Open Access

Dysregulation of the PI3K/Akt signaling pathway affects cell cycle and apoptosis of side population cells in nasopharyngeal carcinoma

  • Authors:
    • Danwei Zheng
    • Guangchao Zhu
    • Shan Liao
    • Wei Yi
    • Gengqiu Luo
    • Junyu He
    • Zhen Pei
    • Guiyuan Li
    • Yanhong Zhou
  • View Affiliations

  • Published online on: May 18, 2015     https://doi.org/10.3892/ol.2015.3218
  • Pages: 182-188
  • Copyright: © Zheng et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Increasing evidence has suggested that certain types of cancer possess their own stem-like cells, and that one subset of these cells, termed the side population (SP), may have an important role in tumorigenesis and cancer therapy. However, the molecular mechanisms underlying the modulation of SP cells in nasopharyngeal carcinoma (NPC) have remained elusive. In the present study, it was hypothesized that dysregulation of the phosphatidylinositol‑4,5‑bisphosphate 3‑kinase (PI3K)/Akt signaling pathway may influence SP and non-SP (NSP) phenotype. SP cells from the HK‑1 NPC cell line were identified, and cancer stem cell markers were found to be highly expressed in SP cells compared with that of NSP cells. Freshly sorted SP cells demonstrated a significant increase in the proportion of cells in G0/G1 phase, while the majority of NSP cells were in the proliferative phase. Following 48 h of culture subsequent to cell sorting, the differences in cell cycle distribution between the SP and NSP cells converged. In addition, the apoptotic ratio of NSP cells was higher than that of SP cells at 24 h following sorting, but had no significant differences 48 h following sorting. To elucidate the potential mechanism mediating the cell cycle and apoptosis in SP cells, the expression levels of key molecules in the PI3K/Akt signaling pathway were evaluated. PI3K and Akt were upregulated, while 14‑3‑3σ protein was downregulated in SP cells when freshly sorted (0 h). However, there was no significant difference in the expression of these molecules between SP and NSP cells following 48 h of culture. These results suggested that dysregulation of the PI3K/Akt signaling pathway may be associated with the cell cycle and apoptosis of SP cells in NPC. However, further investigation is required to elucidate the detailed mechanisms underlying these effects.

Introduction

Increasing evidence has suggested that specific types of cancer may contain their own stem-like cells, known as cancer stem cells (CSCs), which have key roles in the initiation, maintenance and recurrence of tumors (13). In particular, attention has been paid to a subset of CSCs, termed the side population (SP), which was identified by flow cytometry. These SP cells are able to exclude the DNA binding dye, Hoechst 33342, and are highly enriched for stem cells in numerous types of tissue (46). SP cells have been isolated from multiple solid tumors, and studies have suggested that they may have significant roles in tumorigenesis and cancer therapy. A SP of cells in nasopharyngeal carcinoma (NPC) were found to exhibit characteristics of stem-like cancer cells (712). However, the molecular mechanisms underlying the modulation of these stem-like cell populations in NPC have remained elusive.

Cellular proliferation is a critical process underlying the growth, development and regeneration of eukaryotic organisms, and appropriate control of the cell cycle is required for the proliferation of normal cells (13,14). Deregulation of the cell cycle is responsible for the aberrant cell proliferation characteristic of cancer, and the loss of cell cycle checkpoint control, which promotes genetic instability. The cell cycle machinery, which functions as an integration point for information transduced via upstream signaling networks, is a target for potential diagnostic and therapeutic interventions (1315). Apoptosis is a physiological cell death process that has key functions in normal development, as well as in the pathophysiology of various diseases (16,17). A balance between the expression of anti-apoptotic and pro-apoptotic factors underlies apoptosis; and this balance may be altered by certain extracellular signals. Significant alterations to this regulatory pathway may result in the development of various diseases, including autoimmune and neurodegenerative diseases, as well as certain types of cancer (1619). The phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K)/Akt pathway is known to have key roles in cell proliferation, apoptosis and survival in various cell types (20). The PI3K/Akt signaling pathway has been shown to regulate metastasis in multiple cancer cells (21,22).

In the present study, SP cells were identified in the HK-1 NPC cell line, and the SP and NSP cells within this population were sorted for analysis of the cell cycle and apoptosis at differential time-points. In addition, the expression levels of key molecules associated with the PI3K/Akt signaling pathway, including PI3K and Akt, were evaluated by western blotting at the corresponding time-points. The results of the present study may aid the elucidation of the involvement of dysregulation of the PI3K/Akt signaling pathway in cell cycle and apoptosis of SP cells in NPC.

