Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
January-2015 Volume 9 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2015 Volume 9 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Suppression of wingless‑type MMTV integration site family, member 1 expression by small interfering RNA inhibits U251 glioma cell growth in vitro

  • Authors:
    • Lun Dong
    • Xiao‑Chun Duan
    • Chong‑Xu Han
    • Hengzhu Zhang
    • Yongkang Wu
  • View Affiliations / Copyright

    Affiliations: Department of Neurosurgery, Clinical Medical College of Yangzhou University, Yangzhou, Jiangsu 225001, P.R. China, Central Laboratory, Clinical Medical College of Yangzhou University, Yangzhou, Jiangsu 225001, P.R. China
  • Pages: 81-85
    |
    Published online on: October 30, 2014
       https://doi.org/10.3892/ol.2014.2647
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

A Wingless‑type MMTV integration site family, member 1 (Wnt‑1) RNA interference expression vector was constructed during the present study, which was used to transfect the glioma U251 cell line and investigate its effect on glioma. Two 21‑base oligonucleotides complementary to the coding sequence that was flanking the loop sequence were designed to form a DNA hairpin template for the target small interfering RNA (siRNA). The siRNA templates were cloned into the siRNA expression vector, pGPU6/green fluorescent protein (GFP)/Neo and the sequence was confirmed by DNA sequencing. The pGPU6/GFP/Neo‑short hairpin RNA (shRNA)‑Wnt‑1 vector was subsequently transfected into U251 cells, and reverse transcription polymerase chain reaction and western blot analysis were used to evaluate the Wnt‑1 gene silencing effect on U251 cell growth by MTT assay and flow cytometry. The Wnt‑1 protein expression was significantly reduced following transfection with the recombinant plasmid, as determined by western blot analysis of the transfected U251 cells. This transfection exhibited a significantly higher death rate, as shown by MTT. Thus, the present study demonstrated that the pGPU6/GFP/Neo‑shRNA‑Wnt‑1 vector inhibited Wnt‑1 protein expression. However, further investigations regarding the Wnt signaling pathway in glioma pathogenesis are required.

Introduction

Wingless-type MMTV integration site, member 1 (Wnt-1), the first identified member of the Int-1 family, was named by Nusse in 1991 (1). The first Int-1 was termed Wnt-1, as Int-1 and the Wnt gene family were homologous. The Wnt-1 gene consists of 805 adenines, 1,523 cytosines, 1,320 guanines and 874 thymines. Current studies have proposed that the Wnt-1 protein controls cell growth, proliferation, secretion of key signaling molecules, mediates information flow between cells and stem cells, and is important in neural development. Wnt-1 gene expression has been found to closely correlate with the development of numerous types of tumor (1–7). You et al (8), as well as other studies, have also indicated that Wnt-1-target genes may be potential cancer therapy targets (9,10). Preliminary experiments in the present study found that the Wnt-1 protein expression in human glioma was significantly higher than in normal brain tissue, and is closely associated with the degree of malignancy. Therefore, the aim of the current study was to further investigate the role of Wnt-1 in glioma by RNA interference (RNAi) targeting.

Materials and methods

Materials

U251 glioma cells were purchased from the Cell Bank of the Shanghai Institute of Biochemistry and Cell Biology (Shanghai, China). The vectors used were as follows: pGPU6/green fluorescent protein (GFP)/Neo-short hairpin RNA (shRNA)-GAPDH served as a positive control and pGPU6/GFP/Neo-shNC served as a negative control. The pGPU6/GFP/Neo expression plasmid was purchased from Wuhan Genesil Biotechnology Co., Ltd (Wuhan, China). Transfections were performed using liposome LipofectamineTM 2000 reagent and TRIzol that were purchased from Life Technologies (Foster City, CA, USA). The Wnt-1 primary antibody was obtained from Neomarkers Inc. (Fremont, CA, USA), while the horseradish peroxidase-conjugated monoclonal goat anti-rabbit secondary antibody was purchased from ZhongShan Bio-Tech Co., Ltd. (Guangzhou, China). High glucose Dulbecco’s Modified Eagle’s Medium (DMEM) was purchased from Life Technologies and fetal calf serum was purchased from Hangzhou Sijiqing Biological Engineering Materials Co., Ltd. (Hangzhou, China). The restriction enzymes (BamHI, PstI and BbsI), DNA markers, agarose gel DNA purification kit version 2.0, T4 DNA ligase Taq DNA polymerase and polymerase chain reaction (PCR) primers were purchased from Takara Bio, Inc. (Shiga, Japan). Little mention plasmid kit, and propidium iodide (PI) and MTT reagents were purchased from Beyotime Institute of Biotechnology (Nantong, China). M-MLV reverse transcriptase was purchased from Promega Corporation (Madison, WI, USA).

