Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
June 2012 Volume 3 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June 2012 Volume 3 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Changes in leukocyte gene expression profiles induced by antineoplastic chemotherapy

  • Authors:
    • Rebeca González-Fernández
    • Manuel Morales
    • Julio Avila
    • Pablo Martín-Vasallo
  • View Affiliations / Copyright

    Affiliations: Laboratory of Developmental Biology, Department of Biochemistry and Molecular Biology, University of La Laguna, La Laguna 38201, Tenerife, Spain, Service of Medical Oncology, Hospital Universitario Ntra Sra de Candelaria, Santa Cruz de Tenerife 38010, Tenerife, Spain
  • Pages: 1341-1349
    |
    Published online on: April 3, 2012
       https://doi.org/10.3892/ol.2012.669
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

In the present study, we studied changes in gene expression induced by chemotherapy (CT) on normal peripheral blood leukocytes (PBLs), at baseline and following three CT cycles, in order to identify which genes were specifically affected and were potentially useful as biomarkers for a personalised prognosis and follow-up. A PBL subtraction cDNA library was constructed from four patients undergoing CT with paclitaxel and carboplatin (PC). mRNA from the PBLs was isolated prior to the patients receiving the first cycle and following the completion of the third cycle. The library was screened and the expression of the identified genes was studied in PBLs obtained from patients suffering from cancer prior to and following three cycles of PC and a reference group of patients undergoing treatment with Adriamycin-cyclophosphamide (AC). From the 1,200 screened colonies, 65 positive clones showed varied expression intensity and were sequenced; 27 of these were mitochondrial DNA and 38 clones (27 different) were coded for cytosolic and nuclear proteins. The genes that were studied in patients undergoing CT were ATM (ataxia-telangiectasia mutated gene), eIF4B (translation initiation factor 4B), MATR3 (Matrin 3), MORC3 (microrchidia 3), PCMTD2 (protein-L-isoaspartate O-methyltransferase), PDCD10 (programmed cell death gene 10), PSMB1 (proteasome subunit type β), RMND5A (required for meiotic nuclear division 5 homologue A), RUNX2 (runt-related transcription factor 2), SACM1L (suppressor of actin mutations 1-like), TMEM66 (transmembrane protein 66) and ZNF644 (zinc finger protein 644). Certain variations were observed in the expression of the genes that are involved in drug resistance mechanisms, some of which may be secondary to non-desirable effects and others of which may cause the undesired effects of CT. The expression of genes with a dynamic cellular role showed a marked positive correlation, indicating that their upregulation may be involved in a specific pattern of cell survival versus apoptosis in response to the cell damage induced by CT. Whether these CT-induced changes are random or directed in a specific selection-evolution manner needs to be elucidated.

Introduction

Anticancer chemotherapy (CT) functions by producing metabolic alterations, changing the structure and function of DNA, affecting mitotic microtubules or triggering apoptotic pathways in the target cells. As well as beneficial effects in cancer cells, CT results in non-desirable cytotoxic effects in normal healthy tissues. Bone marrow is most susceptible to the non-specific effects of CT; damage may result in short-term toxicity, such as myelosuppression and anaemia, or in long-term problems such as myelodysplastic syndromes or secondary leukaemia forms.

To investigate the changes in gene expression and the possible pathways involved in CT-induced cytotoxicity in normal blood cells, we studied peripheral blood leukocytes (PBLs) prior to and following three cycles of CT.

Most cytotoxic anticancer drugs target DNA directly through reactive metabolites or indirectly through incorporation into DNA (nucleotide analogues) or the blockade of DNA-metabolising enzymes, including polymerases and topoisomerases (1,2). This DNA damage triggers signalling pathways that ultimately lead to cell death (1,2).

Paclitaxel is a tubulin-binding agent that stabilises microtubules (α-β-tubulin heterodimers) in the microtubule-GDP complex, thereby inhibiting the dynamic role of the complex and consequently arresting mitosis (1,2). Platinum chemotherapeutic agents, including carboplatin, halt the cell cycle by forming stable complexes with DNA. The efficacy of chemotherapeutic agents in most types of cancer is limited by the development of resistance. Resistance to paclitaxel suggests the aberrant expression of β-tubulin isotypes, usually βIII-tubulin, or microtubule-regulating proteins (3). Resistance to platinum is commonly developed by the DNA nucleotide excision repair pathways as repair or mismatch repair, such as excision repair cross-complementation group 1 enzyme (ERCC1) (4).

Doxorubicin interacts with DNA by intercalating between two base pairs, blocking the progression of topoisomerase II and thereby preventing the process of replication (2). Resistance to doxorubicin is multifactorial, including increased levels of factors involved in reducing the intracellular drug concentration by increasing drug extrusion through membrane-associated pumps, the altered expression of topoisomerase II, increased ability of the cell to repair DNA damage and changes in gene expression that reduce the apoptotic response (5,6).

Cyclophosphamide mainly acts through its metabolite, phosphoramide mustard, which is an irreversible interstrand DNA crosslinker that causes cell death. Cytochrome P450 (CYP), glutathione S-transferase (GST) and ALDH protect the cells in tissues with rapid cell turnover against the toxic effects of phosphoramide mustard (7) by converting aldophosphamide to molecules that do not produce the toxic metabolites.

The aim of this study was to identify a group of genes in PBLs whose expression is modified by CT.

Materials and methods

Patients

This study was approved by the Ethics Committee of La Laguna University and HUNSC and all the subjects signed informed consent documents prior to entering the study. The study subjects were Caucasian, of European origin and recruited from the reference medical area of the hospital. The patients in this study were administered CT only (not radiotherapy or any other adjuvant therapy), and this was their first CT. Two groups were analysed: patients undergoing carboplatin-paclitaxel (PC) treatment and, as a reference, patients treated with doxorubicin (Adriamycin)-cyclophosphamide (AC).