Materials and methods

Cell culture

HK-1 human NPC cells, a highly differentiated NPC cell line, were provided by the Chinese University of Hong Kong (Hong Kong, China), and cultured in RPMI-1640 (Gibco Life Technologies, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS; Gibco Life Technologies), 100 U/ml penicillin and 100 µg/ml streptomycin (HyClone; GE Healthcare Life Sciences, Logan, UT, USA) at 37°C in a 5% CO2 incubator.

Identifying and sorting of SP cells by flow cytometry (FCM)

HK-1 cells were cultured in RPMI-1640 with 10% FBS until they reached ~70% confluence. The cells were trypsinized with 0.25% Trypsin (Sigma-Aldrich, St. Louis, MO, USA) at 37°C in a 5% CO2 cell incubator. Following centrifugation at 500 × g for 5 min at room temperature, the single cell suspension was resuspended in prewarmed RPMI-1640 culture medium containing 2% FBS at a concentration of 1×106 cells/ml. Hoechst 33342 (10 mg/ml; Biotium Inc., Hayward, CA, USA) was added at a final concentration of 5 µg/ml with or without 50 µmol/l verapamil (5 mmol/l; Sigma-Aldrich), an adenosine triphosphate binding cassette (ABC) transporter inhibitor, to determine whether the fluorescent efflux effect was altered. The cell suspensions were incubated in a 37°C circulating water bath for 90 min with gentle shaking every 15 min. Subsequently, the cells were washed twice with pre-cooled phosphate-buffered saline (PBS; Solarbio Science and Technology Co., Ltd., Beijing, China), resuspended in iced PBS with 2% FBS buffer and 1 µg/ml propidium iodide (PI; Sigma-Aldrich) was added to exclude dead cells. The entire protocol was performed in the dark. A MoFlo™ XDP high-performance cell sorter (Beckman Coulter, Brea, CA, USA) was used for analysis of the SP profile and subsequent cell sorting. In the flow cytometry graphs, SP cells displayed a low Hoechst staining intensity. Finally, SP and NSP cells were sorted from the HK-1 cell line for further experiments. Data and images were acquired using Summit v.5.2 software (Beckman Coulter).

CSC marker assay in SP and NSP cells

The total expression and cell surface expression levels of various CSC markers were evaluated in sorted SP and NSP cells by flow cytometric analysis (MoFlo™ XDP). CSC cell surface marker expression was determined by washing freshly sorted SP and NSP cells with PBS, prior to incubation with the following fluorescent conjugated antibodies (5 µg/105-107 cells): ABC superfamily G member 2 (ABCG2)-phycoerythrin (PE) (eBioscience, Inc., San Diego, CA, USA), CD133-PE [Miltenyi Biotec Technology & Trading (Shanghai) Co., Ltd. Shanghai, China], CD34-electron-coupled dye [ECD (PE-Texas Red)] (Beckman Coulter), CD26-fluorescein isothiocyanate (FITC; Beckman Coulter), cytokeratin 14-FITC (Biological, Swampscott, MA, USA) for 1 h at 4°C. PE mouse immunoglobulin G (IgG)2b isotype control (eBioscience, Inc.), mouse IgG2b isotype control FITC (eBioscience, Inc.) and mouse IgG2b isotype control ECD (eBioscience, Inc.) were used as negative controls for non-specific background signals.

To determine the total expression of these CSC markers, the sorted SP and NSP cells were fixed in 4% paraformaldehyde (Solarbio Science and Technology Co., Ltd.) for 30 min, washed in PBS (3 × 30 sec) and incubated with 0.1% Triton-X 100 (Solarbio Science and Technology Co., Ltd.) for 20 min. Subsequently, the cells were suspended in PBS and the corresponding aforementioned antibodies were added according to the manufacturer's instructions. Mouse IgG2b isotype control antibodies were used as the negative control. The results were analyzed by flow cytometry (MoFlo™ XDP).

RNA isolation and reverse-transcription-quantitative polymerase chain reaction (RT-qPCR) analysis

Total RNA was extracted from the SP and NSP cells using an RNeasy® kit (Qiagen, Inc., Valencia, CA, USA) and complemetary (c)DNA synthesis was performed using the RevertAid First Strand cDNA Synthesis kit (CWBio, Beijing, China) according to the manufacturer's instructions. Subsequently, qPCR was conducted using the GoTaq qPCR master mix (Promega Corp., Madison, WI, USA). The primers used for RT-qPCR are presented in Table I. RT-qPCR was performed using the BIO-RAD CFK96TM Real-Time System (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The data were analyzed with Bio-Rad CFK Manager 2.0 software (Bio-Rad Laboratories, Inc.). Messenger (m)RNA expression was assessed by evaluating the threshold cycle (CT) values. GAPDH was used as an internal control.

Table I.

