normal saline); and the high-dose
aspirin group received aspirin at 30 mg/kg (dissolved in 2 ml
normal saline). Both aspirin groups were treated for 8 consecutive
days. The total experimental duration from surgery to euthanasia
was 8 days. Animal health and behavior were monitored twice daily
throughout the experimental period. Humane endpoints were defined
in accordance with the ARRIVE guidelines (26): (i) Body weight loss exceeding 20%
within 48 h; (ii) inability to access food or water due to severe
abdominal distension or immobility; (iii) persistent hunched
posture, piloerection, or lethargy unresponsive to environmental
enrichment; (iv) signs of severe pain (for example, vocalization,
self-mutilation, or aggressive behavior); (v) respiratory distress
or cyanosis. Any animal meeting one or more of these criteria was
immediately deeply anesthetized with intraperitoneal sodium
pentobarbital (30 mg/kg) and then euthanized by cervical
dislocation. No animals reached these endpoints or succumbed
unexpectedly during the study; all 32 rats completed the experiment
and were included in the final analysis. To minimize suffering, all
surgical procedures were performed under deep anesthesia induced by
sodium pentobarbital (30 mg/kg, intraperitoneal injection). No
postoperative analgesics were administered, as pilot studies
indicated that the model induced only mild and transient
discomfort. Nevertheless, the animals were closely monitored, and
any signs of pain would have prompted immediate analgesic
intervention (buprenorphine 0.05 mg/kg, subcutaneous injection) or
euthanasia according to the humane endpoints. At 6 h after the last
administration (day 8), all rats were anesthetized with 3% sodium
pentobarbital (0.1 ml/100 g, intraperitoneal injection) and
subsequently euthanized by cervical dislocation. Death was
confirmed by observing (i) cessation of heartbeat and respiration
for at least 5 min, (ii) fixed and dilated pupils, and (iii)
absence of pedal and corneal reflexes. All animal experiments were
conducted in accordance with the Guide for the Care and Use of
Laboratory Animals.
Evaluation of adhesion/severity
On the 8th postoperative day, the rats were
euthanized and a U-shaped incision was made to open the abdominal
cavity. The severity of adhesions was assessed in a blinded manner
by two independent observers according to the Nair scoring system
(Table I) (27). Following adhesion scoring, the
entire adhesion tissue was excised. Each sample was bisected
longitudinally: One-half was fixed in 4% paraformaldehyde for 24 h
for histological and immunohistochemical (IHC) analyses and the
one-other half was snap-frozen in liquid nitrogen and stored at
−80°C for western blotting and reverse transcription-quantitative
PCR (RT-qPCR) analyses. All sample divisions were performed by the
same researcher using standardized anatomical landmarks.
 | Table I.Peritoneal adhesion scoring system
according to the Nair scoring system. |
Table I.
Peritoneal adhesion scoring system
according to the Nair scoring system.
| Grade | Description of
adhesive bands |
|---|
| 0 | No adhesions |
| 1 | A single, filmy
adhesive band; easily separable by blunt dissection |
| 2 | More than one filmy
adhesion; blunt dissection is slightly difficult but
achievable |
| 3 | Dense adhesion;
requires sharp dissection |
| 4 | Very dense
adhesions; severe distortion of visceral anatomy due to adhesions,
making separation extremely difficult |
Histopathology and IHC analysis
The adhesion tissues were fixed in 4%
paraformaldehyde for 24 h, embedded in paraffin and sectioned at a
thickness of 4 µm. Collagen deposition was detected using a
Masson's trichrome staining kit (Wuhan Saiwei Biotechnology Co.,
Ltd.) following the manufacturer's instructions: Sections were
dewaxed, rehydrated and stained for 15 min. For IHC, sections were
sequentially dewaxed in xylene and dehydrated through a graded
ethanol series. Antigen retrieval was performed by microwave
heating in citrate buffer (pH 6.0) for 15 min. Following blocking
with 10% bovine serum albumin (Beijing Dingguo Changsheng
Biotechnology Co., Ltd.) at room temperature for 15 min, the
sections were incubated overnight at 4°C with the following primary
antibodies: Rabbit anti-TGF-β1 (1:200; cat. no. BM3901; Boster
Biological Technology), rabbit anti-COL1A1 (1:200; cat. no. F1228;
Selleck Chemicals), rabbit anti-alpha smooth muscle actin (α-SMA;
1:2,000; cat. no. 14395-1-ap; Proteintech Group, Inc.), rabbit
anti-p-Smad2 (1:200; cat. no. AY0742; Shanghai Abways Biotechnology
Co., Ltd.) and rabbit anti-p-Smad3 (1:200; cat. no. CY5140;
Shanghai Abways Biotechnology Co., Ltd.). Following washing, the
sections were incubated with horseradish peroxidase-conjugated goat
anti-rabbit IgG secondary antibody (1:500; cat. no. PN0046; Wuhan
Pinwofei Biotechnology Co., Ltd.) at 37°C for 1 h. Color
development was performed using 3,3′-diaminobenzidine for 90 sec,
followed by counterstaining with hematoxylin for 5 min. The
sections were subsequently dehydrated, cleared and mounted. The
images of three random fields per section were captured using a
Nikon Digital Eclipse C1 confocal microscope. The positively
stained areas were quantified using ImageJ software (version 1.44p;
National Institutes of Health), and the mean value of the three
fields was used for statistical analysis.