Leukocyte isolation

PBLs were obtained immediately prior to patients undergoing the first cycle and following the third cycle (at the time the 4th cycle was administered). A volume of 1X PBS (1.9 mM NaH2PO4, 8.1 mM Na2HPO4, 154 mM NaCl) was added to an identical volume of freshly collected blood and mixed gently. The mix was placed over 5 ml Ficoll-Hypaque (d=1.077 g/ml) (Sigma, St. Louis, MO, USA) and centrifuged for 30 min at 600 × g. The intermediate layer (mononuclear white cells) was aspirated and washed three times in three volumes of HBSS (5.4 mM KCl, 0.3 mM Na2HPO4, 0.4 mM KH2PO4, 4.2 mM NaHCO3, 1.3 mM CaCl2, 0.5 mM MgCl2, 0.6 mM MgSO4, 137 mM NaCl, 5.6 mM D-glucose, 0.02% phenol red) and centrifuged at 300 × g for 10 min. The pellet containing the cells was resuspended in 1 ml of PBS. The trypan blue test and cell counting in a Neubauer chamber were performed. The amount of collected cells ranged from 3 to 4×106 cells.

PBL mRNA extraction, double stranded (ds) cDNA synthesis and PCR amplification

The collected PBLs from 5 ml of blood were spun at 300 × g for 5 min and mRNA was obtained from the cell pellet using the Total SV RNA Isolation system (Promega Corporation, Madison, WI, USA), according to the manufacturer’s instructions. cDNA was synthesised using the iScript cDNA Synthesis kit (Bio-Rad, Mannheim, Germany) for the real-time quantitative RT-PCR (qRT-PCR) assay and the Super SMART PCR cDNA Synthesis kit (Clontech Laboratories, Mountain View, CA, USA) for the subtraction library according to the manufacturer’s instructions.

ds-cDNA subtraction and library construction

The subtraction library was constructed using the PCR Select cDNA Subtraction kit (Clontech Laboratories) according to the manufacturer’s instructions, with ds-cDNA pools obtained from the white cells of the four patients immediately prior to undergoing the first cycle and at the time the 4th cycle of PC was administered, using equal amounts of cDNA from each patient. The pool of differentially expressed cDNA was cloned into the pBSK+ vector in competent E. coli, XL-2-Blue cells.

Dot-blot screening

Probes were used to subtract the cDNA from the PBLs obtained pre- and post-treatment and were digoxigenin-dUTP labeled using the DIG DNA labeling kit (Roche Diagnostics, Mannheim, Germany). Colonies from the library were seeded in plates containing LB-ampicillin (0.1 mg/ml), X-Gal (40 μg/ml) and IPTG (0.2 mM) solid medium and incubated at 37°C overnight. The colonies were selected and placed into 96-well plates in liquid LB-ampicillin (0.1 mg/m) medium and incubated at 37°C overnight. A volume of 1 μl from each cultured well was placed in duplicate onto two nylon membranes (Roche Diagnostics) and incubated at 37°C overnight over LB-ampicillin (0.1 mg/ml) solid medium plates. Duplicate membranes were probed with both probes (8) and positive clones were re-checked by double-dot-blotting of the PCR amplified product using T3 and T7 flanking sequence primers (8).

DNA sequencing and sequence identification

DNA sequencing was performed at La Laguna University Sequencing Facility. DNA for sequencing was prepared using the Qiaprep kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Sequence alignments of the sequences with those in the GenBank, EMBL, DDBJ and PDB databases were performed using the BLASTN and BLASTX algorithms (9).

qRT-PCR

mRNA was extracted from the PBLs to perform qRT-PCR for the selected genes (Table I) and the corresponding cDNAs were synthesised as described above. PCR assays were carried out using the Bio-Rad CFX96 Real-Time PCR system (Hercules, CA, USA). The specific primers for each gene are shown in Table I. PCR was performed using the SYBR-Green Supermix (Bio-Rad). The amplification reactions were performed in a 10-μl final volume containing 2X SYBR-Green Supermix and 10 μM of each primer. Each sample was analysed in triplicate and multiple water blanks were included. β-actin was amplified as a reference for mRNA quantification. The relative gene expression was presented as arbitrary units of the ratio of Ctgene/Ctβ-actin.

Table I

Primers and annealing temperatures used for qRT-PCR of selected genes.

Table I

Primers and annealing temperatures used for qRT-PCR of selected genes.

GenePrimerSequence (5′→3′)Tm (°C)
ATMATM-F AACGAGCCGATCCACAACC63.4
ATM-R CTCATGTAGTCCACAACAGCAAGC63.3
eIF4BeIF4B-F GGCAAAAAGGATCAAGACTCC60.1
eIF4B-R CCATCAACAGAGAGAGCAGC58.7
MATR3MATR3-F CCTAGTCTCAACCCAGTGC55.7
MATR3-R CATCCCTACACCTTTCTCC54.5
MORC3MORC3-F TCCACCTCAGTCTGAACC54.1
MORC3-R TCAAACTGACTACTCAATCTCC53.7
PCMTD2PCMTD2-F ATGCAAAGCAGAAACTGG54.8
PCMTD2-R CGATCATACTGAGAACAATCC54.7
PDCD10PDCD10-F CGATCATACTGAGAACAATCC50.2
PDCD10-R ATACGAAGAAGGGACTCC51.4
PSMB1PSMB1-F AGACTTGGGGATGGAACC57.2
PSMB1-R TCACTCAATCGAGTATCAGAAGC58.6
RMND5ARMND5A-F AGACCCAAGTCAGAAGGAACC59.6
RMND5A-R GGAGCTGTTTTGAGCTATAAGC57.5
RUNX2RUNX2-F GCCTCTGCTGTTATGAAAAACC60.1
RUNX2-R ATGGTCAAGGTGAAACTCTTGC60.5
SACM1LSACM1L-F GATTTGACCCATACTTTGC53
SACM1L-R TGACCATTCCATACAAACC54
TMEM66TMEM66-F TATCCTCCATTTTCCCACC57.2
TMEM66-R CAAAACCAGAAGTTGCACC56.7
ZNF644ZNF644-F GGACTTGACTATGCACTCAGC57.6
ZNF644-R TGTAAACCTCGTCAGCACC57.2
β-actinACT-F CTTCCTTCCTGGGCATGG61.6
ACT-R GCCGCCAGACAGCACTGT63.7

[i] qRT-PCR, real-time quantitative RT-PCR; Tm, annealing temperature; ATM, ataxia-telangiectasia mutated gene; eIF4B, translation initiation factor 4B; MATR3, Matrin 3; MORC3, microrchidia 3; PCMTD2, protein-L-isoaspartate O-methyltransferase; PDCD10, programmed cell death gene 10; PSMB1, proteasome subunit type β; RMND5A, required for meiotic nuclear division 5 homologue A; RUNX2, runt-related transcription factor 2; SACM1L, suppressor of actin mutations 1-like; TMEM66, transmembrane protein 66; ZNF644, zinc finger protein 644; ACT, actin; F, forward; R, reverse.