Human-specific primer sequences used in the present study. To avoid false positive signals originating from DNA contamination, all human-specific polymerase chain reaction primers were designed with known amplicon size, and where possible flanking a region that contained a minimum of one intron.

Table I.

Human-specific primer sequences used in the present study. To avoid false positive signals originating from DNA contamination, all human-specific polymerase chain reaction primers were designed with known amplicon size, and where possible flanking a region that contained a minimum of one intron.

Target geneForward primerReverse primer
ABCG2 AGCTGCAAGGAAAGATCCAA TGCCCATCACAACATCATCT
CD133 TTGTGGCAAATCACCAGGTA TCAGATCTGTGAACGCCTTG
CD34 CAAGCCACCAGAGCTATTCC TCCACCGTTTTCCGTGTAAT
CD26 CAAATTGAAGCAGCCAGACA CACACTTGAACACGCCACTT
CK14 TTCTGAACGAGATGCGTGAC GCAGCTCAATCTCCAGGTTC
Flow cytometric analysis of the cell cycle

The SP and NSP cells of the HK-1 cell line were sorted by flow cytometry as previously described, and divided into two groups, respectively. One group was for analysis of the cell cycle of sorted SP and NSP cells (0 h). The other was for the analysis of the cell cycle of SP and NSP cells following culture in RPMI-1640 supplemented with 10% fetal bovine serum for 24 or 48 h. Cells were harvested at 0, 24 and 48 h and fixed in 70% ethanol at 4°C. The cells were then washed with cold PBS and stained with PI in working solution (0.5 mg/ml RNase and 0.1 mg/ml PI in PBS). The cell cycle distribution was determined by flow cytometric analysis using a MoFloTM XDP High-Performance Cell Sorter (Beckman Coulter) and the data were analyzed using Summit v.5.2 software.

Flow cytometric analysis of apoptosis

The SP and NSP cells of the HK-1 cell line were sorted by flow cytometry. The sorted cells were cultured in RPMI-1640 supplemented with 10% FBS for 24 or 48 h, prior to harvest. The cell apoptosis ratio was analyzed using an Alexa Fluor® 488 Annexin V/Dead Cell Apoptosis kit (Invitrogen Life Technologies, Carlsbad, CA, USA). Briefly, 5×105 cells were stained with Annexin V-FITC (5 µl) and 100 µg/ml PI (1 µl) in 100 µl binding buffer and incubated at room temperature for 15 min in the dark. Subsequently, 400 µl of binding buffer was added and mixed gently, and the stained cells were analyzed using a MoFlo™ XDP flow cytometer. The data were evaluated using Summit v.5.2 software.

Western blot analysis

SP and NSP cells at 0 and 48 h following sorting, were lysed in radioimmunoprecipitation buffer (CWBio, Beijing, China) and total protein concentration was determined using a Pierce® BCA Protein Assay kit (Thermo Fisher Scientific, Waltham, MA, USA). Extracts containing 50 µg protein were separated with 10% SDS-PAGE and electroblotted onto nitrocellulose membranes (HyClone; GE Healthcare Life Sciences). The membranes were inhibited using Tris-buffered saline/Tween-20 (25 mM Tris-HCl, 150 mM NaCl and 0.05% Tween-20; pH 7.5; Solarbio Science and Technology Co., Ltd.) containing 5% non-fat milk followed by overnight incubation at 4°C with the following primary antibodies: rabbit anti-PI3K polyclonal antibody (catalog no. 4292; Cell Signaling Technology, Inc., Danvers, MA, USA; dilution, 1:500); rabbit anti-Akt polyclonal antibody, (catalog no. 9272; Cell Signaling Technology, Inc.; dilution, 1:300) and mouse anti-14-3-3σ monoclonal antibody (E-11; catalog no. sc-166473; Santa Cruz Biotechnology, Inc., Dallas, TX, USA). Following three washes, the membranes were incubated with horseradish peroxidase-conjugated mouse anti-rabbit (catalog no. sc-2491; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA; dilution, 1:5,000) and goat anti-mouse (catalog no. sc-2039; Santa Cruz Biotechnology, Inc.; dilution, 1:5,000) IgG secondary antibodies for 1 h at room temperature and the signals were visualized using an enhanced chemiluminescence detection system (Universal Hood II; Bio-Rad Laboratories, Inc.) with Image Lab™ software. Anti-GAPDH antibody (Santa Cruz Biotechnology, Inc.; 1:3,000) was used as a loading control.

Statistical analysis

Results were statistically analyzed by Student's unpaired t-test using SPSS 17.0 software (SPSS, Inc., Chicago, IL, USA). Data are presented as the mean ± standard error of the mean. P<0.05 was considered to indicate a statistically significant difference between values.

