Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
November 2012 Volume 4 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November 2012 Volume 4 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Regulation of neutrophil gelatinase-associated lipocalin expression by C/EBPβ in lung carcinoma cells

  • Authors:
    • Pi-Xian Zhang
    • Jing-Xia Chang
    • Jian-Jun Xie
    • Hua-Min Yuan
    • Ze-Peng Du
    • Fa-Ren Zhang
    • Zhuo Lü
    • Li-Yan Xu
    • En-Min Li
  • View Affiliations / Copyright

    Affiliations: Department of Biochemistry and Molecular Biology, The Key Immunopathology Laboratory of Guangdong Province, Medical College of Shantou University, Shantou, Guangdong 515041, P.R. China, Institute of Oncologic Pathology, The Key Immunopathology Laboratory of Guangdong Province, Medical College of Shantou University, Shantou, Guangdong 515041, P.R. China
  • Pages: 919-924
    |
    Published online on: August 9, 2012
       https://doi.org/10.3892/ol.2012.859
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Neutrophil gelatinase-associated lipocalin (NGAL), a member of the lipocalin family, has been found to be overexpressed in a variety of tumors, including lung adeno­carcinomas. However, the mechanism by which NGAL expression is regulated in lung carcinoma needs further evaluation. In this study, immunohistochemistry was employed to analyze the expression of NGAL in lung carcinoma tissue samples, including lung squamous carcinomas, adenocarcinomas, adenosquamous carcinomas and bronchial alveolar cell carcinomas. The results showed that NGAL was expressed in 82.61% (19/23) of the samples. RT-PCR and immunofluorescent staining showed that NGAL was localized to the cytoplasm in lung carcinoma cell lines. To explore the transcriptional regulation mechanism of NGAL basal expression in lung carcinoma, a 1515-bp fragment (-1431 to +84) of the NGAL promoter region was cloned and a series of deletion and mutation constructs were generated. These constructs were analyzed using the luciferase reporter assay. The results indicated that the cis-acting elements important for the basal activity of NGAL transcription were likely located between -152 and -141. Further analysis using site-directed mutagenesis and the luciferase reporter assay suggested that the C/EBP binding sites were responsible for the activity of the NGAL promoter. Finally, the binding ability and specificity of the transcription factors were determined by electrophoretic mobility-shift assay (EMSA). The results showed that C/EBPβ was able to bind to the -152 and -141 segments. Taken together, these findings suggest that NGAL is expressed in lung carcinomas and that NGAL expression is mediated by the binding of C/EBPβ to the -152 and -141 segment of the NGAL promoter.

Introduction

Neutrophil gelatinase-associated lipocalin (NGAL), a member of the lipocalin family, was originally identified as a protein stored in specific granules of the human neutrophil (1). Besides the neutrophil, NGAL is expressed in most tissues normally exposed to micro-organisms and is induced in epithelial cells during inflammation (2). NGAL binds bacterial catecholate-type ferric siderophores and acts as a potent bacteriostatic agent by sequestering iron, indicating that NGAL participates in the iron-depletion strategy of the innate immune system (2). In addition, increased NGAL expression has been observed in a variety of pathological conditions, including inflammation, acute ischemic renal injury and various types of human cancer (3). The upregulation of NGAL has been found in human tumors of various organs, including the ovary, colon, pancreas, lung, esophagus and thyroid (2). Previous studies have also demonstrated that the association of NGAL with cancer progression may be due to the ability of NGAL to interact and protect MMP-9 from degradation, resulting in increased MMP-9 activity (4).

