Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
September-2016 Volume 12 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2016 Volume 12 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Epigenetic modification suppresses proliferation, migration and invasion of urothelial cancer cell lines

  • Authors:
    • Phillipp Brockmeyer
    • Bernhard Hemmerlein
  • View Affiliations / Copyright

    Affiliations: Department of Oral and Maxillofacial Surgery, University Medical Centre Göttingen, Göttingen D‑37075, Germany, Department of Pathology, University Medical Centre Göttingen, Göttingen D‑37075, Germany
    Copyright: © Brockmeyer et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 1693-1700
    |
    Published online on: July 18, 2016
       https://doi.org/10.3892/ol.2016.4877
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Epigenetic approaches offer additional therapeutic options, including apoptosis induction, modification of cell cycle regulating proteins and the re‑expression of pharmaceutical targets, such as hormone receptors. The present study analyzed the effect of the epigenetic modifiers 5-aza-2'-deoxycytidine and Trichostatin A on the proliferative, migratory and invasive behavior of four urinary bladder cancer cell lines (RT‑4, RT‑112, VMCUB‑1 and T‑24), and the expression of various matrix metalloproteinases (MMPs) and tissue inhibitors of matrix metalloproteinases (TIMPs). Cell proliferation, migration and invasion assays revealed that treatment with the two epigenetic modifiers resulted in proliferation inhibition in all cell lines, and migration and invasion inhibition in RT‑4, RT‑112 and T‑24 cell lines. Quantitative polymerase chain reaction demonstrated that the mRNA expression of a broad selection of MMPs and their TIMPs was induced in all cell lines, and MMP‑14 mRNA expression was suppressed in all cell lines, with the exception of RT-4. In conclusion, epigenetic modifications suppressed the motility and invasiveness of three out of four urothelial cancer cell lines. The inhibitory effect on cell motility appears to be crucial for reduced invasive properties. However, even a broad spectrum of mRNA analysis does not sufficiently explain the loss of invasiveness, as it does not allow for functional conclusions. Further complex urothelial tumour models should be applied to investigate whether epigenetic therapeutic approaches may be an option in urothelial cancer.

Introduction

Epigenetic modifications affect gene expression without altering the DNA structure. DNA methylation and histone acetylation, or methylation, are two of the most important mechanisms. Epigenetic gene expression modulation is an aspect of physiological development, and its dysregulation is involved in carcinogenesis (1). In myelodysplastic syndromes and acute myeloid leukemia, epigenetic modifiers are used in routine therapy (2,3), and such approaches are becoming popular treatment options for solid tumours (4). Epidermal growth factor receptor is downregulated by epigenetic modifications, and the re-expressed receptor after treatment with, for example, hypomethylating agents is a potential therapeutic target leading to cell death (5,6). Several studies have demonstrated the growth-inhibiting effect of Trichostatin A (TSA) on carcinomas (7,8). Vigushin et al (7) described histone hyperacetylation of histone H4, thereby inhibiting proliferation in breast cancer cell lines following TSA treatment. Ailenberg and Silverman (8) described apoptosis induction in tumour cells following TSA treatment, which restored the expression of cell-cycle-controlling genes.

The compound 5-aza-2′-deoxycytidine (aza) is a cytosin analogue, which can be integrated into newly synthesised DNA strands. Aza irreversibly binds and inhibits DNA (cytosine-5)-methyltransferase 1 (DNMT1), which transfers methylation patterns to newly synthesised DNA. Loss of DNMT1 activity therefore leads to a loss of methylation during the next cell cycles and the re-expression of specific genes (9). Methylation inhibition of CpG islands of the estrogen receptor leads to its downregulation, and treatment with aza restores estrogen receptor expression (10). This principle has been demonstrated for numerous other genes, including e-cadherin in ovarian cancer (11) or tissue inhibitor of matrixmetalloproteinase (TIMP)-3 in gastric cancer (12).

Urothelial cancer develops from a preinvasive stage into an invasive cancer capable of developing metastasis. Matrix metalloproteinases (MMPs) are key molecules in extracellular remodelling, and are most likely to be important for the step from non-invasive to invasive urothelial cancer (13). MMP-9 was previously shown to be upregulated in invasive cancer compared with superficial bladder carcinomas (13). Furthermore, certain studies have shown that the increased expression of MMP-9 and TIMP-2 is associated with an increased recurrence rate of superficial bladder cancer (14). Depending on the grade of differentiation and stage, urothelial cancer may be treated by local chemo- or immunotherapy (15). However, intravesical treatment, either by instillation of Mitomycin C or intravesical immunotherapy by induction of an inflammation with Bacillus Calmette-Guérin (BCG), holds the potential of severe adverse effects, including severe urocystitis or even systemic BCG infections (16,17). Epigenetic approaches may offer potential therapeutic options for urothelial cancer. Nevertheless, such modifiers also indirectly affect the expression of genes, which are not under the influence of CpG islands in their promoter regions.