Results

Putative CSC markers are differentially expressed in SP and NSP cells of the HK-1 cell line

The SP fraction of the NPC cell line, HK-1, was determined using a flow cytometric SP discrimination assay. The percentage of SP cells was found to be 3.65±1.51%. The proportion of SP cells was significantly blocked by verapamil (Fig. 1A and B). Subsequently, the MoFloTM XDP High-Performance Cell sorter was used to isolate the SP and NSP cells from the HK-1 cells and the cell surface expression levels of CSC markers were evaluated. The expression levels of putative CSC markers, including ABCG2, CD133, CD34 and CD26, were higher in SP cells compared with those of NSP cells (P<0.05). ABCG2 expression was higher in SP cells (4.27%) than NSP cells (0.41%). CD133 was 3.28 and 1.90% in SP and NSP cells, respectively. CD34 and CD26 exhibited analogous expression patterns. However, no differential expression of CK14 was detected between SP and NSP cells (Fig. 1C).

Protein and mRNA expression levels of putative CSC markers differ between SP and NSP cells in NPC

Subsequently, the total protein expression levels of the putative CSC markers were examined in sorted SP and NSP cells by flow cytometry. The results demonstrated that CD133, CD34, and CK14 expression was higher in SP cells compared with that of NSP cells. Expression levels were 28.09, 28.17 and 11.89% in SP cells, and 4.82, 24.90 and 5.23% in NSP cells, respectively. The fraction of ABCG2 and CD26 expression was high in SP and NSP cells (Fig. 1D). In addition, the expression levels of these markers in SP and NSP cells were evaluated by RT-qPCR. It was demonstrated that there were significant differences in the mRNA expression levels of ABCG2, CD26, and CK14 between SP and NSP cells of the HK-1 cell line (P<0.05). However, there was no significant difference in the expression of CD133 and CD34 (Fig. 1E). In SP and NSP cells, the mRNA and protein expression levels of CSC markers, including CD133 and CD34, is not consistent.

Cell cycle distribution differs between freshly sorted SP and NSP cells of the HK-1 cell line

Cell cycle progression was compared between SP and NSP cells 0, 24 and 48 h following sorting by flow cytometric analysis. When cells were freshly sorted, SP cells revealed a significant increase in the proportion of cells in G0/G1 phase and a reduction in the percentage of cells in S phase (Fig. 2A). The percentages of G0/G1, S and G2/M phases were 64, 32.22 and 3.78%, respectively. By contrast, the majority of NSP cells were in the proliferative phase, and the percentages of cells in G0/G1, S and G2/M phases were 40.76, 54.83 and 4.41%, respectively. Immediately following sorting, SP and NSP cells demonstrated significant differences in cell cycle distribution. However, following 24 h of culture, the differences in cell cycle distribution between SP and NSP cells were abrogated. The percentages of cells in G0/G1, S and G2/M phases in SP and NSP cells at 24 h were 44.09, 19.55 and 36.37 vs. 40.5%, 37.27% and 22.23%, respectively (Fig. 2B). In accordance, the cell cycle distribution of SP and NSP cells 48 h following sorting also coincided. The percentages of cells in G0/G1, S and G2/M phase in SP and NSP cells at 48 h were 39.5%, 41.05% and 19.45% vs. 47.17%, 35.3% and 17.53%, respectively (Fig. 2C). These results suggested that the differences in cell cycle distribution between SP and NSP cells converged with time.

The apoptotic ratio of NSP cells is higher than that of SP cells 24 h following sorting

Given that SP cells were found to be rich in CSCs markers compared with NSP cells, whether SP cells had a lower apoptotic ratio than NSP cells was determined. Annexin V-FITC and PI staining were used to analyze the percentage of apoptotic cells in SP and NSP cells at various time-points by flow cytometry. The apoptotic ratio of NSP cells was higher than that of SP cells 24 h following sorting, without any external stimuli to the cells. The apoptotic ratios of SP and NSP cells were 10.17 and 16.6%, respectively. As observed in cell cycle distribution, no significant differences in the apoptotic proportion were detected between SP and NSP cells 48 h following sorting. The apoptotic ratios of SP and NSP cells at 48 h were 11.03 and 11.36%, respectively (Fig. 3).

Dysregulation of The PI3K/Akt signaling pathway is dysregulated in SP cells of HK-1 cells immediately following sorting

To elucidate the potential mechanism underlying the mediation of the cell cycle and apoptosis in SP cells, the expression levels of key molecules associated with the PI3K/Akt signaling pathway were detected by western blot analysis. Immediately following cell sorting by flow cytometry (0 h), PI3K and Akt expression levels were upregulated in SP cells compared with those of NSP cells of the HK-1 cell line, whereas 14-3-3σ protein expression was downregulated in SP cells. Once the sorted cells had been cultured for 48 h, no significant difference in PI3K, Akt or 14-3-3σ protein was detected between SP and NSP cells of HK-1 cells (Fig. 4). Combined with the aforementioned results of cell cycle and apoptosis analysis, it was hypothesized that dysregulation of the PI3K/Akt signaling pathway was associated with the alterations in the cell cycle and apoptosis of SP cells in NPC.