Western blot analysis
Total protein was extracted from adhesion tissues
using RIPA lysis buffer (Beyotime Institute of Biotechnology)
containing protease and phosphatase inhibitors. Protein
concentration was determined using the BCA assay (Thermo Fisher
Scientific, Inc.) according to the manufacturer's protocol. Equal
amounts of protein (20 µg per lane) were separated on 10% gels
using SDS-PAGE and transferred onto polyvinylidene difluoride
membranes. Following blocking with 5% skimmed milk for 1 h at 4°C,
the membranes were incubated overnight at 4°C with the following
primary antibodies: Rabbit anti-TGF-β1 (1:1,000; cat. no. ab215715;
Abcam), rabbit anti-COL1A1 (1:1,500; cat. no. ab316222; Abcam),
rabbit anti-α-SMA (1:2,000; cat. no. ab32575; Abcam), rabbit
anti-p-Smad2 (1:1,000; cat. no. 3108; Cell Signaling Technology,
Inc.), rabbit anti-Smad2 (1:500; cat. no. 1641-1; Epitomics;
Abcam), rabbit anti-p-Smad3 (1:1,000; cat. no. 1880-1; Epitomics;
Abcam), rabbit anti-Smad3 (1:500; cat. no. 1735-1; Epitomics;
Abcam), rabbit anti-Smad6 (1:200; cat. no. sc-13048; Santa Cruz
Biotechnology, Inc.) and rabbit anti-GAPDH (1:20,000; cat. no.
KC-5G4; Kangcheng Biotechnology). Following washes with TBST
containing 0.1% Tween-20, the blots were treated with
HRP-conjugated goat anti-rabbit IgG secondary antibody (1:5,000;
cat. no. ZB-5301; Beijing Zhongshan Golden Bridge Biotechnology
Co., Ltd.) for 1 h at room temperature. The protein signals were
developed using an ECL chemiluminescence substrate (Thermo Fisher
Scientific, Inc.) and captured with a ChemiDoc™ imaging system
(Bio-Rad Laboratories, Inc.).
RT-qPCR
Total RNA was isolated from cells using
TRIzol® reagent (Life Technologies; Thermo Fisher
Scientific, Inc.), following the provided protocol. A
PrimeScript® RT reagent kit (Takara Bio, Inc.) was
employed for cDNA synthesis. Quantitative PCR was conducted with a
SYBR Green PCR Master Mix-PLUS kit (Toyobo Co., Ltd.) on a CFX96
Touch™ Real-Time PCR Detection System (Bio-Rad Laboratories, Inc.)
The experimental procedures were performed as previously described
(18). All primer sequences
(listed in Table II) were
obtained from Sangon Biotech Co., Ltd. GAPDH was used as the
internal reference gene. The relative mRNA expression levels were
calculated using the 2−ΔΔCq method (28).
| Table II.Primer sequences for reverse
transcription-quantitative PCR. |
Table II.