Small interfering RNA (siRNA) target sequence design

The full-length Wnt-1 gene sequence was retrieved from GenBank (NM_005430) and the siRNA design principles were obtained from Takara Biotechnology special siRNA design software [Takara Biotechnology (Dalian) Co., Ltd., Dalian, China) to select a 21-nt siRNA target template. The shRNA selected TTCAAGAGA loop structure was maintained to avoid formation of a termination signal and the shRNA transcription termination sequence was composed of a T6 structure. CACC was added to the sense strand of the template to form a BbsI complementary sticky end and antisense strand template. GATC was added to the 5′ end and was digested with BamHI to generate complementary sticky ends. When the first siRNA base was not a G, then an additional CACC was added after the G. The following primers were used: Sense, 5′-ACGGCGTTTATC TTCGCTATC-3′ and antisense, 3′-TGCCGCAAATAGAAG CGATAG-5′ for Wnt-1. The following hairpin single-stranded oligonucleotide sequence was then designed and synthesized: Sense, 5′-CACCGACGG CGTTTATCTTCGCTATCTTCAAGAGAGATAGCGAAG ATAAACGCCGTTTTTTTG-3′ and antisense, 5′-GATCCA AAAAAACGGCGTTTATCTTCGCTATCTCTCTTGAAG ATAGCGAAGATAAACGCCGTC-3′ for Wnt-1. The oligonucleotides were synthesized by the Shanghai Jima Company (Shanghai, China).

Construction of Wnt-1 targeting pGPU6/GFP/Neo-Wnt-1 vector for RNAi

Synthetic single-stranded oligonucleotides were dissolved in Tris-EDTA buffer (pH 8.0; 10mM Tris-HCl, 1 mM EDTA), diluted to 100 μmol/l and annealed to form an shRNA template (5 μl justice chain, 5 μl antisense strand, 5 μl annealing buffer and 35 μl double distilled (dd) H2O to a 50-μl total volume). The shRNA template was annealed on a PCR instrument (ABI7900HT, Invitrogen Applied Biosystems, Foster City, CA, USA) according to the following procedure: 95°C for 5 min, 85°C for 5 min, 75°C for 5 min and 70°C for 5 min. The template was stored at 4°C to generate a 10-μM concentration of shRNA. The template solution was diluted 500-fold to a final concentration of 20 nM for ligation. Restriction digestions were performed with 2μg pGPU6/GFP/Neo, according to the following conditions: 5 μl 10X buffer G (Shanghai PureOne Biotechnology Co., Shanghai, China), 2 μl BbsI enzyme, 2 μl BamHI enzyme, 2 μg pGPU6/GFP/Neo and ddH2O to a total volume of 50 μl. Following digestion at 37°C for 1 h, the product concentrations were examined by agarose gel electrophoresis, using the agarose gel DNA purification kit version 2.0 and diluted to 50 ng/μl. Ligations were performed in 2 μl 10X T4 ligation buffer, 1 μl pGPU6/GFP/Neo (BbsI + BamHI), 1 μl shRNA template, 0.5 μl T4 DNA ligase (5 Weiss U/μl) and 30 μl ddH2O to a total volume of 20 μl at room temperature for 2 h.