Some findings have been reported concerning the mechanisms of NGAL transcriptional regulation. The induction of NGAL expression by the co-stimulation of IL-17 and TNFα was controlled by IκB-ζ, but not by C/EBPβ or C/EBPδ in lung cancer A549 cells (5). NGAL was consistently upregulated in lung cancer A549 cells following IL-1β stimulation, and in thyroid cancer FRO cells following IκB-ζ stimulation (6,7). Moreover, the region of the NGAL promoter from −153 to −90 contained cis-acting elements that may be significant for the basal expression of NGAL in A549 cells (8). C/EBPε also enhanced the transcription of NGAL in neutrophilic granulocytes, as demonstrated by C/EBPε−/− mice experiments (9). We previously studied the responsiveness of NGAL to TPA stimulus in EC109 cells, an esophageal squamous cell carcinoma cell line, and found that the region between −152 and −60 of the NGAL promoter contained TPA response elements, which were identified to the region required for basal expression (10). Our more recent study showed that NGAL was overexpressed in gastric cancer; the binding of C/EBPβ to the TRE of the NGAL promoter mediated its TPA-induced overexpression in gastric carcinoma cells (11). However, to date the core promoter elements for NGAL basal expression are uncertain.

To further explore the transcriptional regulation of NGAL, in the current study, we cloned a 1515-bp fragment (−1431 to +84) of the NGAL promoter region in lung cancer cells and generated a series of deletion and mutation constructs. Further studies using these constructs revealed that the region from −152 to −141 was the core promoter of NGAL and that NGAL expression was mediated by the binding of C/EBPβ to the −152 and −141 segments of the NGAL promoter.

Materials and methods

Cell culture

Two cell lines, 95D (a lung carcinoma cell line of high metastatic propensity) and A549 (type II pneumocyte-derived cell line), were purchased from the Chinese Academy of Sciences. They were all epithelial-like lung carcinoma cells and were cultured in DMEM medium (Invitrogen, Carlsbad, CA, USA) and maintained in a humidified atmosphere with 5% CO2 at 37°C. For transfection, the cells were seeded in 96-well plates at 1.5x105 cells/ml.

Immunohistochemical staining

Specimens of human lung carcinomas were obtained from the Pathology Department of the Medical College of Shantou University (Shantou, China). Immunohistochemical staining was performed as previously described (12). The slides were incubated overnight at 4°C with rat anti-human NGAL monoclonal antibody (R&D Systems, Minneapolis, MN, USA). Following rinsing with PBS, the slides were incubated for 20 min at room temperature with peroxidase-conjugated goat anti-rat antibody (Jackson Immunoresearch Laboratories, West Grove, PA, USA). Subsequently, the slides were stained with 0.003% 3, 3′-diaminobenzidine tetrahydrochloride and 0.005% hydrogen peroxide in 0.05 M Tris HCl (pH 7.2), counterstained, dehydrated and mounted. Blank controls were prepared by substituting PBS for the primary antibody. NGAL-positive samples were defined as those showing brown staining in the cytoplasm.

RT-PCR

Total RNA was extracted using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. Reverse transcription was performed with 1 μg of total RNA using Reverse Transcription system (Promega, Madison, WI, USA) according to the manufacturer’s recommendations. PCR analyses were then performed and the primer sequences were as follows: 5′-GGATCCGTCAGGACTCCACCTCAGA-3′ (forward primer) and 5′-GGTACCTCAGCCGTCGATACA CTG-3′ (reverse primer) for NGAL and 5′-GAAGGT GAAGGTCGGAGTC-3′ (forward primer) and 5′-GAAGAT GGTGATGGGATTTC-3′ (reverse primer) for GAPDH.

Immunofluorescent staining

The cells were seeded on cover-slips and incubated for 24 h. After washing with PBS, the cells were fixed with 100% methanol at −20°C for 15 min and then treated with 0.2% Triton X-100 in PBS for 10 min. The cells were subsequently incubated with a blocking solution (10% normal goat serum in PBS) for 20 min and incubated with primary antibody overnight at 4°C. The cells were washed and incubated with fluorescein-conjugated goat anti-rat IgG (Zymed, Carlsbad, CA, USA) for 30 min at 37°C. Finally, the cells were washed and mounted in glycerol and examined using a fluorescence microscope.

