Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
February 2012 Volume 3 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February 2012 Volume 3 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Single nucleotide polymorphisms in DNA repair genes and risk of cervical cancer: A case-control study

  • Authors:
    • Lihua Zhang
    • Zhenchao Ruan
    • Qingya Hong
    • Xiangzhen  Gong
    • Zhengguang Hu
    • Yan Huang
    • Aidi Xu
  • View Affiliations / Copyright

    Affiliations: Department of Radiation Oncology, Cancer Hospital, Fudan University, Shanghai 200032, P.R. China, Institute of Genetics, School of Life Sciences, Fudan University, Shanghai 200433, P.R. China, Hospital of Obstetrics and Gynecology, Attached Fudan University, Shanghai 200011, P.R. China, Hongkou Maternal and Child Health Care Institute, Shanghai 200437, P.R. China, Shanghai Hongkou District Health Bureau, Shanghai 200086, P.R. China
  • Pages: 351-362
    |
    Published online on: October 26, 2011
       https://doi.org/10.3892/ol.2011.463
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

In this report, we describe a case control study in a Chinese population aimed at identifying possible associations between susceptibility to cervical cancer and single nucleotide polymorphisms in XRCC1 194C>T, XRCC1 280G>A, XRCC1 399G>A, ERCC2 751A>C , ERCC2 156C>A, ERCC1 118C>T, PARP1 762T>C , RAD51 135G>C and HER2 655A>G. The cases comprised 154 patients: 80 cervical squamous cell carcinomas (SCCs), 2 adenocarcinomas and 72 cervical intraepithelial neoplasias (CINs). A total of 177 healthy women were recruited as the controls. A significant association was found between ERCC1 118C>T and SCC in the additive genetic model [odds ratio (OR)=1.711; 95% confidence interval (CI), 1.089-2.880; p=0.021] and the dominant genetic model (OR=1.947; 95% CI, 1.056-3.590; p=0.033). Among women with a smoking family member, ERCC1 118C>T increased SCC risk in the additive model (OR=2.800; 95% CI, 1.314‑5.968; p=0.008). For women who had first intercourse before 22 years of age, XRCC1 280G>A was found to act as a protective factor for SCC under the additive model (OR=0.228; 95% CI, 0.058‑0.900; p=0.035), while RAD51 135G>C was a risk factor for CIN (OR=4.246; 95% CI, 1.335-13.502; p=0.014). For women who had first intercourse after 22 years of age, the additive genetic model showed RAD51 135G>C (OR=0.359; 95% CI, 0.138-0.934; p=0.036) and HER2 655A>G (OR=0.309; 95% CI, 0.098-0.972; p=0.045) to be protective factors for SCC. XRCC1 399G>A increased CIN risk among women who first gave birth before the age of 22 in the additive genetic model (OR=4.459; 95% CI, 1.139‑17.453; p=0.032). For those who first gave birth after age 22, ERCC1 118C>T was found to be a risk factor for SCC in the additive genetic model (OR=1.884; 95% CI, 1.088-3.264; p=0.024). A significant interaction was observed between RAD51 135G>C and age at first intercourse (pinteraction=0.033 for SCC, pinteraction=0.021 for CIN), as well with sexual partner number (pinteraction=0.001 for SCC). The interaction between HER2 655A>G and age at first intercourse, ERCC2 156C>A and family smoking status and XRCC1 280G>A and alcohol consumption were significant, with pinteraction=0.023 for SCC, pinteraction=0.021 for CIN and pinteraction=0.025 for SCC, respectively.

Introduction

Cervical cancer ranks as the second most common female-related cancer worldwide, following breast cancer. Squamous cell carcinoma (SCC), adenocarcinoma (ADC), and adenosquamous cell carcinoma (ADSC) are the three most common histological subtypes of cervical cancer. Screening programs in developed countries have reduced the incidence and prevalence of cervical cancer in these areas, but developing countries often do not have the resources for these programs (1). The result is that 80% of cervical cancer cases now occur in developing countries (2).

In China, incidence rates of cervical cancer range from 2.4 to 4.6 per 100,000 women (3), and the mortality rates range from 2 to 4 per 100,000 women in urban areas. Various evidence has shown that certain types of the oncogenic virus human papillomavirus (HPV) are closely related to the occurrence of cervical cancer (4) and its precursor lesion cervical intraepithelial neoplasia (CIN) (5). However, only a small portion of women go on to develop cervical cancer following infection with HPV (6), and this suggests that other factors, including genetic susceptibility, may also contribute to cervical cancer.

An association between smoking and cervical cancer has been reported (7), as well as smoking-related DNA damage in the cervical epithelium (8). Defects in DNA repair pathways relate to a number of diseases including cancer, and the significance of DNA repair mechanisms in genetic stability maintenance is well accepted in the protection against cancer initiation (9).

There are a number of different types of DNA repair pathways; for single-strand breaks, these include the base excision repair (BER) and nucleotide excision repair (NER) systems and for double-strand DNA breaks, there are two principle mechanisms: homologous recombination (HR) and non-homologous end joining (NHEJ) (10). There are a number of genes known to be involved in these pathways. For example, it is known that the genes, ERCC1 and ERCC2, code for proteins involved in the NER system, removing bulky lesions from DNA caused by things such as toxic chemicals or ultraviolet light (11,12). Two other genes, XRCC1 and PARP1, are crucial to BER systems, which repair DNA damage due to causes such as ionizing radiation. PARP1 is also known to signal damage to other repair mechanisms (12,13). RAD51 functions in the DNA repair of double-strand breaks by HR mechanisms (10). It is also notable that these genes have been implicated in response (or non-response) to certain types of chemotherapeutic drugs (14).

A single nucleotide polymorphism (SNP) is a single nucleotide change in a DNA sequence between two individuals. Knowledge of the genes involved in these DNA repair mechanisms is enlightening investigators and enabling the study of the association between SNPs in these genes and the likelihood of developing cancer (15).

The associations of SNPs in DNA repair genes and various types of cancer and tumors have been extensively described. However, the evidence is frequently confusing, with some SNPs increasing the risk of certain types of cancer, but decreasing the risk of others. For example, previous studies have reported that XRCC1 Arg194Trp C>T (TT) increases the risk of esophageal (16) and bile duct cancer (17), but decreases the risk of gastric carcinoma (18). XRCC1 Arg280His G>A has been reported as a risk factor for breast cancer (19) and as a protective factor for bile duct cancer (17). Niwa et al (20) first reported that the XRCC1 Arg399Gln G>A polymorphism is related to the increased susceptibility to cervical cancer in a Japanese population.