Discussion

NPC is an endemic disease with an incidence rate of 15–50/100,000 individuals in southern China and Southeast Asia, and represents one of the most significant public health issues in these regions (23). Although studies regarding the tumorigenesis of NPC have previously been published (2429), the molecular basis for NPC is not fully understood. Recent studies have demonstrated that CSCs have a significant role in the pathophisiology of head and neck squamous cell carcinomas (3032). In particular, research has focused on a specific subset of CSCs, termed SP cells, which were identified by FCM. Therefore, elucidation of the molecular mechanisms of SP in NPC is urgently required for the improvement of clinical diagnosis and therapy.

In the present study, the fraction of SP cells in the HK-1 NPC cell line, was found to be 3.65±1.51%. The proportion of SP cells in this cell line was significantly decreased following verapamil treatment. SP cells expressed high levels of CSC markers compared with those of NSP cells. For example, ABCG2 expression was higher in SP cells (4.27%) than in NSP cells (0.41%), and CD133 expression was 3.28 and 1.90% in SP and NSP cells, respectively. Wang et al (7) revealed that SP cells represented ~2.6% of the total cells in the NPC cell line, CNE-2. Another four human NPC cell lines, C-666-1, SUNE-1, HONE-1 and CNE-1, were also found to contain small subpopulations of SP cells and their proportions were 0.1, 6.8, 1.8 and 0.7%, respectively. Certain putative CSC markers are highly expressed in SP cells (79), and the results of these studies corroborate the results presented in the present study.

In order to reveal the characteristics of the cell cycle and apoptosis in SP cells, the cells were evaluated at differential time-points following sorting (0, 24 or 48 h). The results of the present study revealed that freshly sorted SP cells demonstrated a significant increase in the number of cells in G0/G1 phase. However, following 48 h of culture, differences in cell cycle distribution between SP and NSP cells were abrogated. In addition, the apoptotic ratio of NSP cells was higher than that of SP cells 24 h following sorting, whereas no significant differences were detected following 48 h of culture. We hypothesize that culturing the SP and NSP cells in complete medium after sorting may have caused the SP cells to differentiate, subsequently losing their stem cell properties. Previous studies have revealed that normal and neoplastic stem cells obtained from neural and epithelial organs only exhibit initial tumor-specific properties when cultured in serum-free medium containing epidermal growth factor (EGF) and fibroblast growth factor (FGF)-2 (3335). In addition, adherent cells expanded in Laminin-coated culture plates in serum free medium containing N2-supplement, EGF and basic FGF maintain initial tumor-specific properties (36). However, when the cells were cultured in traditional complete medium, stem cells differentiated and lost their stem cell phenotype (37,38). In contrast to embryonic stem cells, a characteristic feature of adult stem cells is their proliferative quiescence. It is widely accepted that this quiescent state is a functionally significant feature of adult stem cells (3941).

To reveal the potential mechanisms underlying the cell cycle and apoptosis in SP cells, the expression levels of key molecules associated with the PI3K/Akt signaling pathway were detected. PI3K and Akt expression was upregulated, while 14-3-3σ protein expression was downregulated in freshly sorted SP cells (0 h). However, there was no significant difference in the expression of these molecules in SP and NSP cells following 48 h of culture. 14-3-3σ, a potential tumor suppressor protein, is able to negatively regulate cell cycle progression by inducing G2-M phase arrest (42,43). It has previously been demonstrated that 14-3-3σ is transactivated by p53 in response to DNA damage and, in turn, interacts with p53 and positively regulates p53 activity (44). p53 is known to be involved in mediating the complex response to ionizing radiation, inducing irreversible growth arrest and apoptosis (45). The results of the present study are in accordance with those of previous reports.

In conclusion, the results of the present study suggested that dysregulation of the PI3K/Akt signaling pathway may be associated with mediation of the cell cycle and apoptosis of SP cells in NPC. However, elucidation of the detailed mechanisms underlying this process requires further study.

Acknowledgements

The present study was supported by the National Natural Science Foundation of China (no. 81272975), the Key Project of Hunan Provincial Natural Science Foundation (no. 12JJ2044), the Project of Hunan Provincial Natural Science Foundation (no. 12JJ3121), the Project of Hunan Provincial Development and Reform Commission and the Planned Science and Technology Project of Hunan Province (nos. 2010FJ3088 and 2012FJ2014).