Primer sequences for reverse
transcription-quantitative PCR.
| Gene name | Primer sequence
(5′-3′) | Product size,
bp |
|---|
| COL1A1 | F:
GAGAGAGCATGACCGATGGA | 251 |
|
| R:
CGTGCTGTAGGTGAATCGAC |
|
| α-SMA | F:
TGTGCTGGACTCTGGAGATG | 148 |
|
| R:
GAAGGAATAGCCACGCTCAG |
|
| GAPDH | F:
GACATCAAGAAGGTGGTG | 124 |
|
| R:
CAGCATCAAAGGTGGAAG |
|
Statistical analysis
The measurement data are expressed as the mean ±
standard deviation. The Shapiro-Wilk test was used to assess
normality and the Levene's test was used to evaluate homogeneity of
variances. For data satisfying both assumptions, one-way analysis
of variance (ANOVA) followed by Tukey's post hoc test was
performed. For data that did not meet these assumptions, the
Kruskal-Wallis test followed by Dunn's post hoc test was applied.
The graphs were generated using GraphPad Prism 9.0 software
(Dotmatics) and statistical analysis was conducted using SPSS 27.0
software (IBM Corp.). P<0.05 was considered to indicate a
statistically significant difference.
Results
Aspirin attenuates the severity of PPA
in rats
Representative images illustrating the formation of
intraperitoneal adhesions in each group are shown in Fig. 1A and B. No apparent adhesions were
observed in the sham-operated group. In contrast to these
observations, the model group exhibited extensive, dense and severe
adhesions, which led to distortion of the visceral anatomy and made
the adhesions difficult to separate. Aspirin treatment
significantly reduced the adhesion score compared with the model
group.
Aspirin attenuates PPA fibrosis in
rats
Masson's trichrome staining revealed extensive
collagen deposition (blue staining) in the peritoneal adhesion
tissues of the model group compared with that of the sham-operated
group (Fig. 2A). Aspirin treatment
significantly reduced the levels of collagen deposition, with the
high-dose aspirin group indicating a more pronounced inhibitory
effect than the low-dose group (Fig.
2B). IHC staining was further performed to assess the
expression of fibrosis markers, α-SMA and collagen type I α1 chain
(COL1A1). The results demonstrated markedly enhanced positive
staining for both markers in the model group. In contrast to these
observations, the aspirin-treated groups exhibited significantly
lower positivity in both area and intensity for COL1A1 and α-SMA
compared with that of the model group (Fig. 3A-C). To validate these findings,
RT-qPCR and western blot analyses were conducted. The results
indicated that the mRNA and protein expression levels of α-SMA and
COL1A1 were significantly downregulated in the aspirin-treated
groups compared with those of the model group, with the high-dose
group again demonstrating a more potent effect (Figs. 3D, E and 4A-C). Collectively, these results
indicate that aspirin effectively attenuates PPA fibrosis in
rats.
 | Figure 4.Aspirin downregulates the protein
expression of α-SMA, COL1A1 and the TGF-β1-Smad2/Smad3 signaling
pathway in postoperative peritoneal adhesion. (A) The protein
expression levels of α-SMA, COL1A1, TGF-β1, p-Smad2, p-Smad3, Smad2
and Smad3 in adhesion tissues were detected by western blot
analysis. (B-F) The relative protein expression levels of (B)
α-SMA, (C) COL1A1, (D) TGF-β1, (E) p-Smad2 and (F) p-Smad3 were
quantified (n=8). *P<0.05 vs. the sham group;
#P<0.05 vs. the model group. α-SMA, α-smooth muscle
actin; COL1A1, collagen type I α1 chain; HA, high-dose aspirin; LA,
low-dose aspirin; p-, phosphorylated; LA, low-dose aspirin; TGF-β1,
transforming growth factor-β1. |
Aspirin attenuates PPA fibrosis by
inhibiting the TGF-β1/Smad signaling pathway
To explore the underlying molecular mechanism by
which aspirin alleviates peritoneal adhesion fibrosis, the
expression levels of key proteins in the TGF-β1/Smad signaling
pathway was examined. Western blotting and IHC analyses revealed
that the protein expression levels of TGF-β1, phosphorylated (p-)
Smad2 and p-Smad3 were significantly elevated in the model group.