Construction of plasmids

The construction of the original luciferase expression vector pGLB (Promega), containing the human NGAL promoter region, has been described previously (10). To further study the putative cis-acting elements located at −152 to −141, we constructed mutational plasmids by PCR amplification with mutated primers. The −152 deletion plasmid was generated by PCR amplification with the following primers: 5′-TACTCGAGCTGTCTTGCC CAATCCTGAC-3′, containing a C/EBPs binding site (underlined) and 5′-ATAGATCTGAGACCTAGGGGCATGA TTT-3′. Then a series of mutants with a −152 deletion mutation were generated by PCR amplification. The mutations of the C/EBPs binding site were generated using the following primers: i) 147m, 5′-TACTCGAGCTGTCAACCCGTT TCCTGAC-3′; ii) 144m, 5′-TACTCGAGCTGTCTTGGA TGGTCCTGAC-3′; iii) 141m, 5′-TACTCGAGCTGTCTT GCCCGATCCT GAC-3′; iv) CEBP (conc), 5′-TACTCGAGCTGTCTTGCG CAATCCTGAC-3′. The DNA fragments containing the mutated region were inserted into the XhoI and BglII sites of the pGLB vector. Relevant regions of the final constructs were confirmed by sequencing.

Transient transfection and luciferase reporter gene assay

The cells in 96-well plates were transfected using Superfect transfection reagent (Qiagen, Hilden, Germany) with pGLB promoter constructs. To compensate for differences in transfection efficiency, the cells were co-transfected with the internal control plasmid pRL-TK containing Renilla luciferase (Promega). Following transfection, the cells were cultured at 37°C in a humidified atmosphere with 5% CO2 for 48 h. Subsequently, the cells were harvested and the lysates were assayed for luciferase activity using the Dual Luciferase Reporter Assay system (Promega). Luciferase activity data are expressed as the mean ± SE of at least three independent experiments.

Western blot analysis

Nuclear extracts from 95D and A549 cells were prepared using the method described by Sambrook and Russell (13). The protein concentration was estimated using the Bradford method. Equal amounts of nuclear extracts (100 μg) were separated by SDS-PAGE and transferred to the PVDF membrane (Millipore, Billerica, MA, USA). The membrane was blocked in 5% skimmed milk in PBST (phosphate-buffered saline, containing 0.1% Tween 20) for 1 h at room temperature followed by the addition of the primary antibody for 2 h at room temperature. The membrane was subsequently incubated with secondary antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) for 2 h at room temperature. The protein-antibody complexes were then identified by western blot luminol reagent (Santa Cruz Biotechnology, Inc.).

Electrophoretic mobility shift assay (EMSA) and supershift analysis

The sequences of the oligonucleotides used in the EMSA are listed in Table I and the mutated bases are presented in italics. Complementary oligonucleotides were annealed and labeled with DIG-ddUTP by terminal transferase using DIG Gel Shift kit (Roche Diagnostics, Mannheim, Germany). Nuclear extracts were incubated with labeled probes for 30 min at room temperature in a 20 μl reaction mixture containing 20 mM Hepes (pH 7.9), 1 mM EDTA (pH 8.0), 1 mM dithiotreitol, 10 mM (NH4)2SO4, 0.2% Tween-20 (w/v), 30 mM KCl, 1 μg poly-[d(I-C)] and 0.1 μg poly L-lysine. Then, complexes were resolved on 6% nondenatured polyacrylamide gel (acrylamide/bis-acrylamide ratio of 29:1) in 0.5X TBE at 80 V for 100 min at 4°C. The gels were transferred to a positively-charged nylon membrane. Alkaline phosphatase-conjugated anti-digoxigenin antibody and the chemiluminescent substrate CSPD were used to detect digoxigenin according to the manufacturer’s instructions (Dig Gel Shift kit, Roche Diagnostics) and immunoreactive bands were photographed and analyzed by FluorChemTMIS-8900 (Alpha Innotech, Santa Clara, CA, USA). For supershift analysis, 2 μl anti-C/EBPβ antibodies (Santa Cruz Biotechnology, Inc.) were incubated with nuclear extracts for 20 min prior to the addition of labeled probes. In the competition experiments, different folds molar excess of unlabeled oligonucleotide was added to the binding reactions.