The present study analyzed the effect of the epigenetic modifiers aza and TSA on the proliferation, migration and invasion of four biologically different human urinary bladder cancer cell lines (RT-4, RT-112, VMCUB-1, T-24). In addition, the mRNA expression of various MMPs, TIMPs and extracellular matrix metalloproteinase inducer (EMMPRIN) was analyzed in the four cell lines following aza and TSA treatment.

Materials and methods

Cell culture

Human urinary bladder transitional cell papilloma RT-4 and human urinary bladder transitional cell carcinoma RT-112 (low-grade), VMCUB-1 and T-24 (high grade) cell lines were obtained from the German Collection of Cell Cultures and Microorganisms (Braunschweig, Germany). They were cultivated in Dulbecco's modified Eagle's medium (GE Healthcare, Chalfont, UK), supplemented with 10% foetal calf serum, 1% penicillin/streptomycin and 1% L-glutamine (all Sigma-Aldrich Chemie Gmbh, Munich, Germany) in a humidified incubator at 37°C with 5% CO2.

Tumour doubling time

To calculate the tumour doubling time, 105 cells were seeded in a 25-cm2 flask and cell density was counted after 24 and 48 h.

Cell proliferation and treatment with epigenetic modifiers

All measurements were performed in triplicate in three independent experiments. In total, 5,000 tumour cells were seeded per well in 200 µl cell culture medium, and cultivated for 24 h. For sole treatment with aza, cells were treated with 10 µMol aza for an additional 48 h. For sole treatment with TSA, cells were stimulated with 200 nMol TSA for 24 h. For combined treatment, cells were sequentially stimulated with 10 µMol aza for 24 h, after which, 200 nMol TSA was added for an additional 24 h. After stimulation, cell cultures were labelled for a further 14 h with bromodeoxyuridine (BrdU) at a final concentration of 10 µMol. Proliferation analysis was performed using a BrdU-Cell Proliferation ELISA (Roche Diagnostics GmbH, Penzberg, Germany), according to the manufacturer's protocol. Absorbance was measured using a microplate reader (BioRad Laboratories, Inc., Hercules, CA, USA) at 450 nm (control wavelength 655 nm).

Cell migration and invasion

Cell migration was analyzed using microwell inserts (pore size, 8-µm; Nunc™ Cell Culture Inserts; Thermo Fisher Scientific, Inc., Waltham, MA, USA), while cell invasion was analyzed using Corning® BioCoat™ Growth Factor Reduced Matrigel Invasion Chambers (pore size, 8-µm; BD Biosciences, Franklin Lakes, NsJ, USA). For the two assays, culture medium supplemented with 20% heat-inactivated foetal calf serum was used as a chemoattractant in the lower reservoir. All measurements were performed in three independent experiments using sequential treatment with aza and TSA. Negative controls were performed using acetic acid and dimethyl sulfoxide alone. Subsequent to 72 h, pre-treated cells were harvested, washed and seeded in the upper reservoir. After 24 h, cells on the lower side of the membrane were counted following staining with Giemsa. All values were corrected against the proliferation ratio of BrdU (aza + TSA) / BrdU (control).

Quantitative polymerase chain reaction (qPCR) analysis of MMP, TIMP and EMMPRIN expression

Total RNA was extracted from untreated cells and cells that were treated using the aforementioned method with the RNeasy Mini kit® (Qiagen GmbH, Hilden, Germany), according to the manufacturer's protocol. Since preliminary experiments did not reveal genomic DNA contamination, no RNAse treatment was performed. RNA integrity and concentration was determined using an Agilent 2100 Bioanalyzer (Agilent Technologies Deutschland GmbH & Co., KG, Waldbronn, Germany). In total, 500 ng total RNA were reverse transcribed into cDNA (Omniscript Reverse Transcriptase kit; Qiagen GmbH). For specific gene expression, 125 ng cDNA was subjected to qPCR using an iCycler® (BioRad Laboratories, Inc.) with SYBR®-Green I as an intercalating dye (SYBR Green I Supermix; BioRad Laboratories, Inc.). For qPCR, 50 cycles were performed under the following conditions: Denaturation for 30 sec at 95°C; annealing for 30 sec (for temperatures see Table I); followed by elongation for 30 sec at 95°C. Primer sequences were synthesized by Eurofins Genomics (Ebersberg, Germany) and are listed in Table I. All experiments were performed in triplicate, and specific reverse transcription-PCR measurements were performed in duplicate. The specificity of the PCR reaction was proven by melting point analysis and agarose gel electrophoresis. Expression values were calculated with reference to porphobilinogen deaminase gene expression using the ∆∆Cq method (∆∆Cq = ∆∆Cq treated - ∆∆Cq untreated control) and the equation y = 2−∆∆Cq (18).

Table I.

Primers used for quantitative polymerase chain reaction and their annealing temperatures.