Aspirin treatment effectively suppressed the expression levels of
these proteins, with the high-dose group indicating a more
significant inhibitory effect. However, no notable changes were
observed in the total protein levels of Smad2 and Smad3 across the
groups (Figs. 4A, D-F and 5A-D). These findings suggest that the
antifibrotic effect of aspirin may be associated with the
inhibition of the TGF-β1/Smad signaling pathway activation.
 | Figure 5.Aspirin downregulates the expression
levels of the TGF-β1-Smad2/Smad3 pathway-related proteins in
postoperative peritoneal adhesion. (A) Representative
immunohistochemical staining of TGF-β1, p-Smad2, p-Smad3, Smad2 and
Smad3 (magnification, ×200; scale bar, 50 µm). (B-D) Quantitative
analysis of positive staining areas for (B) TGF-β1, (C) p-Smad2 and
(D) p-Smad3, performed using ImageJ software (n=8). *P<0.05 vs.
sham group; #P<0.05 vs. model group. HA, high-dose
aspirin; LA, low-dose aspirin; p-, phosphorylated; TGF-β1,
transforming growth factor-β1. |
In vitro effects of aspirin on
RPMCs
To further investigate whether aspirin exerts its
effects via regulation of the TGF-β1/Smad signaling pathway at the
cellular level, RPMCs were treated with varying concentrations of
aspirin. The results demonstrated that aspirin dose-dependently
downregulated the protein expression of α-SMA, COL1A1, TGF-β1,
p-Smad2 and p-Smad3, while upregulating the expression levels of
Smad6, an inhibitory regulator of the pathway (Fig. 6A-G). These in vitro findings
are consistent with the observations from the in vivo
experiments. Taken collectively, the data confirm that aspirin can
suppress the expression of fibrosis-related proteins by modulating
the TGF-β1/Smad signaling pathway, thereby exerting an antifibrotic
effect on postoperative peritoneal fibrosis.
 | Figure 6.Impact of varying aspirin
concentrations on α-SMA, COL1A1, TGF-β1, Smad6, p-Smad2 and p-Smad3
protein expressions in RPMCs. (A) Western blotting was performed to
assess the protein levels of TGF-β1, COL1A1, α-SMA, Smad6, p-Smad2,
p-Smad3, Smad2 and Smad3 in RPMCs. (B-G) Quantified relative
protein expression of (B) TGF-β1, (C) COL1A1, (D) α-SMA, (E) Smad6,
(F) p-Smad2 and (G) p-Smad3. &P<0.05 compared
with the DMSO group. α-SMA, α-smooth muscle actin; COL1A1, collagen
type I α1 chain; DMSO, dimethyl sulfoxide; HA, high-dose aspirin;
LA, low-dose aspirin; p-, phosphorylated; RPMCs, rat primary
peritoneal mesothelial cells; TGF-β1, transforming growth
factor-β1. |
Discussion
PPA is a common complication following abdominal
surgery, with an incidence as high as 90–95% (29). It is widely accepted that its
formation initiates from an inflammatory response triggered by
peritoneal injury, leading to excessive collagen deposition and
adhesion development (14).
Consequently, interventions capable of inhibiting collagen
production may aid in preventing or reducing PPA. However, there
are currently no safe and effective pharmacological agents or
measures to prevent PPA, underscoring the requirement for further
research and development of novel anti-adhesive drugs. The present
study demonstrated that aspirin effectively prevented PPA in rats.
Notably, the anti-adhesion effect observed with high-dose aspirin
treatment was comparable to that of sodium hyaluronate (HA), a
well-established anti-adhesive agent reported in the literature
(30,31). This finding strongly supports the
potential of aspirin as a candidate drug for the prevention of PPA.
Mechanistically, the protective effect of aspirin against PPA was
primarily mediated by regulating the key profibrotic signaling
pathway (TGF-β1/Smad pathway), thereby attenuating excessive ECM
deposition and the fibrotic process.
The pathogenesis of PPA is closely associated with
peritoneal fibrosis, which is characterized by excessive
accumulation of ECM (8,32). TGF-β1 serves as a central driver of
this fibrotic process (33,34).
In the present study, it was found that TGF-β1 expression was
significantly upregulated in the adhesion model. Notably, aspirin
treatment dose-dependently reduced the expression levels of TGF-β1,
type I collagen and α-SMA both in vivo and in vitro.
These findings extend the known pharmacological actions of aspirin
from anticoagulation and anti-inflammation to anti-fibrosis, which
is consistent with its previously reported anti-fibrotic effects in
hepatic fibrosis and endometrial fibrosis (35,36),
suggesting that its antifibrotic action may be
organ-non-specific.