Abbreviations:

CSC

cancer stem cell

NPC

nasopharyngeal carcinoma

SP

side population

NSP

non side population

ABCG2

adenosine triphosphate-binding cassette transporter superfamily G member 2

PI3K

phosphatidylinositol-4,5-bisphosphate 3-kinase

FCM

flow cytometry

References

1 

Kristoffersen K, Villingshøj M, Poulsen HS and Stockhausen MT: Level of Notch activation determines the effect on growth and stem cell-like features in glioblastoma multiforme neurosphere cultures. Cancer Biol Ther. 14:625–637. 2013. View Article : Google Scholar : PubMed/NCBI

2 

Cetin I and Topcul M: Cancer stem cells in oncology. J BUON. 17:644–648. 2012.PubMed/NCBI

3 

Muñoz P, Iliou MS and Esteller M: Epigenetic alterations involved in cancer stem cell reprogramming. Mol Oncol. 6:620–636. 2012. View Article : Google Scholar : PubMed/NCBI

4 

Mitsutake N, Iwao A, Nagai K, et al: Characterization of side population in thyroid cancer cell lines: Cancer stem-like cells are enriched partly but not exclusively. Endocrinology. 148:1797–1803. 2007. View Article : Google Scholar : PubMed/NCBI

5 

Cao JX, Cui YX, Long ZJ, et al: Pluripotency-associated genes in human nasopharyngeal carcinoma CNE-2 cells are reactivated by a unique epigenetic sub-microenvironment. BMC Cancer. 10:682010. View Article : Google Scholar : PubMed/NCBI

6 

Hiraga T, Ito S and Nakamura H: Side population in MDA-MB-231 human breast cancer cells exhibits cancer stem cell-like properties without higher bone-metastatic potential. Oncol Rep. 25:289–296. 2011.PubMed/NCBI

7 

Wang J, Guo LP, Chen LZ, Zeng YX and Lu SH: Identification of cancer stem cell-like side population cells in human nasopharyngeal carcinoma cell line. Cancer Res. 67:3716–3724. 2007. View Article : Google Scholar : PubMed/NCBI

8 

Kong QL, Hu LJ, Cao JY, et al: Epstein-Barr virus-encoded LMP2A induces an epithelial-mesenchymal transition and increases the number of side population stem-like cancer cells in nasopharyngeal carcinoma. PLoS Pathog. 6:e10009402010. View Article : Google Scholar : PubMed/NCBI

9 

Liang Y, Zhong Z, Huang Y, Deng W, Cao J, Tsao G, Liu Q, Pei D, Kang T and Zeng YX: Stem-like cancer cells are inducible by increasing genomic instability in cancer cells. J Biol Chem. 285:4931–4940. 2010. View Article : Google Scholar : PubMed/NCBI

10 

Zhang HB, Ren CP, Yang XY, Wang L, Li H, Zhao M, Yang H and Yao KT: Identification of label-retaining cells in nasopharyngeal epithelia and nasopharyngeal carcinoma tissues. Histochem Cell Biol. 127:347–354. 2007. View Article : Google Scholar : PubMed/NCBI

11 

Zhang Y, Peng J, Zhang H, Zhu Y, Wan L, Chen J, Chen X, Lin R, Li H, Mao X and Jin K: Notch1 signaling is activated in cells expressing embryonic stem cell proteins in human primary nasopharyngeal carcinoma. J Otolaryngol Head Neck Surg. 39:157–166. 2010.PubMed/NCBI

12 

Xia H, Cheung WK, Sze J, Lu G, Jiang S, Yao H, Bian XW, Poon WS, Kung HF and Lin MC: miR-200a regulates epithelial-mesenchymal to stem-like transition via ZEB2 and beta-catenin signaling. J Biol Chem. 285:36995–37004. 2010. View Article : Google Scholar : PubMed/NCBI

13 

Diaz-Moralli S, Tarrado-Castellarnau M, Miranda A and Cascante M: Targeting cell cycle regulation in cancer therapy. Pharmacol Ther. 138:255–271. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Williams GH and Stoeber K: The cell cycle and cancer. J Pathol. 226:352–364. 2012. View Article : Google Scholar : PubMed/NCBI

15 

Aarts M, Linardopoulos S and Turner NC: Tumour selective targeting of cell cycle kinases for cancer treatment. Curr Opin Pharmacol. 13:529–535. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Sankari SL, Masthan KM, Babu NA, Bhattacharjee T and Elumalai M: Apoptosis in cancer - an update. Asian Pac J Cancer Prev. 13:4873–4878. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Zielinski RR, Eigl BJ and Chi KN: Targeting the apoptosis pathway in prostate cancer. Cancer J. 19:79–89. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Beesoo R, Neergheen-Bhujun V, Bhagooli R and Bahorun T: Apoptosis inducing lead compounds isolated from marine organisms of potential relevance in cancer treatment. Mutat Res Fundam Mol Mech Mutagen. 768:84–97. 2014. View Article : Google Scholar