We performed a case-control study, in a Chinese population, of eight SNPs from the DNA repair-related genes, ERCC1, ERCC2, XRCC1, PRAP1 and RAD51, as well as one SNP in HER2, which plays essential roles in stabilizing the active protein dimer.

Materials and methods

Study subjects

All subjects were genetically unrelated ethnic Han Chinese from Shanghai in eastern China. Patients diagnosed with histopathologically confirmed cervical cancer or CIN were consecutively recruited between June 2006 and May 2008 at the Margaret Willianson Hospital, Hongkou Maternal and Child Care Service Centre, and the Gynecology Department of Jiangwan Hospital, without restrictions on age and histology. The exclusion criteria included self-reported cancer history, previous radiotherapy and chemotherapy for unknown disease conditions and a family history of cancer. The controls were recruited during the same period from health examinees at the Hongkou Maternal and Child Care Service Centre. The controls were healthy women whose sexual history and age matched the cases, and who were histologically or cytologically diagnosed as having a normal cervix or chronic cervicitis, with no personal or familial history of cancer or other family genetic diseases.

Questionnaire

All patients underwent a complete medical history interview at entry. Detailed information regarding demographic factors (including age at diagnosis, education level, number of sexual partners, age at first intercourse and age at first childbirth), occupational history, environmental exposure data (including tobacco smoking status, alcohol consumption and family smoking status) and family history of cancer were also included. Those who had smoked less than one cigarette per day for a period of one year or less were defined as non-smokers, and the rest were considered to have always smoked. Alcohol consumption was defined as ‘no’ if the participant drank alcohol less than once per week, but otherwise was regarded as ‘yes’. Family smoking status was ‘no’ for participants who had no family member who smoked in the home, but was otherwise regarded as ‘yes’. Family history of cancer was defined as any self-reported cancer in first-degree relatives. Following the interview, approximately 2 ml of venous blood was collected from each participant and maintained below −40˚C.

Laboratory methods

Genetic DNA was extracted from peripheral blood by the standard phenol-chloroform procedure. SNP genotyping was conducted with the SNPware 12plex assay using the SNPstream™ system (Beckman Coulter, Inc., Brea, CA, USA). The amplifying and extension primers are shown in Table I. The nine SNPs were: XRCC1 194C>T (rs1799782), XRCC1 280G>A (rs25489), XRCC1 399G>A (rs25487), ERCC2 751A>C (rs13181), ERCC2 156C>A (rs238406), ERCC1 118C>T (rs11615), PARP1 762T>C (rs1136410), RAD51 135G>C (rs1801320) and HER2 655A>G (rs1801200).

Table I

Primers for single nucleotide polymorphism detection.

Table I

Primers for single nucleotide polymorphism detection.

rs1136410
 5′ primer TGAGCAGACTGTAGGCCAC
 3′ primer TCTGTCTCATTCACYATGATACCTA
 Ext primer CGACTGTAGGTGCGTAACTCGTCC
AGCAGGTTGTCAAGCATTTCC
rs1801200
 5′ primer AAACTAGCCCTCAATCCCTG
 3′ primer AAAGACCACCCCCAAGAC
 Ext primer AGAGCGAGTGACGCATACTACGCCCCC
AGCCCTCTGACGTCCRTC
rs1799782
 5′ primer TYAGGACCCAYGTTGTCC
 3′ primer ATGAGAGCGCCAACTCTCT
 Ext primer AGATAGAGTCGATGCCAGCTTCACCTG
GRGATGTCTTGTTGATCC
rs11615
 5′ primer TTCGTCCCTCCCCAGAGG
 3′ primer ATGAGAGCGCCAACTCTCT
 Ext.primer GTGATTCTGTACGTGTCGCCTTACGTC
GCCAAATTCCCAGGGCAC
rs13181
 5′ primer CTGTCCCTGCTCAGCCTG
 3′ primer AAGACTCAGGAGTCACCAGGA
 Ext primer AGGGTCTCTACGCTGACGATGCTAGAA
TCAGAGGAGACGCTG
rs25489
 5′ primer TTGACCCCCAGTGGTGCTA
 3′ primer TGTCACTGCCCCCTGTGC
 Ext primer GGCTATGATTCGCAATGCTTTCTTCTC
CAGTGCCAGCTCCAACTC
rs1801320
 5′ primer AACTGCAACTCATCTGGGTT
 3′ primer TCCTCTCTCCAGCAGGCC
 Ext primer GCGGTAGGTTCCCGACATATGAGTAGA
GAAGTGGAGCGTAAGCCA
rs25487
 5′ primer TAAGGAGTGGGTGCTGGA
 3′ primer ATTGCCCAGCACAGGATA
 Ext primer AGCGATCTGCGAGACCGTATCGCATGC
GTCGGCGGCTGCCCTCCC
rs238406
 5′ primer TATGTGCGGGCGCAGTAC
 3′ primer TCCTGCCTCCCTCCCTCA
 Ext primer CGTGCCGCTCGTGATAGAATATGACAC
CAGCCTGCCCCACTGCCG

[i] Ext, extension.

Genotyping was performed according to the manufacturer's instructions. Briefly, multiple polymerase chain reaction (PCR) was performed with the following program: 94˚C for 1 min, then 94˚C for 30 sec, 55˚C for 30 sec and 72˚C for 1 min, for 39 cycles. The PCR product was used for SNP extension: 96˚C for 3 min, then 94˚C for 20 sec and 40˚C for 11 sec, for 45 cycles. A chip hybridization reaction was conducted at 42˚C for 2 h with hybridization solution and hybridization additive solution at the proportion of 18:1. Chip data were scanned and analyzed using the SNPstream machine (Beckman Coulter, Inc.).

Statistical analysis

To examine the Hardy-Weinberg equilibrium, a χ2 goodness-of-fit test was performed using a web-based program (http://ihg2.helmholtz-muenchen.de/cgi-bin/hw/hwa1.pl). The frequency distribution of education, smoking status, alcohol consumption, family smoking status, number of sexual partners, age at first intercourse and age at first childbirth was compared between the controls and CIN/SCC cases using Fisher's exact χ2-test. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated by univariate logistic regression analyses and multivariate logistic regression analyses adjusted for age, family smoking status, age at first intercourse and age at first childbirth under the dominant genetic, recessive genetic and additive model. The subjects were stratified according to family smoking status, age at first intercourse, age at first childbirth and disease subtypes, in order to estimate specific ORs and CIs.

Interaction between the nine SNPs and demographic factors (family smoking status, age at first intercourse, age at first childbirth, sexual partner number and alcohol consumption) were estimated. All the regression analyses were performed using SPSS 16.0 software (SPSS Inc., Chicago, IL, USA). Quanto (version 1.2.4) software was used to calculate the statistical power. All p-values were two-sided, and p<0.05 was considered to be statistically significant.