Table I

Oligonucleotides used in EMSA analysis.

Table I

Oligonucleotides used in EMSA analysis.

NameSequence (5′-3′)
−152/−114 CTGTCTTGCCCAATCCTGACCAGGTGCAGAAATCTTGCCGGCAAGATTTCTGCACCTGGTCAGGATTGGGCAAGACAG
−147/−140m CTGTCGACTAGTCTCCTGACCAGGTGCAGAAATCTTGCCGGCAAGATTTCTGCACCTGGTCAGGAGACTAGTCGACAG
−145/−143m CTGTCTTTAACAATCCTGACCAGGTGCAGAAATCTTGCCGGCAAGATTTCTGCACCTGGTCAGGATTGTTAAAGACAG

[i] Mutated bases indicated in italics. EMSA, electrophoretic mobility shift assay.

Results

Expression of NGAL in human lung carcinoma tissues

Previous studies have reported that in lung cancer tissues, NGAL showed moderate to strong positive expression in adenocarcinomas; whilst staining for the protein was negative or weakly positive in squamous cell or large cell carcinomas (14). To further evaluate the expression of NGAL in lung carcinomas, 23 tissue samples were examined by immunohistochemical staining. The samples consisted of a spectrum of tissues ranging from low- to high-grade human lung squamous carcinomas, adenocarcinomas, adenosquamous carcinomas and bronchial alveolar cell carcinomas. The results showed that 82.61% (19/23) of the cases were positive for NGAL staining. All the positive cases revealed a diffuse cytoplasmic distribution of NGAL in the cancer cells (Fig. 1).

Figure 1

Immunohistochemistry staining for NGAL expression in lung carcinoma tissues. (A) (x100) and (B) (x200), lung adenocarcinomas; (C) (x100) and (D) (x200), lung squamous carcinomas; (E) (x100), lung adenosquamous carcinomas; (F) (x100), blank control. NGAL, neutrophil gelatinase-associated lipocalin.

Expression of NGAL in 95D and A549 cells

The mRNA level of NGAL was analyzed by RT-PCR. A band of ∼537 bp was detected in 95D and A549 cells, suggesting that NGAL was expressed in these cells (Fig. 2A). The distribution of NGAL in lung carcinoma cells was determined by means of immunofluorescent staining. NGAL was localized to the cytoplasm of these cells, showing a diffuse to granular pattern (Fig. 2B).

Figure 2

Expression of NGAL in 95D and A549 cells. (A) RT-PCR analysis for NGAL expression. Detection of GAPDH was used as a control. (B) Distribution of NGAL expression was determined by immunofluorescent staining. NGAL was observed in the cytoplasm of the 95D cells (x200) and A549 cells (x200).

Region −152 to −141 was the core promoter of NGAL

To determine the core promoter of human NGAL and to identify regulatory elements within the promoter, a 1515-bp fragment (−1431 to +84) of the NGAL promoter region was cloned and a series of deletion and mutation constructs were obtained. These constructs were then co-transfected with the pRL-TK plasmid into 95D and A549 cells and subjected to the luciferase reporter assay. It was shown that, when truncated from −152 to −140, the promoter activity of NGAL was decreased by ∼70% (Fig. 3A), indicating that the −152 to −141 region was essential for the basal activity of the NGAL promoter and this region was identified as the core promoter of NGAL. We analyzed the sequence using TESS software (http://www.cbil.upenn.edu/cgi-bin/tess) and found several putative binding sites of transcription factors, including C/EBPs, in this region. We then generated a series of mutants with a −152 deletion plasmid by PCR amplification with the mutated primers (see Materials and methods). The relative activity of the −152 mutations, including 147m, 144m and 141m, were reduced by ∼50% compared with the −152 deletion plasmid, and the activity of the CEBP(conc) was slightly increased, suggesting that C/EBPs binding sites were responsible for promoter activity (Fig. 3B).