19 

Jia LT, Chen SY and Yang AG: Cancer gene therapy targeting cellular apoptosis machinery. Cancer Treat Rev. 38:868–876. 2012. View Article : Google Scholar : PubMed/NCBI

20 

Qiao M, Sheng S and Pardee AB: Metastasis and AKT activation. Cell Cycle. 7:2991–2996. 2008. View Article : Google Scholar : PubMed/NCBI

21 

Vivanco I and Sawyers CL: The phosphatidylinositol 3-kinase AKT pathway in human cancer. Nat Rev Cancer. 2:489–501. 2002. View Article : Google Scholar : PubMed/NCBI

22 

Wagner EF and Nebreda AR: Signal integration by JNK and p38 MAPK pathways in cancer development. Nat Rev Cancer. 9:537–549. 2009. View Article : Google Scholar : PubMed/NCBI

23 

Ho JH: An epidemiologic and clinical study of nasopharyngeal carcinoma. Int J Radiat Oncol Biol Phys. 4:182–198. 1978. View Article : Google Scholar : PubMed/NCBI

24 

Zhou Y, Wang W, Zheng D, Peng S, Xiong W, Ma J, Zeng Z, Wu M, Zhou M, Xiang J, et al: Risk of nasopharyngeal carcinoma associated with polymorphic lactotransferrin haplotypes. Med Oncol. 29:1456–1462. 2012. View Article : Google Scholar : PubMed/NCBI

25 

Zhou Y, Zeng Z, Zhang W, Xiong W, Wu M, Tan Y, Yi W, Xiao L, Li X, Huang C, et al: Lactotransferrin, a candidate tumor suppressor, deficient expression in human nasopharyngeal carcinoma and inhibits NPC cell proliferation by modulating the mitogen-activated protein kinase pathway. Int J Cancer. 123:2065–2072. 2008. View Article : Google Scholar : PubMed/NCBI

26 

Zhou Y, Zeng Z, Zhang W, Xiong W, Li X, Zhang B, Yi W, Xiao L, Wu M, Shen S, et al: Identification of candidate molecular markers of nasopharyngeal carcinoma by microarray analysis of subtracted cDNA libraries constructed by suppression subtractive hybridization. Eur J Cancer Prev. 17:561–571. 2008. View Article : Google Scholar : PubMed/NCBI

27 

Zeng Z, Zhou Y, Xiong W, Luo X, Zhang W, Li X, Fan S, Cao L, Tang K, Wu M and Li G: Analysis of gene expression identifies candidate molecular markers in nasopharyngeal carcinoma using microdissection and cDNA microarray. J Cancer Res Clin Oncol. 133:71–81. 2007. View Article : Google Scholar : PubMed/NCBI

28 

Zeng ZY, Zhou YH, Zhang WL, Xiong W, Fan SQ, Li XL, Luo XM, Wu MH, Yang YX, Huang C, et al: Gene expression profiling of nasopharyngeal carcinoma reveals the abnormally regulated WNT signaling pathway. Hum Pathol. 38:120–133. 2007. View Article : Google Scholar : PubMed/NCBI

29 

Zeng Z, Zhou Y, Zhang W, Li X, Xiong W, Liu H, Fan S, Qian J, Wang L, Li Z, et al: Family-based association analysis validates chromosome 3p21 as a putative nasopharyngeal carcinoma susceptibility locus. Genet Med. 8:156–160. 2006. View Article : Google Scholar : PubMed/NCBI

30 

Szafarowski T and Szczepanski MJ: Cancer stem cells in head and neck squamous cell carcinoma. Otolaryngol Pol. 68:105–111. 2014. View Article : Google Scholar : PubMed/NCBI

31 

Qian X, Wagner S, Ma C, Coordes A, Gekeler J, Klussmann JP, Hummel M, Kaufmann AM and Albers AE: Prognostic significance of ALDH1A1-positive cancer stem cells in patients with locally advanced, metastasized head and neck squamous cell carcinoma. J Cancer Res Clin Oncol. 140:1151–1158. 2014. View Article : Google Scholar : PubMed/NCBI

32 

Han J, Fujisawa T, Husain SR and Puri RK: Identification and characterization of cancer stem cells in human head and neck squamous cell carcinoma. BMC Cancer. 14:1732014. View Article : Google Scholar : PubMed/NCBI

33 

Singh SK, Clarke ID, Terasaki M, Bonn VE, Hawkins C, Squire J and Dirks PB: Identification of a cancer stem cell in human brain tumors. Cancer Res. 63:5821–5828. 2003.PubMed/NCBI