Statistical analysis

Statistical analysis was performed using the SPSS software and Pearson’s correlation coefficient. P<0.01 was considered statistically significant. The Kolmogorov-Smirnov analysis of these data showed that the expression values of these genes did not have a normal Gaussian distribution. Thus, in order to use the Pearson’s correlation coefficient, we obtained the decimal logarithm of each expression value. A Kolmogorov-Smirnov test of the logarithm values showed a normal distribution.

Results

Construction and screening of the subtracted cDNA library

We constructed a cDNA subtraction library from the PBLs obtained from patients immediately prior to undergoing the first cycle of CT and at the time the 4th cycle was administered (after completing 3 cycles). Screening of 1,200 colonies yielded a total of 65 positive clones of variable expression intensity. The sequencing and identification of the clones following CT treatment revealed that 27 were mitochondrial DNA and 38 (38 clones but 27 different genes) were coded for cytosolic and nuclear proteins (Tables II and III).

Table II

Identified genes coding for cytosolic and nuclear proteins whose expression levels varied following treatment with paclitaxel and carboplatin chemotherapy.a

Table II

Identified genes coding for cytosolic and nuclear proteins whose expression levels varied following treatment with paclitaxel and carboplatin chemotherapy.a

Identified geneClonesDiff signal int
Transcription and translation factors
 eIF4B1Medium
 H2AFZ1Low
 RUNX21High
 ZNF6441Medium
DNA repair
 ATM2Medium
Signal transduction
 MORC37High
 PDCD101High
Protein remodelling
 PCMTD21Low
 PSMB13High
Cellular multidynamic systems
 ADD31Low
 MATR31Low
 RMND5A1Medium
 SACM1L1Low
Metabolic pathways
 COQ31High
 CSNK1A11High
 FAR11Low
 FTL1High
 GMDS1Medium
 SORL11Medium
Unknown
 ANKRD101Medium
 Chromosome 8 clone RP11-320N211High
 Chromosome 1 clone RP11-545E242Low
 Chromosome 5 clone RP11-1C12Low
 Clone DNA16445 SELT (UNQ150)1High
 F8A11Medium
 TMEM661Low
 TMEM2091Low

a The genes are classified according to the functionality of the proteins they encode.

{ label (or @symbol) needed for fn[@id='tfn3-ol-03-06-1341'] } Diff signal int, different signal intensity; eIF4B, translation initiation factor 4B; H2AFZ, H2A histone family member Z; RUNX2, runt-related transcription factor 2; ZNF644, zinc finger protein 644; ATM, ataxia-telangiectasia mutated gene; MORC3, microrchidia 3; PDCD10, programmed cell death gene 10; PCMTD2, protein-L-isoaspartate O-methyltransferase; PSMB1, proteasome subunit type β; ADD3, adducin 3; MATR3, Matrin 3; RMND5A, required for meiotic nuclear division 5 homologue A; SACM1L, suppressor of actin mutations 1-like; COQ3, coenzyme Q3 homologue; CSNK1A1, casein kinase 1, alpha 1; FAR1, fatty acyl CoA reductase 1; FTL, ferritin, light polypeptide; GMDS, GDP-mannose 4,6-dehydratase; SORL1, sortilin-related receptor, L; ANKRD10, ankyrin repeat domain 10; RP11, retinitis pigmentosa; F8A1, coagulation factor VIII-associated 1; TMEM, transmembrane protein.

Table III

Identified leukocyte mitochondrial genes whose expression levels varied following paclitaxel and carboplatin chemotherapy.

Table III

Identified leukocyte mitochondrial genes whose expression levels varied following paclitaxel and carboplatin chemotherapy.

Identified geneClonesDiff signal int
16S ribosomal RNA gene3High
Isolate TV15 mitochondrion1Medium
Haplogroup J1b2 mitochondrion4Medium
Haplogroup U5b1 mitochondrion2High
Haplogroup U5b2 mitochondrion1High
Haplogroup K2a mitochondrion2Medium
ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit1Medium
Haplogroup H6* mitochondrion2High
Isolate L332 mitochondrion1High
Haplogroup H2a1 mitochondrion1High
Isolate MTDNA381 mitochondrion1High
Isolate ST024 mitochondrion1Medium
Haplotype U4a mitochondrion1High
Isolate Koryak 28 mitochondrion1High
Isolate MTDNA538 mitochondrion1Medium
Haplotype H5 mitochondrion3High
Isolate Tub28 mitochondrion1Medium

[i] Diff signal int, different signal intensity.

We classified the identified genes into seven groups according to the function of the protein they encode: protein synthesis activators (either at the transcriptional or translational level), DNA repair mechanisms, signal transduction pathways (apoptosis-survival), protein repair enzymes, cellular multidynamic systems, integral parts of metabolic pathways and unknown function (Table II).

Genes and proteins analysed in cancer patients undergoing CT

Certain genes were selected for the specific study of variations in their expression levels in two series of patients undergoing CT (Table II). The selected genes were ATM (ataxia-telangiectasia mutated gene), eIF4B (translation initiation factor 4B), MATR3 (Matrin 3), MORC3 (microrchidia 3), PCMTD2 (protein-L-isoaspartate O-methyltransferase), PDCD10 (programmed cell death gene 10), PSMB1 (proteasome subunit type β), RMND5A (required for meiotic nuclear division 5 homologue A), RUNX2 (runt-related transcription factor 2), SACM1L (suppressor of actin mutations 1-like), TMEM66 (transmembrane protein 66) and ZNF644 (zinc finger protein 644). To assess the specificity of carboplatin and paclitaxel on the regulatory response, a group of patients undergoing treatment with doxorubicin (Adriamycin) and cyclophosphamide was analysed concomitantly. Quantitation of the gene expression was carried out using qRT-PCR relative to actin.