Results

Characteristics of the study population

A total of 154 patients (82 carcinomas and 72 CINs) and 177 cancer-free controls were enrolled in the study. Among all carcinomas, two patients were diagnosed with ADC and the rest were diagnosed with SCC. Thus, our study focused on SCC and CIN. The characteristics of the study participants are shown in Table II. There was no significant difference in age between controls and patients with CIN/SCC. Similarly, education level, smoking status, alcohol consumption and the number of sexual partners were not significantly associated with CIN or SCC risk. However, significant differences between the cases and controls were found in family smoking status, age at first intercourse and age at first childbirth. These factors have previously been reported as risk factors for HPV infection, or co-factors for cervical cancer (3).

Table II

Distributions of demographic characters in the study population.

Table II

Distributions of demographic characters in the study population.

ControlsCINSCC


Variable(n=177) no. (%)(n=72) no. (%)p-valueb(n=80) no. (%)p-valueb
Age43 (24–55)a40 (24–59)a44 (26–79)a
Education level
 ≤ Junior high school64 (36.2)28 (38.9)0.77229 (36.2)1.000
 ≥ Senior high school113 (63.8)44 (61.1)51 (63.8)
Smoking status
 No167 (94.4)72 (100)0.06776 (95.0)1.000
 Yes10 (5.6)04 (5.0)
Alcohol consumption
 No148 (83.6)63 (87.5)0.56173 (91.2)0.122
 Yes29 (16.4)9 (12.5)7 (8.8)
Family smoking status
 No61 (34.5)47 (65.3)046 (57.5)0.001
 Yes116 (65.5)25 (34.7)34 (42.5)
Number of sexual partners
 ≤1144 (81.4)50 (73.5)0.21862 (81.6)1.000
 >133 (18.6)18 (26.5)14 (18.4)
Age at first intercourse
 ≤2237 (20.9)28 (41.8)0.00238 (51.4)0
 >22140 (79.1)39 (58.2)36 (48.6)
Age at first childbirth
 ≤2224 (13.6)13 (19.4)0.31719 (25.0)0.030
 >22153 (86.4)54 (80.6)57 (75.0)

a Mean (minimum–maximum).

b Fisher's exact test.

{ label (or @symbol) needed for fn[@id='tfn4-ol-03-02-0351'] } CIN, cervical intraepithelial neoplasia; SCC, squamous cell carcinoma.

Association between SNPs and risk of cervical SCC and CIN

The genotype distributions of controls were in Hardy-Weinberg equilibrium (data not shown). No SNP was found to be associated with the risk of SCC or CIN in all the subjects in the univariate logistic regression analyses (data not shown). Table III shows the adjusted association of the nine SNPs in the two case groups. In the dominant genetic model, a significantly increased risk of SCC was observed in ERCC1 118C>T (OR=1.947; 95% CI, 1.056–3.590; p=0.033) when adjusted for age, family smoking status, age at first intercourse and age at first childbirth. The effect was more clear when the additive model was applied (OR=1.771; 95% CI, 1.089–2.880; p=0.021).

Table III

Analysis of the association between the polymorphisms and risk of SCC/CIN with multivariate logistic regression analysis.

Table III

Analysis of the association between the polymorphisms and risk of SCC/CIN with multivariate logistic regression analysis.

Control, n (%)CIN, n (%)AORaPaSCC, n (%)AORaPa
XRCC1
 rs1799782CC87 (49.2)32 (44.4)1.00041 (51.2)1.000
CT71 (40.1)33 (45.8)1.293 (0.717–2.329)0.39331 (38.8)0.932 (0.531–1.635)0.805
TT19 (10.7)7 (9.7)0.950 (0.360–2.510)0.9188 (10.0)0.904 (0.365–2.239)0.827
Additive1.076 (0.711–1.628)0.7300.944 (0.634–1.404)0.775
 rs25489GG142 (80.2)61 (85.9)1.00068 (85.0)1.000
GA34 (19.2)10 (14.1)0.628 (0.288–1.373)0.24411 (13.8)0.680 (0.325–1.426)0.308
AA1 (0.6)0--1 (1.2)2.022 (0.124–32.955)0.621
Additive0.613 (0.284–1.323)0.2130.781 (0.400–1.525)0.470
 rs25487GG109 (61.9)38 (52.8)1.00043 (53.8)1.000
GA58 (32.8)28 (38.9)1.371 (0.758–2.481)0.29631 (38.8)1.362 (0.776–2.388)0.281
AA10 (5.6)6 (8.3)1.668 (0.561–4.961)0.3586 (7.5)1.526 (0.522–4.461)0.440
Additive1.326 (0.853–2.062)0.2101.293 (0.846–1.976)0.236
ERCC1
 rs11615CC105 (60.0)45 (62.5)1.00039 (48.8)1.000
CT61 (34.9)22 (30.6)0.870 (0.473–1.600)0.65434 (42.5)1.501 (0.859–2.623)0.153
TT9 (5.1)5 (6.9)1.460 (0.450–4.735)0.5297 (8.8)2.058 (0.714–5.932)0.181
Additive1.026 (0.642–1.638)0.9161.465 (0.958–2.241)0.078
ERCC2
 rs13181AA148 (84.1)57 (79.2)1.00068 (85.0)1.000
CA27 (15.3)15 (20.8)1.452 (0.712–2.958)0.30512 (15.0)0.967 (0.462–2.024)0.929
CC1 (0.6)0--0--
Additive1.359 (0.683–2.704)0.3830.896 (0.440–1.826)0.762
 rs238406CC55 (31.6)22 (30.6)1.00029 (36.2)1.000
CA83 (47.7)35 (48.6)1.042 (0.547–1.983)0.90036 (45.0)0.823 (0.453–1.493)0.521
AA36 (20.7)15 (20.8)1.014 (0.459–2.237)0.97315 (18.8)0.799 (0.376–1.697)0.559
Additive1.010 (0.683–1.493)0.9600.883 (0.609–1.281)0.514
PARP1
 rs1136410TT54 (30.7)28 (39.4)1.00025 (31.2)1.000
CT83 (47.2)28 (39.4)0.581 (0.305–1.107)0.09939 (48.8)1.017 (0.553–1.868)0.958
CC39 (22.2)15 (21.1)0.775 (0.361–1.664)0.51316 (20.0)0.883 (0.417–1.871)0.745
Additive0.836 (0.566–1.234)0.3670.947 (0.655–1.370)0.772
RAD51
 rs1801320GG122 (69.7)46 (64.8)1.00058 (72.5)1.000
CG50 (28.6)24 (33.8)1.316 (0.718–2.414)0.37420 (25.0)0.846 (0.461–1.550)0.587
CC3 (1.7))1 (1.4)0.782 (0.078–7.871)0.8352 (2.5)1.420 (0.231–8.738)0.705
Additive1.207 (0.699–2.083)0.4990.929 (0.546–1.578)0.784
HER2
 rs1801200AA131 (74.0)52 (72.2)1.00062 (77.5)1.000
GA44 (24.9)20 (27.8)1.147 (0.611–2.152)0.67016 (20.0)0.766 (0.401–1.463)0.419
GG2 (1.1)0--2 (2.5)2.141 (0.294–15.581)0.452
Additive1.029 (0.565–1.876)0.9250.908 (0.517–1.596)0.738

a Adjusted for age - sample number equals to zero.