The profibrotic effect of TGF-β1 is primarily
mediated via the canonical Smad signaling pathway (17). TGF-β1 induces the phosphorylation
of Smad2 and Smad3. p-Smad2/3 subsequently forms a transcriptional
complex with Smad4, which translocates into the nucleus and
activates the transcription of downstream target genes, including
those encoding fibronectin, α-SMA and type I collagen, ultimately
leading to excessive ECM synthesis and abnormal deposition
(37). In the present study, it
was found that aspirin not only reduced the expression levels of
TGF-β1 but also decreased the levels of p-Smad2/3, thereby
suppressing the transcription of fibrosis-related target genes,
such as COL1A1 and α-SMA. These findings provide a clear molecular
mechanistic explanation with regard to the ability of aspirin to
alleviate ECM deposition and inhibit fibrosis. The high consistency
between the in vivo and in vitro results strengthens
the reliability of this conclusion. In addition, it was observed
that aspirin treatment increased the expression levels of Smad6,
which is consistent with a previous study (38). Smad6 is an inhibitory Smad;
however, whether it interferes with the phosphorylation and nuclear
translocation of Smad2/3 in the context of peritoneal fibrosis
warrants further investigation.
The findings of the present study exhibit important
translational implications. Aspirin is a classic non-steroidal
anti-inflammatory drug with a long history of use, a
well-established safety profile and low cost (39). If its efficacy in preventing
adhesions is confirmed in subsequent clinical studies, it has the
potential to be rapidly translated into a widely applicable
clinical preventive strategy. This can reduce the difficulty of
reoperation and related complications and also aid the improvement
of patient long-term prognosis.
Nevertheless, the present study exhibits several
limitations. Firstly, although the regulatory effect of aspirin was
elucidated on the TGF-β1/Smad signaling pathway, the expression
levels of the TGF-β receptors, the involvement of Smad4, or the
nuclear translocation of p-Smad2/3 were not evaluated. Moreover,
the precise upstream molecular targets of aspirin (for example,
whether it acts directly on the TGF-β1 receptor or upstream
kinases) remain unclear, resulting in an incomplete mechanistic
chain that warrants further investigation. Secondly, the
conclusions are derived from a rat model, and no positive control
group such as HA was included. The optimal timing, dosage,
treatment duration and safety of aspirin for preventing
postoperative adhesions in humans still require validation via the
conduct of well-designed clinical trials. Finally, the formation of
peritoneal adhesions involves crosstalk among multiple signaling
pathways such as the Wnt/β-catenin and the MAPK pathways. Whether
aspirin also influences these pathways warrants further
investigation.
In summary, the present study indicated that aspirin
prevented PPA in rats by inhibiting postoperative peritoneal
fibrosis. The underlying mechanism was likely associated with the
suppression of the TGF-β1/Smad signaling pathway, leading to
reduced expression of fibrosis-related proteins such as α-SMA and
collagen. The present study provides experimental evidence
supporting the potential clinical application of aspirin as a
preventive agent for PPA and offers a novel strategy for reducing
PPA-related complications.
Supplementary Material
Supporting Data
Acknowledgements
Not applicable.
Funding
The present study was supported by the Jingzhou Joint Research
Fund (grant no. 2024LHY19) and the Innovation and Development Joint
Fund of the Natural Science Foundation of Hubei (grant no.
2026AFC0589).
Availability of data and materials
The data generated in the present study may be
requested from the corresponding author.
Authors' contributions
YS and PX conceptualized and designed the study. SY
and YR jointly performed the experiments, analyzed the data,
curated the research data (including organizing, cleaning and
maintaining the raw data to ensure its interpretability and
reusability) and wrote the original draft. BL contributed to the
interpretation of the experimental data, and together with PX,
supervised the overall research process and managed project
administration. YS reviewed and critically revised the manuscript.
YS and PX confirm the authenticity of all the raw data. All authors
read and approved the final version of the manuscript.
Ethics approval and consent to
participate
The animal study protocol was approved by the Animal
Ethics Committee of The First Affiliated Hospital of Yangtze
University (approval no. KY20435; Jingzhou, China).
Patient consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing
interests.