34 

Ricci-Vitiani L, Lombardi DG, Pilozzi E, Biffoni M, Todaro M, Peschle C and De Maria R: Identification and expansion of human colon-cancer-initiating cells. Nature. 445:111–115. 2007. View Article : Google Scholar : PubMed/NCBI

35 

Wu A, Luo W, Zhang Q, Yang Z, Zhang G, Li S and Yao K: Aldehyde dehydrogenase 1, a functional marker for identifying cancer stem cells in human nasopharyngeal carcinoma. Cancer Lett. 330:181–189. 2013. View Article : Google Scholar : PubMed/NCBI

36 

Pollard SM, Yoshikawa K, Clarke ID, Danovi D, Stricker S, Russell R, Bayani J, Head R, Lee M, Bernstein M, et al: Glioma stem cell lines expanded in adherent culture have tumor-specific phenotypes and are suitable for chemical and genetic Screens. Cell Stem Cell. 4:568–580. 2009. View Article : Google Scholar : PubMed/NCBI

37 

Han ME, Jeon TY, Hwang SH, Lee YS, Kim HJ, Shim HE, Yoon S, Baek SY, Kim BS, Kang CD and Oh SO: Cancer spheres from gastric cancer patients provide an ideal model system for cancer stem cell research. Cell Mol Life Sci. 68:3589–3605. 2011. View Article : Google Scholar : PubMed/NCBI

38 

Singh S, Trevino J, Bora-Singhal N, Coppola D, Haura E, Altiok S and Chellappan SP: EGFR/Src/Akt signaling modulates Sox2 expression and self-renewal of stem-like side-population cells in non-small cell lung cancer. Mol Cancer. 11:732012. View Article : Google Scholar : PubMed/NCBI

39 

Orford KW and Scadden DT: Deconstructing stem cell self-renewal: Genetic insights into cell-cycle regulation. Nat Rev Genet. 9:115–128. 2008. View Article : Google Scholar : PubMed/NCBI

40 

Horsley V, Aliprantis AO, Polak L, Glimcher LH and Fuchs E: NFATc1 balances quiescence and proliferation of skin stem cells. Cell. 132:299–310. 2008. View Article : Google Scholar : PubMed/NCBI

41 

Malumbres M: Physiological relevance of cell cycle kinases. Physiol Rev. 91:973–1007. 2011. View Article : Google Scholar : PubMed/NCBI

42 

Mhawech P: 14-3-3 proteins - an update. Cell Res. 15:228–236. 2005. View Article : Google Scholar : PubMed/NCBI

43 

Laronga C, Yang HY, Neal C and Lee MH: Association of the cyclin-dependent kinases and 14-3-3σ negatively regulates cell cycle progression. J Biol Chem. 275:23106–23112. 2000. View Article : Google Scholar : PubMed/NCBI

44 

Yang HY, Wen YY, Chen CH, Lozano G and Lee MH: 14-3-3σ positively regulates p53 and suppresses tumor growth. Mol Cell Biol. 23:7096–7107. 2003. View Article : Google Scholar : PubMed/NCBI

45 

Gudkov AV and Komarova EA: The role of p53 in determining sensitivity to radiotherapy. Nat Rev Cancer. 3:117–129. 2003. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

July-2015
Volume 10 Issue 1

Print ISSN: 1792-1074
Online ISSN:1792-1082

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Zheng D, Zhu G, Liao S, Yi W, Luo G, He J, Pei Z, Li G and Zhou Y: Dysregulation of the PI3K/Akt signaling pathway affects cell cycle and apoptosis of side population cells in nasopharyngeal carcinoma. Oncol Lett 10: 182-188, 2015
APA
Zheng, D., Zhu, G., Liao, S., Yi, W., Luo, G., He, J. ... Zhou, Y. (2015). Dysregulation of the PI3K/Akt signaling pathway affects cell cycle and apoptosis of side population cells in nasopharyngeal carcinoma. Oncology Letters, 10, 182-188. https://doi.org/10.3892/ol.2015.3218
MLA
Zheng, D., Zhu, G., Liao, S., Yi, W., Luo, G., He, J., Pei, Z., Li, G., Zhou, Y."Dysregulation of the PI3K/Akt signaling pathway affects cell cycle and apoptosis of side population cells in nasopharyngeal carcinoma". Oncology Letters 10.1 (2015): 182-188.
Chicago
Zheng, D., Zhu, G., Liao, S., Yi, W., Luo, G., He, J., Pei, Z., Li, G., Zhou, Y."Dysregulation of the PI3K/Akt signaling pathway affects cell cycle and apoptosis of side population cells in nasopharyngeal carcinoma". Oncology Letters 10, no. 1 (2015): 182-188. https://doi.org/10.3892/ol.2015.3218