{ label (or @symbol) needed for fn[@id='tfn6-ol-03-02-0351'] } n, number; P, p-value; AOR, adjusted odds ratio.

The statistical powers of the dominant, recessive and additive model were evaluated for each SNP, and the additive model was found to have the highest statistical power in the study (data not shown). Thus, an additive model was used for all the following association analyses.

Association analysis following stratification

Significant distribution differences between the controls and cases were found in family smoking status, age at first intercourse and age at first childbirth (Table II). Thus, stratification was performed by these three factors. Table IV shows the association using multivariate logistic regression analysis, stratified by family smoking status. Using the additive model where the family member smoking status was ‘yes’, the SNP ERCC1 118C>T had an increased risk of SCC (OR=2.800; 95% CI, 1.314–5.968; p=0.008). Meanwhile, ERCC2 156C>A tended to act as a risk factor for CIN under the additive model (OR=1.949; 95% CI, 0.951–3.944; p=0.068) if the family member smoking status was ‘yes’. However, ERCC2 156C>A tended to be a protective factor for CIN under the additive model (OR=0.616; 95% CI, 0.347–1.095; p=0.099) if the family member smoking status was ‘no’. The different effects of the ERCC2 156C>A polymorphism between CIN and SCC suggest that its function may depend on exposure to tobacco smoke.

Table IV

Analysis of the association between the polymorphisms and risk of SCC/CIN stratified by family smoking status.

Table IV

Analysis of the association between the polymorphisms and risk of SCC/CIN stratified by family smoking status.

NoYes


CINSCCCINSCC




AORaPaAORaPaAORaPaAORaPa
XRCC1
 rs1799782CC1.0001.0001.0001.000
CT1.297 (0.561–2.997)0.5430.955 (0.418–2.184)0.9131.472 (0.579–3.745)0.4170.931 (0.405–2.138)0.866
TT0.645 (0.190–2.196)0.4830.360 (0.088–1.466)0.1541.156 (0.210–6.375)0.8681.928 (0.559–6.646)0.299
Additive0.915 (0.531–1.579)0.7510.710 (0.400–1.260)0.2411.222 (0.614–2.433)0.5691.223 (0.685–2.183)0.496
 rs25489GG1.0001.0001.0001.000
GA1.017 (0.323–3.207)0.9771.071 (0.340–3.371)0.9070.516 (0.166–1.716)0.2810.578 (0.202–1.654)0.307
AA--2.263e91.000----
Additive1.017 (0.323–3.207)0.9771.398 (0.512–3.819)0.5130.508 (0.155–1.667)0.2640.558 (0.199–1.564)0.267
 rs25487GG1.0001.0001.0001.000
GA1.579 (0.669–3.728)0.2982.463 (1.052–5.766)0.0381.515 (0.604–3.799)0.3760.783 (0.334–1.834)0.573
AA1.167 (0.316–4.303)0.8170.960 (0.214–4.305)0.9571.769 (0.172–18.239)0.6322.718 (0.554–13.348)0.218
Additive1.222 (0.689–2.167)0.4931.419 (0.777–2.592)0.2551.443 (0.666–3.127)0.3521.134 (0.591–2.177)0.705
ERCC1
 rs11615CC1.0001.0001.0001.000
CT0.718 (0.305–1.687)0.4471.281 (0.564–2.907)0.5541.215 (0.470–3.143)0.6882.088 (0.910–4.788)0.082
TT1.343 (0.302–5.978)0.6981.009 (0.206–4.947)0.9920.954 (0.094–9.655)0.9684.913 (1.116–21.634)0.035
Additive0.945 (0.511–1.748)0.8571.128 (0.605–2.101)0.7051.111 (0.514–2.404)0.7882.161 (1.152–4.054)0.016
ERCC2
 rs13181AA1.0001.0001.0001.000
CA1.500 (0.549–4.101)0.4290.569 (0.163–1.991)0.3781.494 (0.480–4.649)0.4881.730 (0.669–4.472)0.258
CC--------
Additive1.500 (0.549–4.101)0.4290.550 (0.158–1.913)0.5501.394 (0.466–4.169)0.5521.536 (0.623–3.785)0.351
 rs238406CC1.0001.0001.0001.000
CA0.550 (0.220–1.376)0.2010.695 (0.281–1.723)0.4322.423 (0.758–7.745)0.1350.800 (0.333–1.926)0.619
AA0.360 (0.116–1.114)0.0760.423 (0.133–1.347)0.1453.461 (0.913–13.115)0.0681.298 (0.459–3.671)0.623
Additive0.595 (0.339–1.046)0.0710.655 (0.370–1.159)0.1461.843 (0.970–3.500)0.0621.093 (0.642–1.859)0.744
PARP1
 rs1136410TT1.0001.0001.0001.000
CT0.431 (0.179–1.041)0.0620.786 (0.325–1.901)0.5930.948 (0.326–2.757)0.9231.157 (0.473–0.833)0.749
CC0.971 (0.313–3.007)0.9591.394 (0.448–4.331)0.5661.028 (0.301–3.510)0.9640.709 (0.229–2.192)0.550
Additive0.844 (0.486–1.466)0.5471.115 (0.638–1.950)0.7021.012 (0.545–1.877)0.9710.869 (0.510–1.482)0.607
RAD51
 rs1801320GG1.0001.0001.0001.000
CG1.233 (0.551–2.760)0.6110.819 (0.349–1.921)0.6460.853 (0.283–2.573)0.7780.770 (0.301–1.969)0.585
CC--2.729 (0.234–31.843)0.4231.875 (0.152–23.055)0.624--
Additive1.085 (0.504–2.335)0.8351.026 (0.496–2.119)0.9461.027 (0.424–2.490)0.9530.689 (0.284–1.671)0.410
HER2
 rs1801200AA1.0001.0001.0001.000
GA0.970 (0.422–2.228)0.9430.544 (0.218–1.359)0.1920.974 (0.320–2.967)0.9631.041 (0.400–2.710)0.935
GG------3.583 (0.471–27.226)0.217
Additive0.970 (0.422–2.228)0.9430.544 (0.218–1.359)0.1920.823 (0.294–2.305)0.7121.359 (0.654–2.824)0.412

a Adjusted for age - sample number equals to zero.