Analysis of variation in the expression of selected genes induced by CT

The relative gene expression prior to and following CT with PC (Table IVA) or AC (Table IVB) was evaluated. In almost all of the genes studied there was a significant variation of expression, with up- and downregulation in patients treated with PC and AC. Only a few cases (one or two per group) of certain genes (Tables IVA and B) did not show significant variation in their expression levels. Column ‘N’ in Tables IVA and B indicates the number of cases in which the expression of each gene was increased or decreased significantly and the column ‘Ratio’ shows the mean of the increased or decreased ratio between the relative gene expression prior to and following CT (Pre-/Post-CT) for each patient. Genes with the greatest increases in expression induced by PC were RMND5A (7-fold), PDCD10 (3.9-fold) and MATR3 (4.5-fold). The increases in gene expression induced by AC therapy ranged between 1.4- and 2.1-fold. Decrease of the expression of the studied genes was shown in fewer cases at levels that range about a half of the previous expression to CT.

Table IV

Mean and typical error of relative gene expression, prior to and following chemotherapy.

Table IV

Mean and typical error of relative gene expression, prior to and following chemotherapy.

A, Relative gene expression prior to and following chemotherapy with paclitaxel and carboplatin

GeneExpressionNPre-CTPost-CTRatio
ATMIncrease6866±3712301±10002.8±0.20
Decrease22479±8391316±3030.6±0.05
No change0
eIF4BIncrease311730±395820092±66881.8±0.18
Decrease514588±63865358±15780.6±0.08
No change0
MATR3Increase21041±1884358±11084.5±1.90
Decrease58357±20903673±18480.5±0.10
No change1881882
MORC3Increase4166±221733±13542.1±0.80
Decrease21502±458835±3300.5±0.05
No change22235±13192485±1513
PCMTD2Increase5656±2262276±10062.7±0.98
Decrease18917000.8
No change2819±519884±594
PDCD10Increase6924±31310828±65603.9±0.71
Decrease27067±24394756±31380.6±0.25
No change0
PSMB1Increase6788±3783137±11783.3±0.64
Decrease0
No change23898±20784172±2566
RMND5AIncrease5816±29413569±82017±3.07
Decrease26091±14033172±5600.5±0.05
No change117561495
RUNX2Increase4399±1871081±4472.1±0.24
Decrease23277±1081236±4130.4±0.10
No change2584±479498±408
SACM1LIncrease5352±157742±2841.7±0.19
Decrease36006±27511524±4810.4±0.11
No change0
TMEM66Increase32900±149616501±51453±0.25
Decrease326174±778012398±45960.5±0.17
No change23626±16913905±1900
ZNF644Increase4221±1061040±3772.9±0.29
Decrease42026±10621012±4670.6±0.08
No change0

B, Relative gene expression prior to and following chemotherapy with Adriamycin and cyclophosphamide

GeneExpressionNPre-CTPost-CTRatio

ATMIncrease41589±4532385±6971.5±0.11
Decrease42655±4601235±1390.5±0.08
No change22554±9512349±853
eIF4BIncrease47622±111416094±44902±0.39
Decrease511250±17307462±18170.6±0.09
No change194308304
MATR3Increase42766±5904154±10271.5±0.07
Decrease53789±4052154±3470.6±0.07
No change113571276
MORC3Increase3842±721302±1271.6±0.12
Decrease51135±70786±1120.7±0.06
No change21090±1061066±59
PCMTD2Increase3791±711247±3181.5±0.27
Decrease3864±380405±1730.5±0.09
No change4993±256976±250
PDCD10Increase74348±144810148±77472±0.46
Decrease22908±1111873±640.6±0.00
No change126282967
PSMB1Increase65489±305615822±124991.7±0.41
Decrease42966±4811877±3620.6±0.09
No change0
RMND5AIncrease4920±1501741±2881.9±0.14
Decrease43032±13511518±4460.6±0.12
No change2807±131852±98
RUNX2Increase4632±961241±1872.1±0.33
Decrease41441±306755±1770.5±0.05
No change2444±180437±155
SACM1LIncrease3953±991497±1271.6±0.25
Decrease61124±251631±1410.6±0.09
No change1584584
TMEM66Increase26941±27659935±30961.5±0.15
Decrease611805±19836396±7750.6±0.04
No change27143±27347808±3201
ZNF644Increase21072±2392148±11791.9±0.65
Decrease61016±244484±620.5±0.07
No change2773±99802±80

[i] Every measure was the result of triplicate samples. N indicates the number of cases in which the expression of each gene was increased, decreased or not significantly altered following CT. Ratio shows the mean and typical error of the increased or decreased quotient between relative gene expression prior to and following CT (Pre-/Post-CT) for each patient. CT, chemotherapy; Pre-CT, prior to CT; Post-CT, following CT; PC, paclitaxel and carboplatin; AC, Adriamycin and cyclophosphamide; ATM, ataxia-telangiectasia mutated gene; eIF4B, translation initiation factor 4B; MATR3, Matrin 3; MORC3, microrchidia 3; PCMTD2, protein-L-isoaspartate O-methyltransferase; PDCD10, programmed cell death gene 10; PSMB1, proteasome subunit type β; RMND5A, required for meiotic nuclear division 5 homologue A; RUNX2, runt-related transcription factor 2; SACM1L, suppressor of actin mutations 1-like; TMEM66, transmembrane protein 66; ZNF644, zinc finger protein 644.

Results of the analysis of correlation among the genes with up- or downregulated expression are shown in Fig. 1.