Plasmid identification

Competent Escherichia coli DH5α cells were grown on lysis buffer medium plates containing kanamycin (Beyotime Institute of Biotechnology) at 37°C for 18 h. Six colonies were selected and used to inoculate the kanamycin-containing LB liquid medium (50 μg/ml), which was agitated using a blender (Beijing Tianshi Tianli Medical Device Technology Development Center, Beijing, China) overnight. The plasmids were extracted by alkaline lysis and digested sequentially with BamHI and PstI. The positive recombinant vectors were digested with BamHI, but not PstI. Two clones were selected for each vector and sequenced by Invitrogen Applied Biosystems (Shanghai, China).

Cell culture

The U251 cell lines were grown at 37°C in a 5% CO2 humidified atmosphere with high glucose DMEM medium (containing 10% fetal bovine serum (FBS), 100 U/l penicillin, 100 mg/l streptomycin and 10% fetal calf serum).

Plasmid transfection

Transfected cells (3×105) were grown to 70–80% confluence for two days, and subsequently inoculated in six-well plates (35 mm), with 2 ml 10% FBS (Chongqing Manuik Technology Co., Ltd., Chongqing, China) per well. Prior to transfection, the liposome/DNA was incubated for 10 min, and replaced with 1 ml fresh serum-free 10% FBS (Chongqing Manuik Technology Co., Ltd.). Based on the pretest results, the cells were cultured with LipofectamineTM 2000 reagent (Life Technologies) and plasmid at a ratio of 6 μl:2 μg, respectively, according to the manufacturer’s instructions, and incubated at 37°C in a 5% CO2 humidified atmosphere. After 5 h, 2–3 ml fresh growth medium was added. The cells were collected the next day and fresh 10% fetal calf serum was added. The cells were then cultured for 48 h to observe any GFP expression. The cells were divided into the following four transfection groups: pGPU6/GFP/Neo-Wnt-1, pGPU6/GFP/Neo-shRNA-GAPDH (positive control), pGPU6/GFP/Neo-shNC (negative control) and a phosphate-buffered saline (PBS) control. GFP expression was used to evaluate the transfection efficiency 48 h following transfection and was measured by 488-nm excitation via fluorescence microscopy (Olympus BX51; Olympus America Inc., Center Valley, PA, USA).

Reverse transcription (RT)-PCR detection of Wnt-1 mRNA expression level

The primer design software Premier 5.0 (Premier Biosoft, Palo Alto, CA, USA) was used to design the following primers: Sense, 5′-CTGCCTCTCTTCTTCCCCTT-3′ and antisense, 5′-TCACAGCTGTTCAATGGCTC-3′ for Wnt-1 (251-bp product); and sense, 5′-CCATGT TCGTCATGGGTGTGAACCA-3′ and antisense, 5′-GCCAGT AGAGGCAGGGATGATGTTC-3′ for the internal reference, GAPDH (246-bp product). Preamplification of GAPDH was used to assess the efficacy of RT, with a semi-quantitative PCR reaction run in parallel, which served as an internal reference. TRIzol was used to extract the total cellular RNA and first-strand cDNA synthesis was performed according to the manufacturer’s instructions. The total RNA (2 μg) was used for RT, in addition, 0.1 μg oligo-dt, denatured at 65°C for 10 min and placed immediately in an ice bath for 5 min, was added to 5 μl 5X PCR buffer [Takara Biotechnology (Dalian) Co., Ltd.], 1 μl dNTP (10 mM each), 100 units RNAsin, 10 units M-MLV reverse transcriptase and water, which was added to produce a total volume of 25 μl. The samples were incubated at 42°C for 60 min following a 5-min 95°C denaturalization step, subsequently placed in an ice bath for 3 min and stored at −20°C to conserve the RNA template for the PCR. The RNA template was then converted into cDNA for use in the RT-PCR, which was performed in a total reaction volume of 50 μl, containing 5 μl 10X buffer, 4 μl MgCl2 (25 mM), 1 μl dNTP (10 mM each), 0.5 μl primer (50 pmol/μl), 0.5 μl downstream primer (50 pmol/μl), 0.3 μl Taq enzyme (5 U/μl), 2 μl cDNA template and 30–50 μl paraffin oil. PCR reactions were performed as follows: 95°C denaturation for 5 min; 30 cycles of 94°C for 30 sec, 50°C annealing for 30 sec and 72°C for 1 min; with a final step at 72°C for 5 min. The products were subjected to 2% agarose electrophoresis and ethidium bromide staining. Images were captured using the IBM 586 computer-controlled Gel Doc 1000 imaging system (Bio-Rad, Hercules, CA, USA).