{ label (or @symbol) needed for fn[@id='tfn8-ol-03-02-0351'] } n, number; P, p-value; AOR, adjusted odds ratio. Bold numbers indicate statistical significance.

Among women having their first intercourse after the age of 22, there was no significant association for CIN using multivariate logistic regression analysis (Table V). However, the additive model showed that RAD51 135G>C (OR=0.359; 95% CI, 0.138–0.934; p=0.036) and HER2 655A>G (OR=0.309; 95% CI, 0.098–0.972; p=0.045) may be protective factors for SCC. In the subgroup who had their first intercourse before age 22, XRCC1 280G>A showed a protective effect for SCC (OR=0.228; 95% CI, 0.058–0.900; p=0.035) under the additive model. Meanwhile, RAD51 135G>C was related to increased susceptibility to CIN under the additive model (OR=4.246; 95% CI, 1.335–13.502; p=0.014).

Table V

Analysis of the association between the polymorphisms and risk of SCC/CIN stratified by age at first intercourse.

Table V

Analysis of the association between the polymorphisms and risk of SCC/CIN stratified by age at first intercourse.

≤22>22


CINSCCCINSCC




AORaPaAORaPaAORaPaAORaPa
XRCC1
 rs1799782CC1.0001.0001.0001.000
CT2.040 (0.711–5.852)0.1851.131 (0.382–3.349)0.8250.991 (0.463–2.121)0.9820.996 (0.468–2.121)0.992
TT3.122 (0.438–22.263)0.2565.071 (0.795–32.331)0.0860.786 (0.232–2.658)0.6990.197 (0.024–1.591)0.127
Additive1.888 (0.850–4.194)0.1191.743 (0.824–3.690)0.1460.920 (0.540–1.568)0.7600.700 (0.390–1.258)0.233
 rs25489GG1.0001.0001.0001.000
GA0.284 (0.071–1.142)0.0760.242 (0.063–0.930)0.0391.068 (0.414–2.757)0.8920.991 (0.367–2.677)0.986
AA------4.508 (0.270–75.395)0.295
Additive0.284 (0.071–1.142)0.0760.242 (0.063–0.930)0.0391.002 (0.401–2.501)0.9971.239 (0.537–2.861)0.615
 rs25487GG1.0001.0001.0001.000
GA1.945 (0.681–5.559)0.2140.975 (0.352–2.701)0.9611.052 (0.483–2.296)0.8981.737 (0.799–3.779)0.164
AA6.132 (0.524–71.825)0.1490.775 (0.044–13.594)0.8621.053 (0.258–4.301)0.9421.601 (0.389–6.597)0.514
Additive2.151 (0.901–5.133)0.0840.944 (0.392–2.276)0.8991.038 (0.586–1.837)0.8991.442 (0.817–2.547)0.207
ERCC1
 rs11615CC1.0001.0001.0001.000
CT1.258 (0.411–3.851)0.6881.685 (0.599–4.736)0.3230.653 (0.294–1.450)0.2951.341 (0.611–2.942)0.464
TT4.608 (0.432–49.149)0.2062.476 (0.216–28.394)0.4660.814 (0.159–4.183)0.8062.478 (0.663–9.267)0.178
Additive1.643 (0.704–3.833)0.2511.640 (0.692–3.885)0.2610.755 (0.400–1.423)0.3841.478 (0.834–2.620)0.181
ERCC2
 rs13181AA1.0001.0001.0001.000
CA2.066 (0.623–6.857)0.2361.082 (0.297–3.948)0.9051.252 (0.484–3.237)0.6430.917 (0.319–2.636)0.872
CC--------
Additive2.066 (0.623–6.857)0.2361.082 (0.297–3.948)0.9051.156 (0.464–2.877)0.7560.855 (0.309–2.365)0.762
 rs238406CC1.0001.0001.0001.000
CA0.749 (0.241–2.324)0.6170.511 (0.164–1.590)0.2471.049 (0.458–2.403)0.9091.061 (0.466–2.415)0.888
AA1.404 (0.354–5.565)0.6291.494 (0.388–5.758)0.5600.908 (0.327–2.521)0.8520.596 (0.189–1.876)0.377
Additive1.125 (0.569–2.224)0.7351.112 (0.578–2.141)0.7510.961 (0.583–1.585)0.8770.819 (0.485–1.383)0.455
PARP1
 rs1136410TT1.0001.0001.0001.000
CT0.585 (0.188–1.820)0.3550.493 (0.162–1.503)0.2140.552 (0.235–1.294)0.1721.202 (0.504–2.862)0.678
CC0.573 (0.140–2.347)0.4390.661 (0.176–2.481)0.5391.019 (0.399–2.601)0.9691.150 (0.406–3.257)0.792
Additive0.733 (0.363–1.478)0.3850.773 (0.401–1.490)0.4430.956 (0.583–1.566)0.8571.080 (0.648–1.799)0.768
RAD51
 rs1801320GG1.0001.0001.0001.000
CG3.241 (1.050–10.005)0.0411.915 (0.603–6.082)0.2700.877 (0.393–1.955)0.7480.592 (0.248–1.416)0.239
CC3.408e9NA1.696e9NA----
Additive3.524 (1.208–10.286)0.0212.347 (0.836–6.589)0.1050.764 (0.362–1.614)0.4810.540 (0.235–1.237)0.145
HER2
 rs1801200AA1.0001.0001.0001.000
GA1.724 (0.538–5.523)0.3591.687 (0.529–5.375)0.3771.194 (0.544–2.623)0.6580.344 (0.114–1.042)0.059

a Adjusted for age - sample number equals to zero.

{ label (or @symbol) needed for fn[@id='tfn10-ol-03-02-0351'] } n, number; P, p-value; AOR, adjusted odds ratio. Bold numbers indicate statistical significance.

Using the additive model, XRCC1 399G>A increased susceptibility to CIN in the subgroup who first gave birth before age 22 (OR=4.459; 95% CI, 1.139–17.453; p=0.032), and ERCC1 118C>T was found to be a risk factor for SCC (OR=1.884; 95% CI, 1.088–3.264; p=0.024) among those who first gave birth after age 22.