Figure 3

The basal activity of the NGAL promoter in 95D and A549 cells. (A) Relative luciferase activities of various 5′ deletion constructs of the NGAL promoter ranging from −1431 to −10. Luciferase activity was normalized to the Renilla luciferase activity and then shown relative to that of −1431 deletion construct. Background activity was determined by including the reporter plasmid pGL3-Basic with no promoter insert (Basic). (B) Relative luciferase activities of the 152 mutants. Luciferase activity was normalized to the Renilla luciferase activity and then shown relative to that of the −152 deletion construct. The data were obtained from a single experiment repeated two more times with similar results. Each value is presented as mean ± SE of at least three independent experiments. (A and B) Schematic representation of the NGAL promoter constructs used for transient transfection is shown in the left panel, with the relative luciferase activity from each construct in the right panel.

C/EBPβ was probably the transcription factor regulating NGAL basal expression

According to the results of the luciferase reporter assay, we presumed that C/EBPs regulated the basal expression of NGAL. Nuclear extracts from 95D and A549 cells were collected and the levels of expression of C/EBPs were analyzed using western blotting. The results showed that C/EBPα and γ were undetected (data not shown), but C/EBPβ could be detected in different isoforms (42, 35 and 20 kDa; Fig. 4A). In order to further confirm that C/EBPβ played a critical role in regulating the activity of the NGAL promoter, we synthesized oligonucleotide probes corresponding to C/EBPs binding sites, and simultaneously, oligonucleotide probes with a mutated C/EBPs binding site served as non-specific competitors (Table I). We then examined nuclear extracts from 95D and A549 cells by EMSA, using the C/EBPs site of the NGAL promoter (−152/−114) as a probe. Similar DNA-protein complexes were found in the two types of cells (Fig. 4B and C, lane 1). To determine the specificity of these binding complexes, we added 125- to 725-fold molar excess of unlabeled specific competitor to the binding reaction. With the increasing molarity of unlabeled oligonucleotide, the complex disappeared gradually (Fig. 4B and C, lanes 5–7). However, when the unlabeled mutated oligonucleotide was added to the reaction, the complex remained prominent [Fig. 4B and C, lane 3 (−147/−140m): TTGCCCAA→GACTAGTC; lane 4 (−145/−143m): GCC→TAA]. In supershift analysis, anti-C/EBPβ antidody led to the disappearance of the DNA-protein complex and later a migrating band appeared (Fig. 4B and C, lane 2). These results suggest that C/EBPβ binds to the core promoter of NGAL in lung carcinoma cells.

Figure 4

C/EBPβ was present in 95D and A549 cells and bound to the NGAL promoter. (A) Nuclear extracts were collected from 95D and A549 cells and tested for C/EBPs by western blot analysis; (B and C) EMSA analysis for the binding of C/EBPβ to the core promoter of NGAL in (B) 95D and (C) A549 cells. Lane 1, EMSA was performed using Dig-labeled C/EBP sequence of the NGAL promoter (−152/−114) and nuclear extracts; lane 2, supershift experiment; lanes 5–7, a competition EMSA was carried out to determine the specificity of nuclear extracts binding to the C/EBP binding sites. The binding reaction contained a 125-, 375- and 725-fold molar excess of specific competitors (unlabeled −152/−114), respectively. A 125-fold molar excess of two non-specific competitors with two different mutated C/EBP sites (−147/−140m and −145/−143m) were also used (lanes 3–4). EMSA, electrophoretic mobility shift assay; NGAL, neutrophil gelatinase-associated lipocalin.

Discussion

NGAL has been identified in a variety of normal and pathological human tissues (14). The expression of NGAL has been demonstrated in several types of cancer, including carcinoma of the colon, lung, pancreas, breast and esophagus (2). NGAL also promotes breast tumor growth by enhancing MMP-9 activity and facilitating tumor progression. The detection of urinary MMP-9 and NGAL complexes in breast cancer patients may serve as new independent predictors of disease status (4). Also, our previous studies have indicated that NGAL was overexpressed in esophageal squamous cell carcinoma and gastric carcinoma, and that altered NGAL expression may play a significant role in the transformation and progression of esophageal squamous cell carcinoma (10,11,15). In the current study, we further showed that NGAL was expressed in lung squamous carcinoma and adenocarcinoma tissues.