Western blot analysis

Western blot analysis was used to detect Wnt-1 protein expression prior to and following U251 transfection. Total cellular protein was determined by SDS-PAGE gel electrophoresis. The proteins were transferred to nitrocellulose membranes (Whatman Inc., London, UK) for protein immunoassays and the primary monoclonal mouse anti-human proto-onocogene Wnt-1 antibody (Boster Biotechnology Co., Ltd., Wuhan, China) was used at a dilution of 1:100, with the secondary monoclonal rabbit anti-mouse antibody (Boster Biotechnology Co., Ltd.) at 1:500.

MTT cell proliferation assay

U251-transfected cells were subjected to trypsin digestion following 24 h. Single cell suspensions were prepared in culture medium containing 10% fetal calf serum, transferred into 96-well plates at a final volume of 200 μl and grown at 37°C in a 5% CO2 humidified atmosphere for 48 h. Each MTT well contained a 20-μl MTT solution (5 mg/ml), which was incubated for 4 h. At culture termination, the medium was carefully aspirated and the supernatant discarded. Each well contained 150 μl dimethyl sulfoxide and was agitated for 10 min to fully dissolve the crystals. ELISA was used to record the absorbance at 490 nm and the cellular proliferation rate was calculated as follows: Cellular proliferation rate (%) = (experimental group/absorbance value of blank control group) × 100.

Flow cytometry (FCM) detection of cell cycle

Trypsinized cells were transfected with plasmids 48 h following digestion. The cell suspension was then centrifuged in a clean centrifuge tube using a high speed centrifuge (Beijing Era Beili Centrifuge Co., Ltd., Beijing, China) at 507 xg for 5 min. The culture medium was discarded and washed three times with cold PBS. The cells were resuspended by adding 75% alcohol, fixed for 30 min in ethanol and centrifuged at 1,917 xg for 5 min, followed by washing three times with PBS. The cells were then resuspended in 100 μl PBS and 2.5 μl RNase (10 mg/ml), followed by 25 μl PI pyridine (10 mg/ml) and staining for 30 min. The cells were examined using a FACSAria flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA) to determine the G1/G0, G2/M and S phase fractions.

Statistical analysis

SPSS 10.0 (SPSS Inc., Chicago, IL, USA) was used for analysis of variance. Data are presented as the mean ± standard deviation. The means between two groups were compared using Student’s t-test, while multiple comparisons were analyzed using the F-test. P<0.05 was considered to indicate a statistically significant difference.

Results

Plasmid verification

Successful digestion by BamHI, but not PstI confirmed construction of the recombinant plasmid vector (Fig. 1). Furthermore, sequencing verified that the targeted Wnt-1 gene had been inserted into the pGPU6/GFP/Neo complete shRNA vector.

Figure 1

Restriction map of the Wnt-1 plasmid.

RT-PCR detection of Wnt-1 gene mRNA expression level changes following RNAi

Transfected cells were characterized by semi-quantitative RT-PCR 48 h following transfection to detect the pGPU6/GFP/Neo-shRNA-Wnt-1-positive cells. The Wnt-1 mRNA content had decreased by 63% compared with the controls, while the negative and positive control groups did not exhibit any significant differences (Fig. 2). Compared with the controls, no significant differences in Wnt-1 gene mRNA expression levels were observed between the negative and positive control group (99 and 100%, respectively).