Interaction between SNPs and demographic factors

RAD51 135G>C decreased the CIN risk in combination with first intercourse at a later age (OR=0.217; 95% CI, 0.059–0.798; p=0.021), and increased CIN risk in combination with a greater number of sexual partners (OR=12.260; 95% CI, 2.874–52.305; p=0.001). ERCC2 156C>A increased the CIN risk in combination with family smoking status (OR=2.639; 95% CI, 1.157–6.020; p=0.021).

HER2 655A>G and RAD51 135G>C decreased the SCC risk when combined with first intercourse at a later age (OR=0.179; 95% CI, 0.041–0.790; p=0.023; and OR=0.250; 95% CI, 0.070–0.893; p=0.033; respectively). When combined with alcohol consumption, XRCC1 280G>A increased the SCC risk (OR=7.117; 95% CI, 1.274–39.754; p=0.025).

Discussion

DNA repair genes have been frequently studied as significant determinants of cancer risk. Associations between SNPs in these genes and various types of cancer have been well documented but the picture remains complex, with often inconsistent data pointing to both increased and decreased risks (16–19). An association between the SNP XRCC1 Arg399Gln G>A and an increased susceptibility to cervical cancer has been shown in the Japanese population (20), in contrast to a decreased risk, but an increased persistence of HPV infection, in a population in Costa Rica (21). These data have been partially confirmed in this study where we observed an association between XRCC1 Arg399Gln G>A and an increased CIN risk among women who first gave birth before the age of 22. However, other changes in XRCC1, such as XRCC1 Arg194Trp C>T showed no significant association with CIN/SCC, and among women who had their first intercourse before 22 years of age, there was a significant association between XRCC1 Arg280His G>A and a decreased susceptibility to SCC. Although no previous study has reported an association between alcohol consumption and cervical cancer, we observed an interaction between XRCC1 280G>A and alcohol consumption (pinteraction<0.05), which may suggest that alcohol is involved in the development of cervical cancer.

The enzyme PARP1 (encoded by the gene of the same name) plays a role in repairing single-stranded DNA breaks. The PARP1 Val762Ala T>C polymorphism located in the catalytic domain has been shown to interact with XRCC1. In vitro, this polymorphism markedly reduces the enzymatic activity of PARP1, and has also been linked to cancer susceptibility (22). An increased risk of smoking-related lung cancer has also been reported (23). There are no previous reports evaluating the correlation of PARP1 Val762Ala T>C with cervical cancer as yet. Our analysis showed no significant association between the polymorphism and CIN/SCC risk.

The proteins, ERCC1 and ERCC2. are two of 16 proteins involved in NER systems, where they help to excise lesions from the DNA strand (11,24). The proteins are encoded by the genes ERCC1 and ERCC2, respectively. In ERCC1, a polymorphism at ERCC1 118C>T has been shown to decrease the rate of mRNA translation to the protein (25). It is possible that a decreased level of ERCC1 mRNA expression influences the repair efficiency of DNA damage, which then contributes to cancer susceptibility. Studies have also shown an association between the polymorphism and malignancies such as lung, ovarian and colorectal cancer (26–29), although no previous association with cervical cancer has been shown. Our study showed that ERCC1 118C>T may be a potential risk factor for SCC. Among the Chinese population, a homozygous CC polymorphism in ERCC2 at position 751A>C is related to a decreased DNA repair capacity in patients with lung cancer (30). In addition, there are data linking an ERCC2 polymorphism and glioblastoma (31). Our data indicate that ERCC2 751A>C and ERCC2 156C>A have no significant association in CIN/SCC. Furthermore, among women who first gave birth after 22 years of age, ERCC1 118C>T may be a risk factor for SCC.

The association between cervical cancer and smoking (and second-hand smoke) has already been established (7,32). The hypothesis is that the carcinogens in smoke initiate DNA damage, and then activate the DNA repair process; with polymorphisms in the DNA repair genes either increasing or decreasing the risk of cancer in the areas affected. In the case of cervical cancer, it is thought that smoke may have a directly carcinogenic effect by acting through the polycyclic aromatic hydrocarbon-DNA adduct in the cervix (33). When we looked at associations between family smoking status and SNPs, we found that ERCC1 118C>T, a potential risk factor for SCC, became more significantly associated with this outcome in women who live with family members who smoke. Although not statistically significant, ERCC2 156C>A tended to be a risk factor among patients who have smoking family members, but tended to play a protective role in women whose families did not smoke. Tsai et al (32) previously showed that non-smoking women exposed to second-hand cigarette smoke had a significantly greater risk of developing CIN than unexposed non-smokers. Our data indicate that ERCC2 156C>A may play a role in the association between second-hand smoke and CIN.

The gene RAD51 plays a significant role in DNA repair of double-strand breaks via HR (34). Previous studies, although not looking at functional evidence, have shown that the polymorphism RAD51 135G>C is related to breast cancer susceptibility (35). No RAD51 polymorphisms related to cervical cancer have been reported as yet. In this study, we observed that RAD51 135G>C may increase the risk of CIN in women who first had intercourse before the age of 22, but may be a protective factor for SCC in women who first had intercourse after the age of 22. Studies examining SNPs in HER2 have mostly focused on HER2 655A>G in breast cancer (36), and no previous association has been shown in cervical cancer. In our analysis, HER2 655A>G showed a decreased susceptibility to SCC in women who had first intercourse after the age of 22.

The interaction analysis in our study shows a consistent result with epidemiological data of cervical cancer. Women who have multiple sexual partners or a younger age at first sexual intercourse had a significantly higher risk of HPV infection (3) as well as an increased risk of cervical cancer (37). While our study indicates that polymorphisms in HER2 655A>G and RAD51 135G>C and the age of first intercourse are related, it is worth noting that the age we used as a cut-off (22 years) is an arbitrary age that is open to some debate. There is evidence that in certain countries as many as 50% of women have their first intercourse between the ages of 13 and 19 years (37). Altering the age cut-off in our interaction analyses may affect the outcome and correlations between cervical cancer and the selected SNPs, and these analyses will need to be performed before any more firm conclusions can be drawn.

It is also worth noting that the sample size of our study was relatively small, which limits the statistical power, and, hence, the conclusions that may be drawn. Other studies examining associations in other types of cancer, such as lung or breast cancer have recruited larger numbers of patients, and this larger number of data points has enhanced the robustness of the findings. Cervical cancer patients however, are fewer in number compared with other types of cancer, and therefore we were limited as to the number of patients we could recruit to our study. Our study of 154 patients (82 carcinomas and 72 CINs) compares favorably with other recently published case-control studies in the same geographical area (38–40), but clearly there is a need for further research with larger sample sizes across diverse populations.