The significant correlation between NGAL and tumor progression led to studies concerning the expression regulation mechanisms of NGAL. Increasing evidence suggests that certain transcription factors, including IκB-ζ, NF-κB, C/EBPα, C/EBPβ and C/EBPε, play dominant roles in the induction of NGAL expression within tumor cells (5). Our previous study in esophageal squamous cell carcinoma cells indicated that there was a TPA response element located at the −152 and −60 regions of the NGAL promoter which mediated TPA stimulation (10). More recently, in gastric cancer, we found that the binding of C/EBPβ to the TRE of the NGAL promoter mediates its TPA-induced overexpression (11). In lung cancer, it has been reported that NGAL was induced by IL-1β through the NF-κB and IκB-ζ pathway in A549 cells (6,8). However, the mechanisms for NGAL basal expression have not been thoroughly investigated. In the current study, we aimed to find the cis-acting elements which regulate NGAL basal expression. We identified the core promoter region of NGAL, which contained C/EBPs binding sites located at −152 to −141 and showed that the C/EBPs binding sites were crucial for the basal expression of NGAL.

C/EBPβ belongs to the C/EBP family of basic region leucine zipper (bZIP) transcription factors that consists of six members: C/EBPα, C/EBPβ, C/EBPγ, C/EBPδ, C/EBPε and C/EBPζ. With the exception of C/EBPζ, which lacks a canonical basic region, each protein contains a similar basic region and leucine zipper sequences at its C-terminus, which mediate DNA binding and dimerization, respectively (16). C/EBPs form both homo- and heterodimers and may interact with other non-bZIP transcription factors (17). C/EBPs play significant roles in a number of cellular processes, including metabolism and inflammatory response, and are specifically involved in the differentiation of adipocytes, myeloid cells, hepatocytes, mammary epithelial cells, intestinal epithelial cells, keratinocytes and ovarian luteal cells (18). Therefore, C/EBPs lead to not only granulocytic differentiation, but also the expression of granulocyte-specific genes, including the expression of NGAL, which is stored in specific granules of the human neutrophil (1,19). In the present study, we demonstrated that C/EBPβ exists as different isoforms in 95D and A549 cells. C/EBPβ binds to the C/EBPs binding site of the NGAL promoter and regulates the basal expression of NGAL. C/EBPβ has been shown to function as a pro-oncogenic transcription factor that promotes the proliferation and/or survival of certain tumor cells, and its levels were increased in a number of tumors, including lung cancer (20). This may be the reason for NGAL overexpression in these tumors. Moreover, NGAL has been implicated in epithelial cell differentiation (21). We presume that C/EBPβ promotes NGAL expression in the cell differentiation process.

In summary, we identified the core promoter of NGAL in lung carcinoma cells and revealed the regulation mechanism of NGAL basal expression by the binding of transcriptional factor C/EBPβ to this core promoter.

Acknowledgements

This study was supported by grants from the National High Technology Research and Development Program of China (No. 2006AA02A403), the Natural Science Foundation of China-Guangdong Joint Fund (No. U0932001) and the National Natural Science Foundation of China (No. 30772485; No. 31000347).

References

1. 

L KjeldsenAH JohnsenH SengeløvN BorregaardIsolation and primary structure of NGAL, a novel protein associated with human neutrophil gelatinaseJ Biol Chem268104251043219937683678

2. 

D BolignanoV DonatoA LacquanitiMR FazioC BonoG CoppolinoM BuemiNeutrophil gelatinase-associated lipocalin (NGAL) in human neoplasias: a new protein enters the sceneCancer Lett2881016201010.1016/j.canlet.2009.05.02719540040

3. 