Figure 2

Reverse transcription polymerase chain reaction detection of the Wnt-1 gene mRNA expression levels following plasmid transfection. Lanes: 1, Blank control; 2, negative control; 3, positive control; 4 and 5, transfected pGPU6/GFP/Neo-shRNA-Wnt-1; 6, GAPDH internal reference; and M, 50-bp DNA marker.

Knockdown of Wnt-1 protein expression by plasmid transfection

Western blot analysis showed that the Wnt-1 protein expression was significantly reduced following transfection. Although the negative control did not change significantly, the expression of the positive control decreased. This may be the result of excessive cell death, which reduced the amount of extracted protein (Fig. 3).

Figure 3

Western blot analysis of the transfected Wnt-1 plasmid. Lanes: 1, Blank controls; 2, negative controls; 3, transfected positive controls; and 4 and 5, pGPU6/GFP/Neo-shRNA-Wnt-1 group.

MTT cell proliferation assay

The results of the MTT assay indicated that the positive and negative controls exhibited decreased cell growth following pGPU6/GFP/Neo-shRNA-Wnt-1 transfection. The positive controls that were transfected with pGPU6/GFP/Neo-shRNA-GAPDH showed decreased cell survival compared with the pGPU6/GFP/Neo-shRNA-Wnt-1 transfected samples, however, survival at 48 h was not identified to be statistically significant.

FCM test results

No statistically significant differences were identified between the positive and negative control groups at 48 h post-transfection (P>0.05), which indicated that the plasmid and transfection reagents were not toxic. The positive controls transfected with pGPU6/GFP/Neo-shRNA-Wnt-1 were predominantly arrested at G0/G1 and the number of cells in the S phase was decreased (P<0.05). Furthermore, the number of replicating cells decreased, which indicated that U251 proliferation was inhibited (Table I).

Table I

Cell cycle changes of each group (mean ± standard deviation; n=4).

Table I

Cell cycle changes of each group (mean ± standard deviation; n=4).

Group G0/G1 phase (%)S phase (%)G2/M phase (%)
Transfection pGPU6/GFP/Neo-shRNA-Wnt-179.5±0.616.8±1.03.7±0.5
Positive control78.5±0.411.6±0.610.0±0.6
Negative control67.2±1.626.5±0.65.6±1.1
Blank control67.4±0.727.2±0.45.1±0.5

[i] The percentage of U251 cells in G0/G1 phase in the transfection and postive groups was higher than that of the negative control and blank groups (P<0.01). By contrast, the percentage of U251 cells in S phase in the transfection and postive groups was lower than that of the two control groups (P<0.01). No significant difference was identified between the transfection and postive groups in G0/G1 phase or S phase (P>0.05).

Discussion

The Wnt signaling pathways are important in cellular differentiation and proliferation in a variety of species, and are involved in the formation of certain types of tumor (11–13). The Wnt/β-catenin signaling pathway is considered to be a classical signaling pathway, which has been investigated in-depth (14). Wnt signal transduction mediates other processes, including Wnt/Ca2+ signaling, planar cell polarity, spindle orientation and asymmetric cell growth (11,14). Wnt binding of the Frizzled receptor inhibits the effect of glycogen synthase kinase 3-β, axin, and adenomatous polyposis coli protein complexes that are involved in β-catenin phosphorylation and degradation. Non-phosphorylated β-catenin is not degraded, however, accumulates in the cytoplasm, prior to translocation to the nucleus. β-catenin then binds to the lymphocyte enhancer factor/T cell-specific transcription factor, activating the target genes, c-myc, cyclin D and MMP7, leading to cellular proliferation and tumor formation. Therefore, certain studies have hypothesized that targeted therapy of Wnt signaling may inhibit tumor formation and growth (15).