Figure 1

Correlations between the studied genes. +, positive correlation, P<0.01; -, negative correlation, P<0.01; ns, no significant correlation; PC, paclitaxel and carboplatin; AC, Adriamycin and cyclophosphamide; ATM, ataxia-telangiectasia mutated gene; eIF4B, translation initiation factor 4B; MATR3, Matrin 3; MORC3, microrchidia 3; PCMTD2, protein-L-isoaspartate O-methyltransferase; PDCD10, programmed cell death gene 10; PSMB1, proteasome subunit type β; RMND5A, required for meiotic nuclear division 5 homologue A; RUNX2, runt-related transcription factor 2; SACM1L, suppressor of actin mutations 1-like; TMEM66, transmembrane protein 66; ZNF644, zinc finger protein 644.

Discussion

Areas of progress in the fields of cancer biology and CT currently include strategies for identifying genes that are differentially expressed in different situations, including normal and cancer cells or, as in this study, prior to and following CT. Several methods have been used for these analyses, including SAGE (serial analysis of gene expression) (10), the differential display of mRNA by PCR (11) and the generation and screening of cDNA subtraction libraries (12). We selected the last method in order to obtain cDNA clones that could be used to analyse or produce recombinant proteins and subsequent antibodies for lesser known genes and proteins. This study specifically concerns the construction and screening of the library, the description of differential genes and their analysis in two groups of patients undergoing CT. Thus, in addition to patients receiving PC, we extended our study to women suffering from breast cancer who were undergoing doxorubicin (Adriamycin) and cyclophosphamide treatment in the adjuvant setting in order to differentiate genes whose expression varies as a general response to CT from those which are more specifically correlated with PC treatment.

The ATM gene is distinctive as mutations in this gene are associated with the ataxia telangiectasia disorder. ATM is a central transducer of DNA damage signals and ensures the normal repair of DNA ds breaks (13). ATM belongs to the PI3/PI4-kinase family and is a cell cycle checkpoint kinase that functions as a regulator of a wide variety of downstream proteins, including the tumour suppressor proteins p53, BRCA1, CHK2, RAD17 and RAD9 and the DNA repair protein NBS1. The ATM and ATR proteins are closely related and control the cell cycle checkpoint signalling pathways that are required for cellular responses to DNA damage and for genome stability (14). We suggest that leukocytes upregulate the ATM gene during CT in order to repair DNA that has been damaged by drugs.

eIF4B stimulates the helicase activity of the DEAD box protein translation initiation factor 4A (eIF4A) to unwind the inhibitory secondary structure of the 5′ untranslated region of eukaryotic mRNAs. Increasing the expression of the eIF4B gene might be a general response to CT in order to accelerate the synthesis of proteins involved in drug resistance or metabolic changes involved in cell survival, but the helicase activity of eIF4B suggests that its upregulation is more specifically correlated with carboplatin treatment (15).

MATR3 is a nuclear matrix protein that has been reported to interact with other nuclear proteins to anchor RNAs to the nuclear matrix, modulate the activity of proximal promoters and to be the main PKA substrate following the activation of the NMDA receptor (16). Two transcript variants encoding the same protein have been identified for this gene. Matrin3 has been identified as a Ca2+-dependent CaM-binding protein and a downstream substrate for caspases (17). MATR3 acts as a co-factor of the HIV-1 Rev protein during nuclear export and the translation of unspliced and partially spliced viral mRNA (18).

MORC3, also termed KIAA0136, ZCWCC3 and NXP-2, encodes a member of the MORC protein family, which is characterised by conserved structures consisting of a GHL (Gyrase B, Hsp90 and MutL)-ATPase domain, a zinc finger-type CW domain (four cysteines and two tryptophans), a nuclear localisation signal (NLS) and coiled-coil domains at the carboxy-terminus, as mentioned in (19). MORC3 is ubiquitously expressed in humans, localises to the nuclear matrix, has RNA binding activity and regulates p53 activity and localisation to promyelocytic leukaemia-nuclear bodies (PML-NBs) (19). The upregulation of MATR3 and MORC3 may indicate an attempt to drive an injured cell, through the caspase and p53 pathways, to apoptosis.

PCMTD2 is also termed PIMT (protein-L-isoaspartate O-methyltransferase). The formation of L-isoaspartyl (isoAsp) peptide bonds is a major source of protein damage in vivo and in vitro. PIMT is a protein repair enzyme that converts L-isoaspartyl residues in damaged proteins to normal L-aspartyl residues. In rat nucleosomes, the histone H2B was found to accumulate isoAsp in the Asp25-Gly26 bond in the N-terminal tail. In chicken nucleosomes, isoAsp accumulated mainly in histone H2A and, to a lesser extent, in histone H2B (20–22).

PDCD10 is also known as cerebral cavernous malformation-3 and CCM3. This gene encodes an evolutionarily conserved protein which is associated with cell apoptosis and has multiple alternatively spliced variants encoding the same protein (23). The protein interacts with the serine/threonine protein kinase MST4 to modulate the extracellular signal-regulated kinase (ERK) pathway. The protein also interacts with and is phosphorylated by serine/threonine kinase 2 in a signalling pathway, which is critical for vascular development (24). Gene chip data have suggested that PDCD10 is involved in tumour signalling, as it was shown to be upregulated in pancreatic adenocarcinoma (25), metastatic colon cancer cells resistant to cisplatin-induced apoptosis and other cancer cell lines (26). Thus, our data suggest that the interaction pathway PDCD10-MST4-ERK-MAPK, one of the most significant regulators of cell proliferation, is also affected by the two CT therapies investigated in the present study.

The PSMB1 proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped core structure. This gene encodes a member of the proteasome B-type family, also known as the T1B family, with a 20S core β subunit. The PSMB1 subunit is critical for the degradation of several proteins, more specifically those involved in cell proliferation and cancer (27).

RMND5A, also known as CTLH, RMD5, p44CTLH, FLJ12753, FLJ13910, FLJ21795 and MGC78451, forms complexes in cells with RanBPM, ARMC8α, ARMC8β, Muskelin and p48EMLP. RMND5A is a key component of the CTLH complex (C-terminal to lissencephaly type-1-like homology motif). This complex is involved in microtubule dynamics, cell migration, nucleokinesis and chromosome segregation (28). Therefore, the variations in the expression of the RMND5A gene may be due to the effects of paclitaxel.