References
|
1
|
Beyene RT, Kavalukas SL and Barbul A:
Intra-abdominal adhesions: Anatomy, physiology, pathophysiology,
and treatment. Curr Probl Surg. 52:271–319. 2015. View Article : Google Scholar : PubMed/NCBI
|
|
2
|
Okabayashi K, Ashrafian H, Zacharakis E,
Hasegawa H, Kitagawa Y, Athanasiou T and Darzi A: Adhesions after
abdominal surgery: A systematic review of the incidence,
distribution and severity. Surg Today. 44:405–420. 2014. View Article : Google Scholar : PubMed/NCBI
|
|
3
|
Duron JJ, Silva NJ, du Montcel ST, Berger
A, Muscari F, Hennet H, Veyrieres M and Hay JM: Adhesive
postoperative small bowel obstruction: Incidence and risk factors
of recurrence after surgical treatment: A multicenter prospective
study. Ann Surg. 244:750–757. 2006. View Article : Google Scholar : PubMed/NCBI
|
|
4
|
Stratakis K, Kalogiannis E, Thanopoulos A,
Grigoriadis G, Roditis S, Kaliatsi EG, Nikiteas N, Kontzoglou K and
Perrea D: Mechanisms and therapeutic approaches for peritoneal
adhesions: A comprehensive review. Chirurgia (Bucur). 118:113–126.
2023. View Article : Google Scholar : PubMed/NCBI
|
|
5
|
Schaefer SD, Alkatout I, Dornhoefer N,
Herrmann J, Klapdor R, Meinhold-Heerlein I, Meszaros J, Mustea A,
Oppelt P, Wallwiener M and Kraemer B: Prevention of peritoneal
adhesions after gynecological surgery: A systematic review. Arch
Gynecol Obstet. 310:655–672. 2024. View Article : Google Scholar : PubMed/NCBI
|
|
6
|
Tingstedt B, Isaksson J and Andersson R:
Long-term follow-up and cost analysis following surgery for small
bowel obstruction caused by intra-abdominal adhesions. Br J Surg.
94:743–748. 2007. View
Article : Google Scholar : PubMed/NCBI
|
|
7
|
Munro MG, Salazar CA, Bhagavath B, Emanuel
MH, Huddleston HG, Sobti D, Jaiswal AK, Gamburg R, Kumar J, Martin
C, et al: The epidemiology, clinical burden, and prevention of
intrauterine adhesions (IUAs) related to surgically induced
endometrial trauma: A systematic literature review and selective
meta-analyses. Hum Reprod Update. 31:588–625. 2025.PubMed/NCBI
|
|
8
|
Pascual-Antón L, Sandoval P, Tomero-Sanz
H, Terri M, Strippoli R, García-Sanz Í, Marín-Campos C, Del Pozo
MA, Obaid M, Garcia V, et al: Sprayable extracellular matrix
hydrogel reduces postoperative adhesion formation and protects
healing tissues in preclinical models. Sci Transl Med.
17:eadn31792025. View Article : Google Scholar : PubMed/NCBI
|
|
9
|
Ma Y, Sun T, Ren K, Ma R, Min T, Wang X,
Yuan Y, Xie X, Zhang B, Deng X, et al: Plasma-activated solutions
prevent peritoneal adhesion formation by regulating eNOS expression
in mesothelial cells. J Adv Res. 78:555–571. 2025. View Article : Google Scholar : PubMed/NCBI
|
|
10
|
Ren L, Luo Y, Huang Y, Shi X, Lin H, Zhang
T, Gong Y, Liu Y, Zheng D, Li W, et al: Engineering ROS-responsive
double network hydrogel as bioactive barrier for postoperative
abdominal adhesions prevention. Bioact Mater. 53:269–286.
2025.PubMed/NCBI
|
|
11
|
Hellebrekers BW and Kooistra T:
Pathogenesis of postoperative adhesion formation. Br J Surg.
98:1503–1516. 2011. View
Article : Google Scholar : PubMed/NCBI
|
|
12
|
Lin Z, Liu Z, Huang Y and Zhao C:
Postoperative abdominal adhesions: pathogenesis and advances in
hydrogel-based multimodal prevention strategies. Acta Biomater.
204:76–108. 2025. View Article : Google Scholar : PubMed/NCBI
|
|
13
|
Mathewson AJ, Loszko AF, Ackerman JE,
Wilson NA and Loiselle AE: Cellular and molecular regulation of
fibrotic postoperative abdominal adhesions. Am J Physiol Cell
Physiol. 330:C1410–C1426. 2026. View Article : Google Scholar : PubMed/NCBI
|
|
14
|
Yang L, Fang Y, Lian Y, Kong Z, Miao J,
Chen Y, Li W, Chen F, Zhang B, Chen Y and Bian Y: Aloe-Emodin
targeting FOXC2 disrupts NETs formation and EMT-Driven
postoperative peritoneal adhesion through TGF-β1-Smad2/3 pathway.