Gliomas are the most common type of primary intracranial tumor and more effective therapeutic strategies are required to stop glioma progression. The Wnt/β-catenin signaling cascade is an important signal transduction pathway in human cancer (16). The human Wnt family consists of 19 members that regulate cell proliferation, differentiation, motility and fate during embryonic development and tumorigenesis. Wnt members bind to the cell surface receptors, Frizzled and low density lipoprotein receptor-related protein, and transduce their signals through β-catenin-dependent and -independent intracellular signaling pathways (17). Wnt-1 was one of the first signaling molecules to be identified and it is considered to be the first step in the classical Wnt/β-catenin signaling pathway (18,19). Increasing evidence indicates that interplay between the Wnt/β-catenin and PI3K/AKT signaling cascades is involved in tumor development and progression. However, the mechanism of this in glioma is not well understood (20). Although a number of studies have identified a variety of tumors that exhibit abnormal Wnt-1 expression (1,10), abnormal expression is rare in glioma. In our previous study, it was demonstrated that Wnt-1 gene expression is increased in glioma, with little or weak expression identified in normal brain tissue. Furthermore, Wnt-1 expression showed a positive correlation with the glioma grade (15). The present study indicated that targeting Wnt-1 gene expression by RNAi knockdown inhibits the growth of human glioma cells. This demonstrates that glioma growth may be closely correlated with Wnt-1 protein expression. Malignant glioma growth may involve activation of the Wnt-1 signaling pathway (21), however, the specific underlying mechanism requires further investigation (22).

Current RNAi methods are important for investigating gene function (18,23,24) and it is hypothesized that the Wnt signaling pathway may be ideal for targeted drug development. However, few studies have used Wnt-1 gene RNAi. Certain studies have used fragments of chemically synthesized siRNA in transfected cells (25,26), or plasmids lacking a reporter gene (27), which complicates the assessment of transfection efficiency and the identification of stable cell lines. A previous study described the transfection of siRNA targeting Wnt-1 into SH-SY5Y neuroblastoma cells using LipofectamineTM 2000 (28). Wnt-1 and β-catenin protein expression decreased following transfection with siRNA, as did the cell number, and was accompanied by abundant floating dead cells. Additionally, the SH-SY5Y cells transfected with siRNA targeting Wnt-1 showed less viability.

In conclusion, the current study used a pGPU6/GFP/Neo carrier plasmid containing a GFP reporter, which detects cellular expression efficiency and Kanamycin/G418 resistance, into stable cell lines. Therefore, siRNA targeting Wnt-1 was used to investigate which region of the Wnt-1 gene may be targeted as a novel hotspot (29). The results of the present study revealed that miR-106a-5p is a tumor suppressor gene in astrocytomas. The overexpression of miR-106a-5p inhibits astrocytoma cell proliferation, migration, and invasion and promotes apoptosis. In addition, FASTK was found to be a direct target for miR-106a-5p. Although much remains to be elucidated in terms of the role of miR-106a-5p in the pathogenesis of astrocytomas, miR-106a-5p presents a novel potential therapeutic target for the treatment of astrocytomas.

References

1 

Benad P, Rauner M, Rachner TD and Hofbauer LC: The anti-progestin RU-486 inhibits viability of MCF-7 breast cancer cells by suppressing WNT1. Cancer Lett. 312:101–108. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Benchabane H, Xin N, Tian A, et al: Jerky/Earthbound facilitates cell-specific Wnt/Wingless signalling by modulating β-catenin-TCF activity. EMBO J. 30:1444–1458. 2011. View Article : Google Scholar : PubMed/NCBI

3 

Xu X, Sun PL, Li JZ, Jheon S, Lee CT and Chung JH: Aberrant Wnt1/β-catenin expression is an independent poor prognostic marker of non-small cell lung cancer after surgery. J Thorac Oncol. 6:716–724. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Nakashima N, Huang CL, Liu D, Ueno M and Yokomise H: Intratumoral Wnt1 expression affects survivin gene expression in non-small cell lung cancer. Int J Oncol. 37:687–694. 2010.PubMed/NCBI