In addition, the data presented in this study were gained using an additive genetic model. Although the additive and dominant models are often highly correlated, there is debate as regards which is the most appropriate, and there are also cases where these tests are not appropriate, particularly if testing traits that turn out to be recessive (41). Further exploration of different models is required, particularly if larger sample sizes are used.

In conclusion, this is the first association study between cervical cancer and SNPs in ERCC1, ERCC2, RAD51 and HER2. Interaction analysis suggests that sexual behavior, second-hand smoke and alcohol consumption are co-factors combined with SNPs, and further research is required to confirm these findings.

Acknowledgements

This study was supported by the Shanghai Municipal Health Bureau Program 2006108 and the Shanghai Hongkou District Health Bureau Program 0601-03.

References

1 

Kitchener HC, Castle PE and Cox JT: Achievements and limitations of cervical cytology screening. Vaccine. 24:63–70. 2006. View Article : Google Scholar : PubMed/NCBI

2 

Valdespino VM and Valdespino VE: Cervical cancer screening: State of the art. Curr Opin Obstet Gynecol. 18:35–40. 2006. View Article : Google Scholar : PubMed/NCBI

3 

Shi JF, Qiao YL, Smith JS, et al: Epidemiology and Prevention of Human Papillomavirus and Cervical Cancer in China and Mongolia. Vaccine. 26:M53–M59. 2008. View Article : Google Scholar : PubMed/NCBI

4 

Walboomers JMM, Jacobs MV, Manos MM, et al: Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol. 189:12–19. 1999. View Article : Google Scholar : PubMed/NCBI

5 

Hausen HZ: Viruses in Human Cancers. Science. 254:1167–1173. 1991. View Article : Google Scholar : PubMed/NCBI

6 

Giuliano AR, Harris R, Sedjo RL, et al: Incidence, prevalence, and clearance of type-specific human papillomavirus infections: The young women's health study. J Infect Dis. 186:462–469. 2002. View Article : Google Scholar : PubMed/NCBI

7 

Winkelstein W: Smoking and cervical cancer - current status: a review. Am J Epidemiol. 131:945–957. 1990.PubMed/NCBI

8 

Simons AM, Phillips DH and Coleman DV: Damage to DNA in cervical epithelium related to smoking tobacco. BMJ. 306:1444–1448. 1993. View Article : Google Scholar : PubMed/NCBI

9 

Maser RS and DePinho RA: Connecting chromosomes, crisis, and cancer. Science. 297:565–569. 2002. View Article : Google Scholar : PubMed/NCBI

10 

Jackson SP and Bartek J: The DNA-damage response in human biology and disease. Nature. 461:1071–1078. 2009. View Article : Google Scholar : PubMed/NCBI

11 

Mu D, Park CH, Matsunaga T, Hsu DS, Reardon JT and Sancar A: Reconstitution of human DNA-repair excision nuclease in a highly defined system. J Biol Chem. 270:2415–2418. 1995. View Article : Google Scholar : PubMed/NCBI

12 

Smith TR, Levine EA, Freimanis RI, et al: Polygenic model of DNA repair genetic polymorphisms in human breast cancer risk. Carcinogenesis. 29:2132–2138. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Schreiber V, Dantzer F, Ame JC and de Murcia G: Poly(ADP-ribose): novel functions for an old molecule. Nat Rev Mol Cell Biol. 7:517–528. 2006. View Article : Google Scholar : PubMed/NCBI

14 

Li SX, Sjolund A, Harris L and Sweasy JB: DNA repair and personalized breast cancer therapy. Environ Mol Mutagen. 51:897–908. 2010. View Article : Google Scholar : PubMed/NCBI

15 

Manuguerra M, Saletta F, Karagas MR, et al: XRCC3 and XPD/ERCC2 single nucleotide polymorphisms and the risk of cancer: A HuGE review. Am J Epidemiol. 164:297–302. 2006. View Article : Google Scholar : PubMed/NCBI

16 

Xing DY, Qi J, Miao XP, Lu WF, Tan W and Lin DX: Polymorphisms of DNA repair genes XRCC1 and XPD and their associations with risk of esophageal squamous cell carcinoma in a Chinese population. Int J Cancer. 100:600–605. 2002. View Article : Google Scholar : PubMed/NCBI

17 

Huang WY, Gao YT, Rashid A, et al: Selected base excision repair gene polymorphisms and susceptibility to biliary tract cancer and biliary stones: a population-based case-control study in China. Carcinogenesis. 29:100–105. 2008. View Article : Google Scholar : PubMed/NCBI

18 

Shen HB, Xu YC, Qian Y, et al: Polymorphisms of the DNA repair gene XRCC1 and risk of gastric cancer in a Chinese population. Int J Cancer. 88:601–606. 2000. View Article : Google Scholar : PubMed/NCBI

19 

Loizidou MA, Michael T, Neuhausen SL, et al: Genetic polymorphisms in the DNA repair genes XRCC1, XRCC2 and XRCC3 and risk of breast cancer in Cyprus. Breast Cancer Res Treat. 112:575–579. 2008. View Article : Google Scholar : PubMed/NCBI

20 

Niwa Y, Matsuo K, Ito H, et al: Association of XRCC1 Arg399Gln and OGG1 Ser326Cys polymorphisms with the risk of cervical cancer in Japanese subjects. Gynecol Oncol. 99:43–49. 2005. View Article : Google Scholar : PubMed/NCBI

21 

Wang SS, Bratti MC, Rodriguez AC, et al: Common variants in immune and DNA repair genes and risk for human papillomavirus persistence and progression to cervical cancer. J Infect Dis. 199:20–30. 2009. View Article : Google Scholar : PubMed/NCBI

22 

Wang XG, Wang ZQ, Tong WM and Shen Y: PARP1 Val762Ala polymorphism reduces enzymatic activity. Biochem Biophys Res Commun. 354:122–126. 2007. View Article : Google Scholar : PubMed/NCBI

23 

Zhang XM, Miao XP, Liang G, et al: Polymorphisms in DNA base excision repair genes ADPRT and XRCC1 and risk of lung cancer. Cancer Res. 65:722–726. 2005.PubMed/NCBI

24 

Mu D, Hsu DS and Sancar A: Reaction mechanism of human DNA repair excision nuclease. J Biol Chem. 271:8285–8294. 1996. View Article : Google Scholar : PubMed/NCBI

25 

Yu JJ, Mu CJ, Lee KB, et al: A nucleotide polymorphism in ERCC1 in human ovarian cancer cell lines and tumor tissues. Mutat Res. 382:13–20. 1997.PubMed/NCBI