Adv Sci (Weinh). 12:e110132025. View Article : Google Scholar : PubMed/NCBI
|
|
15
|
Ghellai AM, Stucchi AF, Chegini N, Ma C,
Andry CD, Kaseta JM, Burns JW, Skinner KC and Becker JM: Role of
transforming growth factor beta-1 in peritonitis-induced adhesions.
J Gastrointest Surg. 4:316–323. 2000. View Article : Google Scholar : PubMed/NCBI
|
|
16
|
Chegini N, Kotseos K, Zhao Y, Bennett B,
McLean FW, Diamond MP, Holmdahl L and Burns J: Differential
expression of TGF-beta1 and TGF-beta3 in serosal tissues of human
intraperitoneal organs and peritoneal adhesions. Hum Reprod.
16:1291–1300. 2001. View Article : Google Scholar : PubMed/NCBI
|
|
17
|
Gough NR, Xiang X and Mishra L: TGF-β
signaling in liver, pancreas, and gastrointestinal diseases and
cancer. Gastroenterology. 161:434–452. e4152021. View Article : Google Scholar : PubMed/NCBI
|
|
18
|
Sun Y, Liu B, Xie J, Jiang X, Xiao B, Hu X
and Xiang J: Aspirin attenuates liver fibrosis by suppressing
TGF-β1/Smad signaling. Mol Med Rep. 25:1812022. View Article : Google Scholar : PubMed/NCBI
|
|
19
|
Deng L, Li Q, Lin G, Huang D, Zeng X, Wang
X, Li P, Jin X, Zhang H, Li C, et al: P-glycoprotein mediates
postoperative peritoneal adhesion formation by enhancing
phosphorylation of the chloride channel-3. Theranostics. 6:204–218.
2016. View Article : Google Scholar : PubMed/NCBI
|
|
20
|
Vonkeman HE and van de Laar MA:
Nonsteroidal anti-inflammatory drugs: Adverse effects and their
prevention. Semin Arthritis Rheum. 39:294–312. 2010. View Article : Google Scholar : PubMed/NCBI
|
|
21
|
Jiang ZG, Feldbrügge L, Tapper EB, Popov
Y, Ghaziani T, Afdhal N, Robson SC and Mukamal KJ: Aspirin use is
associated with lower indices of liver fibrosis among adults in the
United States. Aliment Pharmacol Ther. 43:734–743. 2016. View Article : Google Scholar : PubMed/NCBI
|
|
22
|
Liu PP, Liu HH, Sun SH, Shi XX, Yang WC,
Su GH and Zhao J: Aspirin alleviates cardiac fibrosis in mice by
inhibiting autophagy. Acta Pharmacol Sin. 38:488–497. 2017.
View Article : Google Scholar : PubMed/NCBI
|
|
23
|
D'Agostino I, Tacconelli S, Bruno A,
Contursi A, Mucci L, Hu X, Xie Y, Chakraborty R, Jain K, Sacco A,
et al: Low-dose Aspirin prevents hypertension and cardiac fibrosis
when thromboxane A(2) is unrestrained. Pharmacol Res.
170:1057442021. View Article : Google Scholar : PubMed/NCBI
|
|
24
|
Zhang X, Feng H, Du J, Sun J, Li D,
Hasegawa T, Amizuka N and Li M: Aspirin promotes apoptosis and
inhibits proliferation by blocking G0/G1 into S phase in rheumatoid
arthritis fibroblast-like synoviocytes via downregulation of
JAK/STAT3 and NF-κB signaling pathway. Int J Mol Med. 42:3135–3148.
2018.PubMed/NCBI
|
|
25
|
Kapetanovic IM, Bauer KS, Tessier DM,
Lindeblad MO, Zakharov AD, Lubet R and Lyubimov A: Comparison of
pharmacokinetic and pharmacodynamic profiles of aspirin following
oral gavage and diet dosing in rats. Chem Biol Interact.
179:233–239. 2009. View Article : Google Scholar : PubMed/NCBI
|
|
26
|
Percie du Sert N, Ahluwalia A, Alam S,
Avey MT, Baker M, Browne WJ, Clark A, Cuthill IC, Dirnagl U,
Emerson M, et al: Reporting animal research: Explanation and
elaboration for the ARRIVE guidelines 2.0. PLoS Biol.