5 

Oguma K, Oshima H and Oshima M: Inflammation, tumor necrosis factor and Wnt promotion in gastric cancer development. Future Oncol. 6:515–526. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Fracalossi AC, de Silva MS, Oshima CT and Ribeiro DA: Wnt/beta-catenin signalling pathway following rat tongue carcinogenesis induced by 4-nitroquinoline 1-oxide. Exp Mol Pathol. 88:176–183. 2010. View Article : Google Scholar

7 

Wang FL, Guo X, Yuan TZ, et al: Expression and clinical significance of Wnt-1 and beta-catenin in nasopharyngeal carcinoma. Ai Zheng. 28:72–75. 2009.PubMed/NCBI

8 

You L, Kim J, He B, Xu Z, McCormick F and Jablons DM: Wnt-1 signal as a potential cancer therapeutic target. Drug News Perspect. 19:27–31. 2006. View Article : Google Scholar : PubMed/NCBI

9 

Augustin I, Goidts V, Bongers A, et al: The Wnt secretion protein Evi/Gpr177 promotes glioma tumourigenesis. EMBO Mol Med. 4:38–51. 2012. View Article : Google Scholar :

10 

Natsume A, Kinjo S, Yuki K, et al: Glioma-initiating cells and molecular pathology: implications for therapy. Brain Tumor Pathol. 28:1–12. 2011. View Article : Google Scholar : PubMed/NCBI

11 

Ille F and Sommer L: Wnt signaling: multiple functions in neural development. Cell Mol Life Sci. 62:1100–1108. 2005. View Article : Google Scholar : PubMed/NCBI

12 

Toledo EM, Colombres M and Inestrosa NC: Wnt signaling in neuroprotection and stem cell differentiation. Prog Neurobiol. 86:281–296. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Han L, Yang Y, Yue X, et al: Inactivation of PI3K/AKT signaling inhibits glioma cell growth through modulation of β-catenin-mediated transcription. Brain Res. 1366:9–17. 2010. View Article : Google Scholar : PubMed/NCBI

14 

Reya T and Clevers H: Wnt signalling in stem cells and cancer. Nature. 434:843–850. 2005. View Article : Google Scholar : PubMed/NCBI

15 

De Ferrari GV and Moon RT: The ups and downs of Wnt signaling in prevalent neurological disorders. Oncogene. 25:7545–7553. 2006. View Article : Google Scholar : PubMed/NCBI

16 

Liu C, Tu Y, Sun X, et al: Wnt/beta-Catenin pathway in human glioma: expression pattern and clinical/prognostic correlations. Clin Exp Med. 11:105–112. 2011. View Article : Google Scholar

17 

Kamino M, Kishida M, Kibe T, et al: Wnt-5a signaling is correlated with infiltrative activity in human glioma by inducing cellular migration and MMP-2. Cancer Sci. 102:540–548. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Thiele S, Rauner M, Goettsch C, et al: Expression profile of WNT molecules in prostate cancer and its regulation by aminobisphosphonates. J Cell Biochem. 112:1593–1600. 2011. View Article : Google Scholar : PubMed/NCBI

19 

Sharma V, Dixit D, Koul N, Mehta VS and Sen E: Ras regulates interleukin-1β-induced HIF-1α transcriptional activity in glioblastoma. J Mol Med (Berl). 89:123–136. 2011. View Article : Google Scholar

20 

Chen L, Huang K, Han L, et al: β-catenin/Tcf-4 complex transcriptionally regulates AKT1 in glioma. Int J Oncol. 39:883–890. 2011.PubMed/NCBI

21 

Wei W, Chua MS, Grepper S and So SK: Blockade of Wnt-1 signaling leads to anti-tumor effects in hepatocellular carcinoma cells. Mol Cancer. 24:762009. View Article : Google Scholar

22 

Sareddy GR, Challa S, Panigrahi M and Babu PP: Wnt/beta-catenin/Tcf signaling pathway activation in malignant progression of rat gliomas induced by transplacental N-ethyl-N-nitrosourea exposure. Neurochem Res. 34:1278–1288. 2009. View Article : Google Scholar : PubMed/NCBI

23 

Whangbo JS and Hunter CP: Environmental RNA interference. Trends Genet. 24:297–305. 2008. View Article : Google Scholar : PubMed/NCBI