RUNX2 is a member of the RUNX family of transcription factors, which are essential for osteoblast growth and differentiation and chondrocyte maturation. RUNX2 encodes a nuclear protein with a Runt DNA-binding domain that controls the expression of target genes involved in cell fate decisions (29). Runx-2 isoforms are produced by transcript variants caused by alternative promoters and alternative splicing. In the osteosarcoma cell line Saos2, Runx2 has been shown to regulate apoptosis via modulation of the Bcl2 family of proteins (30).

The SACM1L gene encodes a phosphoinositide phosphatase that is an integral membrane protein of the endoplasmic reticulum (ER) and the Golgi apparatus representing a class of phosphoinositide degradation enzymes (31,32). The integral membrane Sac1 phosphatases are a major class of this type of enzyme. Additionally, SAC1 accumulates in the Golgi complex of quiescent cells and suppresses anterograde trafficking by depleting Golgi PI(4)P (33).

For the purposes of our study, the reported case of a mixed lineage leukaemia MLL-rearrangement with the suppressor of actin mutations 1-like (MLL-SACM1L) rearrangement is significant. This rearrangement was observed in bone marrow cells during CT for acute lymphoblastic leukaemia with hyperdiploidy and was continuously detected over seven years without exhibiting clonal expansion (34).

TMEM66, also known as XTP3, FOAP-7, HSPC035, MGC8721 and FLJ22274, is regarded as a potential marker for prostate cancer, included into a group of secreted proteins (35,36) and counted among others in a screening for proapoptotic genes (37). No specific function has yet been attributed to the protein product of this gene.

ZNF644 (38) is a large multizinc finger homologue of the KIAA1221 and WIZ proteins (39). It has been reported that these three proteins co-purified with CDYL, which is associated with histone methylase G9a and mediates a REST tumour suppression function. The specific function of ZNF644 is currently unknown.

All the studied genes in the patients from the PC group showed a positive correlation with each other, with the marked exception of eIF4B and MATR3. Most of these correlations were not found in the AC patient group; furthermore, some of the correlations were negative in this group. Notably, MORC3 and ZNF644 in the PC patients had a positive correlation with the rest of the genes, whereas, in the AC patients, MORC3 did not show a correlation with any gene and ZNF644 was correlated with only a few genes.

A high correlation of the levels of expression of most of the identified genes coding for cytosolic and nuclear proteins were included in the cellular multidynamic system and signal transduction groups (Table II). The balance in the variation in their expression drives the cell to life versus apoptosis as a response to cellular damage induced by CT. This expression pattern corresponds to the pattern for CT-surviving cells, assuming that cells that did not react by modifying the expression of these genes, thereby inducing apoptosis and cell death. This hypothesis is further supported by the different expression patterns observed in the leukocytes obtained from AC-treated patients. The few up- or downregulations the PC- and AC-treated groups have in common are likely to be due to the similar modes of action of carboplatin and Adriamycin and the manner in which cells react to the two drugs.

A notable differential positive correlation between the PC and AC groups is that of PCMTD2 with PDCD10 and the non- significant PCMTD2 with PSMB1 in PC-treated patients. In the case of AC-treated patients, the expression of the PCMTD2 gene showed a negative correlation with the expression of PDCD10 and PSMB1. As such, the expression of an apoptosis regulatory gene was correlated with a protein repair gene and not a proteasome subunit gene in the PC-treated group. However, the same apoptosis regulatory gene in AC-treated patients was negatively correlated with the protein repair gene and the proteasome subunit gene. This further supports the theory that the increased expression of genes that are involved in protein repair and damaged protein degradation following PC treatment is indicative of an attempt to rescue the cells from the effects of PC-induced cytotoxicity.

In the PC-treated patients, the amount of circulating platelets and the expression levels of the ATM, MORC, PSMB1, RUNX TMEM and ZNF genes showed a negative correlation (P<0.05). No other correlation between groups of patients with up- or downregulated genes and clinical parameters, including anaemia, fever, secondary neuropathy or mucositis, has been demonstrated for any of the studied parameters.

The results indicate a heterogeneous response of white cells (Tables IVA and B) resulting in different populations that have the up- or downregulation of the expression of certain genes in common. The contradictory responses of cells which contemporaneously increased the expression of genes involved in the survival and apoptotic responses may be due to the critical moment at which cells are committed to evolving and surviving or being eliminated by apoptosis.

This study was performed with a reduced sample of patients, as a pilot study, to identify genes whose expression levels are affected by CT. Now that the changes in gene expression are known, further studies should be performed with a larger cohort of patients and a longer follow-up period to ascertain whether certain genes are associated with specific clinical or analytical manifestations.

The patients treated with PC CT had stage III-IV non-small cell lung cancer or gynaecological cancer. This group of patients have a high incidence of chronic anaemia, reducing the possibility of identifying the effects of the changes in gene expression on the development of bone marrow toxicity.

Certain genes that showed altered patterns of expression in the leukocytes may be involved in the generation of the non-desirable effects of CT in normal blood cells. In the short-term, it should be determined whether there is any association between these changes and immune deficiency, which leads to infectious complications in a reversible or permanent manner. This is critical in establishing prognostic significance in terms of immune surveillance and the recurrence rate.

If these variations in gene expression originate in stem cells, they may be important for CT-associated anaemia or, in the long-term, for myelodysplastic syndromes. If these CT-induced alterations in gene expression also occur in tumour cells, we should expect them to contribute, in heavily treated patients, to an increased genomic instability and rapid disease progression. More studies are necessary to determine whether these changes in gene expression are correlated with the short- and/or long-term toxicities of anticancer CT. Additionally, whether these changes are random or directed in a specific selection-evolution manner also needs to be elucidated.