18:e30004112020. View Article : Google Scholar : PubMed/NCBI
|
|
27
|
Nair SK, Bhat IK and Aurora AL: Role of
proteolytic enzyme in the prevention of postoperative
intraperitoneal adhesions. Arch Surg. 108:849–853. 1974. View Article : Google Scholar : PubMed/NCBI
|
|
28
|
Livak KJ and Schmittgen TD: Analysis of
relative gene expression data using real-time quantitative PCR and
the 2(−Delta Delta C(T)) Method. Methods. 25:402–408. 2001.
View Article : Google Scholar : PubMed/NCBI
|
|
29
|
Ouaïssi M, Gaujoux S, Veyrie N, Denève E,
Brigand C, Castel B, Duron JJ, Rault A, Slim K and Nocca D:
Post-operative adhesions after digestive surgery: Their incidence
and prevention: review of the literature. J Visc Surg.
149:e104–e114. 2012. View Article : Google Scholar : PubMed/NCBI
|
|
30
|
Shi X, Wu Y, Li E, Zhang L, Ma Y, Wei G,
Li X and Wang S: The inhibitory effects of naringin in a rat model
of postoperative intraperitoneal adhesion formation. Evid Based
Complement Alternat Med. 2022:53315372022.PubMed/NCBI
|
|
31
|
Wu Y, Duan X, Gao Z, Yang N and Xue F:
AICAR attenuates postoperative abdominal adhesion formation by
inhibiting oxidative stress and promoting mesothelial cell repair.
PLoS One. 17:e02729282022. View Article : Google Scholar : PubMed/NCBI
|
|
32
|
Hu Q, Xia X, Kang X, Song P, Liu Z, Wang
M, Lu X, Guan W and Liu S: A review of physiological and cellular
mechanisms underlying fibrotic postoperative adhesion. Int J Biol
Sci. 17:298–306. 2021. View Article : Google Scholar : PubMed/NCBI
|
|
33
|
Jin X, Ren S, Macarak E and Rosenbloom J:
Pathobiological mechanisms of peritoneal adhesions: The mesenchymal
transition of rat peritoneal mesothelial cells induced by TGF-β1
and IL-6 requires activation of Erk1/2 and Smad2 linker region
phosphorylation. Matrix Biol. 51:55–64. 2016. View Article : Google Scholar : PubMed/NCBI
|
|
34
|
Li G, Ren Y, Li E, Deng K, Qu C, Zhang J,
Zhang L, Wang X, Lian J, Zhou H, et al: Quercetin inhibits
mesothelial-mesenchymal transition and alleviates postoperative
peritoneal adhesions by blocking the TGF-β1/PI3K/AKT pathway. J
Ethnopharmacol. 319((Pt 2)): 1172422024. View Article : Google Scholar : PubMed/NCBI
|
|
35
|
Zhang Z, Li S, Deng J, Yang S, Xiang Z,
Guo H, Xi H, Sang M and Zhang W: Aspirin inhibits endometrial
fibrosis by suppressing the TGF-β1-Smad2/Smad3 pathway in
intrauterine adhesions. Int J Mol Med. 45:1351–1360.
2020.PubMed/NCBI
|
|
36
|
Simon TG, Wilechansky RM, Stoyanova S,
Grossman A, Dichtel LE, Lauer GM, Miller KK, Hoshida Y, Corey KE,
Loomba R, et al: Aspirin for metabolic dysfunction-associated
steatotic liver disease without cirrhosis: A Randomized clinical
trial. JAMA. 331:920–929. 2024. View Article : Google Scholar : PubMed/NCBI
|
|
37
|
Peng D, Fu M, Wang M, Wei Y and Wei X:
Targeting TGF-β signal transduction for fibrosis and cancer
therapy. Mol Cancer. 21:1042022. View Article : Google Scholar : PubMed/NCBI
|
|
38
|
Lin H, Ying Y, Wang YY, Wang G, Jiang SS,
Huang D, Luo L, Chen YG, Gerstenfeld LC and Luo Z: AMPK
downregulates ALK2 via increasing the interaction between Smurf1
and Smad6, leading to inhibition of osteogenic differentiation.
Biochim Biophys Acta Mol Cell Res. 1864:2369–2377. 2017. View Article : Google Scholar : PubMed/NCBI
|
|
39
|
Fijałkowski Ł, Skubiszewska M, Grześk G,
Koech FK and Nowaczyk A: Acetylsalicylic acid-primus inter pares in
pharmacology. Molecules. 27:84122022. View Article : Google Scholar : PubMed/NCBI
|