K MoriHT LeeD RapoportIR DrexlerK FosterJ YangKM Schmidt-OttX ChenJY LiS WeissEndocytic delivery of lipocalin-siderophore-iron complex rescues the kidney from ischemia-reperfusion injuryJ Clin Invest115610621200510.1172/JCI2305615711640

4. 

CA FernándezL YanG LouisJ YangJL KutokMA MosesThe matrix metalloproteinase-9/neutrophil gelatinase-associated lipocalin complex plays a role in breast tumor growth and is present in the urine of breast cancer patientsClin Cancer Res11539053952005

5. 

JR KarlsenN BorregaardJB CowlandInduction of neutrophil gelatinase-associated lipocalin expression by co-stimulation with interleukin-17 and tumor necrosis factor-alpha is controlled by IkappaB-zeta but neither by C/EBP-beta nor C/EBP-deltaJ Biol Chem2851408814100201010.1074/jbc.M109.017129

6. 

JB CowlandT MutaN BorregaardIL-1beta-specific up-regulation of neutrophil gelatinase-associated lipocalin is controlled by IkappaB-zetaJ Immunol17655595566200610.4049/jimmunol.176.9.555916622025

7. 

A IannettiF PacificoR AcquavivaA LavorgnaE CrescenziC VascottoG TellAM SalzanoA ScaloniE VuttarielloThe neutrophil gelatinase-associated lipocalin (NGAL), a NF-kappaB-regulated gene, is a survival factor for thyroid neoplastic cellsProc Natl Acad Sci USA1051405814063200810.1073/pnas.071084610518768801

8. 

JB CowlandOE SørensenM SehestedN BorregaardNeutrophil gelatinase-associated lipocalin is up-regulated in human epithelial cells by IL-1 beta, but not by TNF-alphaJ Immunol17166306639200310.4049/jimmunol.171.12.663014662866

9. 

AF GombartSH KwokKL AndersonY YamaguchiBE TorbettHP KoefflerRegulation of neutrophil and eosinophil secondary granule gene expression by transcription factors C/EBP epsilon and PU.1Blood10132653273200310.1182/blood-2002-04-103912515729

10. 

LY XuEM LiYD NiuWJ CaiHM YuanJX ChangZY ShenY ZengThere are TPA response elements in −152∼-60 position of NGAL gene 5′ flanking region in the esophageal cancer cells EC109Progress in Biochem and Biophys331401482006(In Chinese)

11. 

ZP DuHM YuanBL WuJX ChangZ LvJ ShenJY WuHB ChenEM LiLY XuNeutrophil gelatinase-associated lipocalin in gastric carcinoma cells and its induction by TPA are controlled by C/EBPβBiochem Cell Biol89314324201121612443

12. 

ZP DuZ LvBL WuZY WuJH ShenJY WuXE XuQ HuangJ ShenHB ChenNeutrophil gelatinase-associated lipocalin and its receptor: independent prognostic factors of esophageal squamous cell carcinomaJ Clin Pathol646974201110.1136/jcp.2010.08390721109701

13. 

J SambrookDW RussellMolecular Cloning: A Laboratory Manual3rd editionCold Spring Harbor Laboratory PressNew York2001

14. 

A FriedlSP StoeszP BuckleyMN GouldNeutrophil gelatinase-associated lipocalin in normal and neoplastic human tissues. Cell type-specific pattern of expressionHistochem J31433441199910.1023/A:100370880893410475571

15. 

H ZhangL XuD XiaoJ XieH ZengZ WangX ZhangY NiuZ ShenJ ShenUpregulation of neutrophil gelatinase-associated lipocalin in esophageal squamous cell carcinoma: significant correlation with cell differentiation and tumour invasionJ Clin Pathol60555561200710.1136/jcp.2006.039297

16. 

MP HollandSP BlissKA BerghornMS RobersonA role for CCAAT/enhancer-binding protein beta in the basal regulation of the distal-less 3 gene promoter in placental cellsEndocrinology14510961105200410.1210/en.2003-077714670999

17. 