Acknowledgements

This study was supported by grants from the Grupo Hospiten, Tenerife, Spain to M.M.; FIS PS09/0128 to J.A. and FIS PI11/00141, Spain, to P. M-V. The authors thank Dr Eduardo Salido, Facultad de Medicina, Universidad de La Laguna, Spain and Dr Ali Mobasheri, Nottingham University Vet School, UK, for their critical reading and editorial help.

References

1 

DeVita V; DePinho RA, Lawrence TS, Rosenberg SA and Weinberg RA: DeVita, Hellman, and Rosenberg’s Cancer: Principles and Practice of Oncology. 9th edition. Lippincott Williams & Wilkins; Philadelphia: 2011

2 

Perry MC: The Chemotherapy Source Book. 4th edition. Lippincott Williams & Wilkins; Philadelphia: 2008

3 

Kavallaris M, Kuo DY, Burkhart CA, et al: Taxol-resistant epithelial ovarian tumors are associated with altered expression of specific beta-tubulin isotypes. J Clin Invest. 100:1282–1293. 1997. View Article : Google Scholar : PubMed/NCBI

4 

Steffensen KD, Waldstrom M and Jakobsen A: The relationship of platinum resistance and ERCC1 protein expression in epithelial ovarian cancer. Int J Gynecol Cancer. 19:820–825. 2009. View Article : Google Scholar : PubMed/NCBI

5 

Smith L, Watson MB, O’Kane SL, Drew PJ, Lind MJ and Cawkwell L: The analysis of doxorubicin resistance in human breast cancer cells using antibody microarrays. Mol Cancer Ther. 5:2115–2120. 2006. View Article : Google Scholar : PubMed/NCBI

6 

Watts GS, Futscher BW, Isett R, Gleason-Guzman M, Kunkel MW and Salmon SE: cDNA microarray analysis of multidrug resistance: doxorubicin selection produces multiple defects in apoptosis signaling pathways. J Pharmacol Exp Ther. 299:434–441. 2001.

7 

Ekhart C, Doodeman VD, Rodenhuis S, Smits PH, Beijnen JH and Huitema AD: Influence of polymorphisms of drug metabolizing enzymes (CYP2B6, CYP2C9, CYP2C19, CYP3A4, CYP3A5, GSTA1, GSTP1, ALDH1A1 and ALDH3A1) on the pharmacokinetics of cyclophosphamide and 4-hydroxycyclophosphamide. Pharmacogenet Genomics. 18:515–523. 2008. View Article : Google Scholar

8 

Sambrook J, Fritsch EF and Maniatis T: Molecular Cloning: A Laboratory Manual. 2nd edition. Cold Spring Harbor Laboratory; 1989

9 

Altschul SF, Madden TL, Schaffer AA, et al: Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389–3402. 1997. View Article : Google Scholar : PubMed/NCBI

10 

Velculescu VE, Zhang L, Vogelstein B and Kinzler KW: Serial analysis of gene expression. Science. 270:484–487. 1995. View Article : Google Scholar : PubMed/NCBI

11 

Liang P and Pardee AB: Differential display of mRNA by PCR. Curr Protoc Mol Biol. Chapter 25(Unit 25): pp. B32001

12 

Diatchenko L, Lau YF, Campbell AP, et al: Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc Natl Acad Sci USA. 93:6025–6030. 1996. View Article : Google Scholar

13 

Bensimon A, Aebersold R and Shiloh Y: Beyond ATM: the protein kinase landscape of the DNA damage response. FEBS Lett. 585:1625–1639. 2011. View Article : Google Scholar : PubMed/NCBI

14 

Lavin MF: Ataxia-telangiectasia: from a rare disorder to a paradigm for cell signalling and cancer. Nat Rev Mol Cell Biol. 9:759–769. 2008. View Article : Google Scholar : PubMed/NCBI

15 

Parsyan A, Svitkin Y, Shahbazian D, et al: mRNA helicases: the tacticians of translational control. Nat Rev Mol Cell Biol. 12:235–245. 2011. View Article : Google Scholar : PubMed/NCBI

16 

Przygodzka P, Boncela J and Cierniewski CS: Matrin 3 as a key regulator of endothelial cell survival. Exp Cell Res. 317:802–811. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Valencia CA, Ju W and Liu R: Matrin 3 is a Ca2+/calmodulin-binding protein cleaved by caspases. Biochem Biophys Res Commun. 361:281–286. 2007.PubMed/NCBI

18 

Kula A, Guerra J, Knezevich A, Kleva D, Myers MP and Marcello A: Characterization of the HIV-1 RNA associated proteome identifies Matrin 3 as a nuclear cofactor of Rev function. Retrovirology. 8:602011. View Article : Google Scholar : PubMed/NCBI

19 

Takahashi K, Yoshida N, Murakami N, et al: Dynamic regulation of p53 subnuclear localization and senescence by MORC3. Mol Biol Cell. 18:1701–1709. 2007. View Article : Google Scholar : PubMed/NCBI

20 

Shimizu T, Matsuoka Y and Shirasawa T: Biological significance of isoaspartate and its repair system. Biol Pharm Bull. 28:1590–1596. 2005. View Article : Google Scholar : PubMed/NCBI

21 

Young GW, Hoofring SA, Mamula MJ, et al: Protein L-isoaspartyl methyltransferase catalyzes in vivo racemization of Aspartate-25 in mammalian histone H2B. J Biol Chem. 280:26094–26098. 2005. View Article : Google Scholar : PubMed/NCBI

22 

Carter WG and Aswad DW: Formation, localization, and repair of L-isoaspartyl sites in histones H2A and H2B in nucleosomes from rat liver and chicken erythrocytes. Biochemistry. 47:10757–10764. 2008. View Article : Google Scholar : PubMed/NCBI

23 

Lauenborg B, Kopp K, Krejsgaard T, et al: Programmed cell death-10 enhances proliferation and protects malignant T cells from apoptosis. APMIS. 118:719–728. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Ma X, Zhao H, Shan J, et al: PDCD10 interacts with Ste20-related kinase MST4 to promote cell growth and transformation via modulation of the ERK pathway. Mol Biol Cell. 18:1965–1978. 2007. View Article : Google Scholar : PubMed/NCBI