24 

Dillin A: The specifics of interfering RNA specificity. Proc Nat Acd Sci USA. 100:6289–6291. 2003. View Article : Google Scholar

25 

Mikami I, You L, He B, et al: Efficacy of Wnt-1 monoclonal antibody in sarcoma cells. BMC Cancer. 5:532005. View Article : Google Scholar : PubMed/NCBI

26 

Wieczorek M, Paczkowska A, Guzenda P, Majorek M, Bednarek AK and Lamparska-Przybysz M: Silencing of Wnt-1 by siRNA induces apoptosis of MCF-7 human breast cancer cells. Cancer Biol Ther. 7:268–274. 2008. View Article : Google Scholar

27 

Polanec J, Pavelic ZP and Myers WL: Effect of Wnt-1 antisense RNA on the outgrowth of a mammary adenocarcinoma cell line expressing that oncogene. Clin Mol Pathol. 49:M166–M169. 1996. View Article : Google Scholar : PubMed/NCBI

28 

Zhang L, Li K, Lv Z, Xiao X and Zheng J: The effect on cell growth by Wnt1 RNAi in human neuroblastoma SH-SY5Y cell line. Pediatr Surg Int. 25:1065–1071. 2009. View Article : Google Scholar : PubMed/NCBI

29 

Takahashi-Yanaga F and Sasaguri T: The Wnt/beta-catenin signaling pathway as a target in drug discovery. J Pharmacol Sci. 104:293–302. 2007. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Dong L, Duan XC, Han CX, Zhang H and Wu Y: Suppression of wingless‑type MMTV integration site family, member 1 expression by small interfering RNA inhibits U251 glioma cell growth in vitro. Oncol Lett 9: 81-85, 2015.
APA
Dong, L., Duan, X., Han, C., Zhang, H., & Wu, Y. (2015). Suppression of wingless‑type MMTV integration site family, member 1 expression by small interfering RNA inhibits U251 glioma cell growth in vitro. Oncology Letters, 9, 81-85. https://doi.org/10.3892/ol.2014.2647
MLA
Dong, L., Duan, X., Han, C., Zhang, H., Wu, Y."Suppression of wingless‑type MMTV integration site family, member 1 expression by small interfering RNA inhibits U251 glioma cell growth in vitro". Oncology Letters 9.1 (2015): 81-85.
Chicago
Dong, L., Duan, X., Han, C., Zhang, H., Wu, Y."Suppression of wingless‑type MMTV integration site family, member 1 expression by small interfering RNA inhibits U251 glioma cell growth in vitro". Oncology Letters 9, no. 1 (2015): 81-85. https://doi.org/10.3892/ol.2014.2647
Copy and paste a formatted citation
x
Spandidos Publications style
Dong L, Duan XC, Han CX, Zhang H and Wu Y: Suppression of wingless‑type MMTV integration site family, member 1 expression by small interfering RNA inhibits U251 glioma cell growth in vitro. Oncol Lett 9: 81-85, 2015.
APA
Dong, L., Duan, X., Han, C., Zhang, H., & Wu, Y. (2015). Suppression of wingless‑type MMTV integration site family, member 1 expression by small interfering RNA inhibits U251 glioma cell growth in vitro. Oncology Letters, 9, 81-85. https://doi.org/10.3892/ol.2014.2647
MLA
Dong, L., Duan, X., Han, C., Zhang, H., Wu, Y."Suppression of wingless‑type MMTV integration site family, member 1 expression by small interfering RNA inhibits U251 glioma cell growth in vitro". Oncology Letters 9.1 (2015): 81-85.
Chicago
Dong, L., Duan, X., Han, C., Zhang, H., Wu, Y."Suppression of wingless‑type MMTV integration site family, member 1 expression by small interfering RNA inhibits U251 glioma cell growth in vitro". Oncology Letters 9, no. 1 (2015): 81-85. https://doi.org/10.3892/ol.2014.2647
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team