YH LeeSC WilliamsM BaerE SterneckFJ GonzalezPF JohnsonThe ability of C/EBP beta but not C/EBP alpha to synergize with an Sp1 protein is specified by the leucine zipper and activation domainMol Cell Biol172038204719979121452

18. 

J Lekstrom-HimesKG XanthopoulosBiological role of the CCAAT/enhancer-binding protein family of transcription factorsJ Biol Chem2732854528548199910.1074/jbc.273.44.285459786841

19. 

A NumataK ShimodaK KamezakiT HaroH KakumitsuK ShideK KatoT MiyamotoY YamashitaY OshimaSignal transducers and activators of transcription 3 augments the transcriptional activity of CCAAT/enhancer-binding protein alpha in granulocyte colony-stimulating factor signaling pathwayJ Biol Chem2801262112629200510.1074/jbc.M408442200

20. 

PF JohnsonMolecular stop signs: regulation of cell-cycle arrest by C/EBP transcription factorsJ Cell Sci11825452555200510.1242/jcs.0245915944395

21. 

L MallbrisKP O’BrienA HulthénB SandstedtJB CowlandN BorregaardM Ståhle-BäckdahlNeutrophil gelatinase-associated lipocalin is a marker for dysregulated keratinocyte differentiation in human skinExp Dermatol11584591200210.1034/j.1600-0625.2002.110611.x12473066

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhang P, Chang J, Xie J, Yuan H, Du Z, Zhang F, Lü Z, Xu L and Li E: Regulation of neutrophil gelatinase-associated lipocalin expression by C/EBPβ in lung carcinoma cells. Oncol Lett 4: 919-924, 2012.
APA
Zhang, P., Chang, J., Xie, J., Yuan, H., Du, Z., Zhang, F. ... Li, E. (2012). Regulation of neutrophil gelatinase-associated lipocalin expression by C/EBPβ in lung carcinoma cells. Oncology Letters, 4, 919-924. https://doi.org/10.3892/ol.2012.859
MLA
Zhang, P., Chang, J., Xie, J., Yuan, H., Du, Z., Zhang, F., Lü, Z., Xu, L., Li, E."Regulation of neutrophil gelatinase-associated lipocalin expression by C/EBPβ in lung carcinoma cells". Oncology Letters 4.5 (2012): 919-924.
Chicago
Zhang, P., Chang, J., Xie, J., Yuan, H., Du, Z., Zhang, F., Lü, Z., Xu, L., Li, E."Regulation of neutrophil gelatinase-associated lipocalin expression by C/EBPβ in lung carcinoma cells". Oncology Letters 4, no. 5 (2012): 919-924. https://doi.org/10.3892/ol.2012.859
Copy and paste a formatted citation
x
Spandidos Publications style
Zhang P, Chang J, Xie J, Yuan H, Du Z, Zhang F, Lü Z, Xu L and Li E: Regulation of neutrophil gelatinase-associated lipocalin expression by C/EBPβ in lung carcinoma cells. Oncol Lett 4: 919-924, 2012.
APA
Zhang, P., Chang, J., Xie, J., Yuan, H., Du, Z., Zhang, F. ... Li, E. (2012). Regulation of neutrophil gelatinase-associated lipocalin expression by C/EBPβ in lung carcinoma cells. Oncology Letters, 4, 919-924. https://doi.org/10.3892/ol.2012.859
MLA
Zhang, P., Chang, J., Xie, J., Yuan, H., Du, Z., Zhang, F., Lü, Z., Xu, L., Li, E."Regulation of neutrophil gelatinase-associated lipocalin expression by C/EBPβ in lung carcinoma cells". Oncology Letters 4.5 (2012): 919-924.
Chicago
Zhang, P., Chang, J., Xie, J., Yuan, H., Du, Z., Zhang, F., Lü, Z., Xu, L., Li, E."Regulation of neutrophil gelatinase-associated lipocalin expression by C/EBPβ in lung carcinoma cells". Oncology Letters 4, no. 5 (2012): 919-924. https://doi.org/10.3892/ol.2012.859
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team