25 

Aguirre AJ, Brennan C, Bailey G, et al: High-resolution characterization of the pancreatic adenocarcinoma genome. Proc Natl Acad Sci USA. 101:9067–9072. 2004. View Article : Google Scholar : PubMed/NCBI

26 

Huerta S, Harris DM, Jazirehi A, et al: Gene expression profile of metastatic colon cancer cells resistant to cisplatin-induced apoptosis. Int J Oncol. 22:663–670. 2003.PubMed/NCBI

27 

Keutgens A, Zhang X, Shostak K, et al: BCL-3 degradation involves its polyubiquitination through a FBW7-independent pathway and its binding to the proteasome subunit PSMB1. J Biol Chem. 285:25831–25840. 2010. View Article : Google Scholar : PubMed/NCBI

28 

Kobayashi N, Yang J, Ueda A, et al: RanBPM, Muskelin, p48EMLP, p44CTLH, and the armadillo-repeat proteins ARMC8alpha and ARMC8beta are components of the CTLH complex. Gene. 396:236–247. 2007. View Article : Google Scholar : PubMed/NCBI

29 

Pratap J, Lian JB, Javed A, et al: Regulatory roles of Runx2 in metastatic tumor and cancer cell interactions with bone. Cancer Metastasis Rev. 25:589–600. 2006. View Article : Google Scholar : PubMed/NCBI

30 

Eliseev RA, Dong YF, Sampson E, et al: Runx2-mediated activation of the Bax gene increases osteosarcoma cell sensitivity to apoptosis. Oncogene. 27:3605–3614. 2008. View Article : Google Scholar : PubMed/NCBI

31 

Rohde HM, Cheong FY, Konrad G, Paiha K, Mayinger P and Boehmelt G: The human phosphatidylinositol phosphatase SAC1 interacts with the coatomer I complex. J Biol Chem. 278:52689–52699. 2003. View Article : Google Scholar : PubMed/NCBI

32 

Liu Y, Boukhelifa M, Tribble E, et al: The Sac1 phosphoinositide phosphatase regulates Golgi membrane morphology and mitotic spindle organization in mammals. Mol Biol Cell. 19:3080–3096. 2008. View Article : Google Scholar : PubMed/NCBI

33 

Blagoveshchenskaya A, Cheong FY, Rohde HM, et al: Integration of Golgi trafficking and growth factor signaling by the lipid phosphatase SAC1. J Cell Biol. 180:803–812. 2008. View Article : Google Scholar : PubMed/NCBI

34 

Mori T, Nishimura N, Hasegawa D, et al: Persistent detection of a novel MLL-SACM1L rearrangement in the absence of leukemia. Leuk Res. 34:1398–1401. 2010. View Article : Google Scholar : PubMed/NCBI

35 

Romanuik TL, Ueda T, Le N, et al: Novel biomarkers for prostate cancer including noncoding transcripts. Am J Pathol. 175:2264–2276. 2009. View Article : Google Scholar : PubMed/NCBI

36 

Romanuik TL, Wang G, Holt RA, Jones SJ, Marra MA and Sadar MD: Identification of novel androgen-responsive genes by sequencing of LongSAGE libraries. BMC Genomics. 10:4762009. View Article : Google Scholar : PubMed/NCBI

37 

Mannherz O, Mertens D, Hahn M and Lichter P: Functional screening for proapoptotic genes by reverse transfection cell array technology. Genomics. 87:665–672. 2006. View Article : Google Scholar : PubMed/NCBI

38 

Mulligan P, Westbrook TF, Ottinger M, et al: CDYL bridges REST and histone methyltransferases for gene repression and supp-ression of cellular transformation. Mol Cell. 32:718–726. 2008. View Article : Google Scholar : PubMed/NCBI

39 

Matsumoto K, Ishii N, Yoshida S, Shiosaka S, Wanaka A and Tohyama M: Molecular cloning and distinct developmental expression pattern of spliced forms of a novel zinc finger gene wiz in the mouse cerebellum. Brain Res Mol Brain Res. 61:179–189. 1998. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
González-Fernández R, Morales M, Avila J and Martín-Vasallo P: Changes in leukocyte gene expression profiles induced by antineoplastic chemotherapy. Oncol Lett 3: 1341-1349, 2012.
APA
González-Fernández, R., Morales, M., Avila, J., & Martín-Vasallo, P. (2012). Changes in leukocyte gene expression profiles induced by antineoplastic chemotherapy. Oncology Letters, 3, 1341-1349. https://doi.org/10.3892/ol.2012.669
MLA
González-Fernández, R., Morales, M., Avila, J., Martín-Vasallo, P."Changes in leukocyte gene expression profiles induced by antineoplastic chemotherapy". Oncology Letters 3.6 (2012): 1341-1349.
Chicago
González-Fernández, R., Morales, M., Avila, J., Martín-Vasallo, P."Changes in leukocyte gene expression profiles induced by antineoplastic chemotherapy". Oncology Letters 3, no. 6 (2012): 1341-1349. https://doi.org/10.3892/ol.2012.669
Copy and paste a formatted citation
x
Spandidos Publications style
González-Fernández R, Morales M, Avila J and Martín-Vasallo P: Changes in leukocyte gene expression profiles induced by antineoplastic chemotherapy. Oncol Lett 3: 1341-1349, 2012.
APA
González-Fernández, R., Morales, M., Avila, J., & Martín-Vasallo, P. (2012). Changes in leukocyte gene expression profiles induced by antineoplastic chemotherapy. Oncology Letters, 3, 1341-1349. https://doi.org/10.3892/ol.2012.669
MLA
González-Fernández, R., Morales, M., Avila, J., Martín-Vasallo, P."Changes in leukocyte gene expression profiles induced by antineoplastic chemotherapy". Oncology Letters 3.6 (2012): 1341-1349.
Chicago
González-Fernández, R., Morales, M., Avila, J., Martín-Vasallo, P."Changes in leukocyte gene expression profiles induced by antineoplastic chemotherapy". Oncology Letters 3, no. 6 (2012): 1341-1349. https://doi.org/10.3892/ol.2012.669
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team