26 

Kang S, Ju W, Kim JW, et al: Association between excision repair cross-complementation group 1 polymorphism and clinical outcome of platinum-based chemotherapy in patients with epithelial ovarian cancer. Exp Mol Med. 38:320–324. 2006. View Article : Google Scholar

27 

Park DJ, Zhang W, Stoehlmacher J, Tsao-Wei D, Groshen S, Gil J, Yun J, Sones E, Mallik N and Lenz HJ: ERCC1 gene polymorphism as a predictor for clinical outcome in advanced colorectal cancer patients treated with platinum-based chemotherapy. Clin Adv Hematol Oncol. 1:162–166. 2003.PubMed/NCBI

28 

Suk R, Gurubhagavatula S, Park S, et al: Polymorphisms in ERCC1 and grade 3 or 4 toxicity in non-small cell lung cancer patients. Clin Cancer Res. 11:1534–1538. 2005. View Article : Google Scholar : PubMed/NCBI

29 

Zhou W, Liu G, Park S, et al: Gene-smoking interaction associations for the ERCC1 polymorphisms in the risk of lung cancer. Cancer Epidemiol Biomarkers Prev. 14:491–496. 2005. View Article : Google Scholar : PubMed/NCBI

30 

Yin JY, Vogel U, Ma YG, Guo L, Wang HW and Qi R: Polymorphism of the DNA repair gene ERCC2 Lys751Gln and risk of lung cancer in a northeastern Chinese population. Cancer Genet Cytogenet. 169:27–32. 2006. View Article : Google Scholar : PubMed/NCBI

31 

McKean-Cowdin R, Barnholtz-Sloan J, Inskip PD, et al: Associations between polymorphisms in DNA repair genes and glioblastoma. Cancer Epidemiol Biomarkers Prev. 18:1118–1126. 2009. View Article : Google Scholar : PubMed/NCBI

32 

Tsai HT, Tsai YM, Yang SF, et al: Lifetime cigarette smoke and second-hand smoke and cervical intraepithelial neoplasm–a community-based case-control study. Gynecol Oncol. 105:181–188. 2007.

33 

Hellberg D, Valentin J and Nilsson S: Smoking as risk factor in cervical neoplasia. Lancet. 2:1497. 1983. View Article : Google Scholar : PubMed/NCBI

34 

Galkin VE, Esashi F, Yu X, Yang SX, West SC and Egelman EH: BRCA2 BRC motifs bind RAD51-DNA filaments. Proc Natl Acad Sci USA. 102:8537–8542. 2005. View Article : Google Scholar : PubMed/NCBI

35 

Jara L, Acevedo ML, Blanco R, et al: RAD51 135G>C polymorphism and risk of familial breast cancer in a South American population. Cancer Genet Cytogenet. 178:65–69. 2007.

36 

Xie DW, Shu XO, Deng ZL, et al: Population-based, case-control study of HER2 genetic polymorphism and breast cancer risk. J Natl Cancer Inst. 92:412–417. 2000. View Article : Google Scholar : PubMed/NCBI

37 

Louie KS, de Sanjose S, Diaz M, et al: Early age at first sexual intercourse and early pregnancy are risk factors for cervical cancer in developing countries. Br J Cancer. 100:1191–1197. 2009. View Article : Google Scholar : PubMed/NCBI

38 

Han SS, Cho EY, Lee TS, et al: Interleukin-12 p40 gene (IL12B) polymorphisms and the risk of cervical cancer in Korean women. Eur J Obstet Gynecol Reprod Biol. 140:71–75. 2008. View Article : Google Scholar : PubMed/NCBI

39 

Kohaar I, Thakur N, Salhan S, et al: TNF alpha-308G/A polymorphism as a risk factor for HPV associated cervical cancer in Indian population. Cell Oncol. 29:249–256. 2007.PubMed/NCBI

40 

Tong SY, Lee JM, Song ES, et al: Functional polymorphism in manganese superoxide dismutase and antioxidant status: Their interactions on the risk of cervical intraepithelial neoplasia and cervical cancer. Gynecol Oncol. 115:272–276. 2009. View Article : Google Scholar

41 

Lettre G, Lange C and Hirschhorn JN: Genetic model testing and statistical power in population-based association studies of quantitative traits. Genet Epidemiol. 31:358–362. 2007. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhang L, Ruan Z, Hong Q, Gong X, Hu Z, Huang Y and Xu A: Single nucleotide polymorphisms in DNA repair genes and risk of cervical cancer: A case-control study. Oncol Lett 3: 351-362, 2012.
APA
Zhang, L., Ruan, Z., Hong, Q., Gong, X., Hu, Z., Huang, Y., & Xu, A. (2012). Single nucleotide polymorphisms in DNA repair genes and risk of cervical cancer: A case-control study. Oncology Letters, 3, 351-362. https://doi.org/10.3892/ol.2011.463
MLA
Zhang, L., Ruan, Z., Hong, Q., Gong, X., Hu, Z., Huang, Y., Xu, A."Single nucleotide polymorphisms in DNA repair genes and risk of cervical cancer: A case-control study". Oncology Letters 3.2 (2012): 351-362.
Chicago
Zhang, L., Ruan, Z., Hong, Q., Gong, X., Hu, Z., Huang, Y., Xu, A."Single nucleotide polymorphisms in DNA repair genes and risk of cervical cancer: A case-control study". Oncology Letters 3, no. 2 (2012): 351-362. https://doi.org/10.3892/ol.2011.463
Copy and paste a formatted citation
x
Spandidos Publications style
Zhang L, Ruan Z, Hong Q, Gong X, Hu Z, Huang Y and Xu A: Single nucleotide polymorphisms in DNA repair genes and risk of cervical cancer: A case-control study. Oncol Lett 3: 351-362, 2012.
APA
Zhang, L., Ruan, Z., Hong, Q., Gong, X., Hu, Z., Huang, Y., & Xu, A. (2012). Single nucleotide polymorphisms in DNA repair genes and risk of cervical cancer: A case-control study. Oncology Letters, 3, 351-362. https://doi.org/10.3892/ol.2011.463
MLA
Zhang, L., Ruan, Z., Hong, Q., Gong, X., Hu, Z., Huang, Y., Xu, A."Single nucleotide polymorphisms in DNA repair genes and risk of cervical cancer: A case-control study". Oncology Letters 3.2 (2012): 351-362.
Chicago
Zhang, L., Ruan, Z., Hong, Q., Gong, X., Hu, Z., Huang, Y., Xu, A."Single nucleotide polymorphisms in DNA repair genes and risk of cervical cancer: A case-control study". Oncology Letters 3, no. 2 (2012): 351-362. https://doi.org/10.3892/ol.2011.463
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team