Table I.

Primers used for quantitative polymerase chain reaction and their annealing temperatures.

MMP typeSense primerAntisense primerTemperature, °C
MMP-1 CTGGGAGCAAACACATCTGA AAGGAGAGTTGTCCCGATGA63
MMP-2 ACAGTGGACATGGCGGTCTCAG AGCCAAGTGGTCCGTGTGAA62
MMP-3 CCTTTTGATGGACCTGGAAA TGAAAGAGACCCAGGGAGTG56
MMP-7 Ex4/5 TGCTCACTTCGATGAGGATG TGGGGATCTCCATTTCCATA59
MMP-8 CTTTCAGGGAAACCAGCAAC TCCACGGAGTGTGGTGATAG56
MMP-9 GCCACTTGTCGGCGATAGG CACTGTCCACCCCTCAGAGC63
MMP-10 TGGGTTTTCCTCCAACCATA AGGCTCAACTCCTGGAAAGTC59
MMP-11 TGTGACGCCACTCACCTTTA ATCCCCTTCTCGGTGAGTCT56
MMP-12 TTCCCCTGAACAGCTCTACAAGCCTGGAAA GATCCAGGTCCAAAAGCATGGGCTAGGATT65
MMP-13 AACATCCAAAAACGCCAGAC GGAAGTTCTGGCCAAAATGA53
MMP-14 CGGTCATCATCGGGCAGCACAAAA CGCTACGCCATCCAGGGTCTCAAA63
MMP-15 GGAATTCCCCCTCATGTAT GGGATCCCTTTCCAGACTGT63
MMP-16 GGAATTCCCCCTCATGGTAT GGGATCCCTTTCCAGACTGT63
MMP-17 GTGTGCGGGAGTCTGTGTC AAAGCTTCACCCCGGATCT68
MMP-19 CACAATATGGGTACCTACAGAAGC GATCCTCTAGGCCACAACGA59
MMP-20 GCACGTGCAGCAAATAGATG TCGATTTGGCCATTTACTCC56
MMP-21 Ex5/6 ATGGGGACCCTATCCAAATC GGTCATAAAACGCCGTGTCT59
MMP-23 GATCAACCACACGGACTGC CGTGTTGTGAGTGCATCAGG56
MMP-24 CCTATGACTCACGGGCATCT GCCTCCACTTCTGTCCAGTC59
MMP-25 CCCAAACCCCATATGACAAG AGGGGCCTTTGAAGAAGAAA56
MMP-26 GATATGAAGCCATCCGCAGT AGGCATGGCCTAAGATACCA63
MMP-27 GCCAGATTATCCCAAATCC TTACCACTCTCTGCGGGAAC59
MMP-28 GAGACCTGGGACTCCTACAGC CTCTGAGACGTTGCCATCAG61
TIMP-1 ACCAGACCACCTTATACCAGCG GGACTGGAAGCCCTTTTCAGAG65
TIMP-2 ATGCAGATGTAGTGATCAGGGC GATGAAGTCACAGAGGGTGATG63
TIMP-3 GGGGAAGAAGCTGGTAAAG AAGTCACAAAGCAAGGCAG57
TIMP-4 CACCCTCAGCAGCACATCT TTTGATTTCATACCGGAGCA59
EMMPRIN CCGGCACAGTCTTCACTACC TACTCTCCCCACTGGTCGTC60
PBGD TCAATGTTGCCACCACACTGTCCGTCT TGTCTGGTAACGGCAATGCGGCTGCAAC70

[i] MMP, matrix metalloproteinase; TIMP, tissue inhibitor matrix metalloproteinase; EMMPRIN, extracellular matrix metalloproteinase inducer; PBGD, porphobilinogen deaminase.

Statistical analysis

Statistical significance was calculated using Student's t-test. Post hoc comparisons were made by the Bonferroni test for repeated measurements. P<0.05 was considered to indicate a statistically significant difference. All tests were performed using GraphPad Prism version 4 software (GraphPad Software Inc., La Jolla, CA, USA).

Results

Antiproliferative effects of epigenetic modifiers

The calculation of the tumour doubling time of unstimulated cell lines revealed a doubling time of 41.6 h for cell line RT-4, 15.9 h for RT-112, 11.3 h for VMCUB-1 and 9 h for T-24.

In cell lines RT-112 (P=0.008), VMCUB-1 (P=0.035) and T-24 (P=0.050) only combined aza and TSA treatment resulted in a significantly reduced proliferation compared with untreated controls. By contrast, the proliferation of RT-4 cells was significantly suppressed by treatment with TSA (P=0.009) or aza treatment alone (P=0.049), and the TSA and aza combination treatment (P=0.009) (Fig. 1).

Figure 1.

Proliferation of human urinary bladder cancer (A) RT-4, (B) RT-112, (C) VMCUB-1 and (D) T-24 cell lines following treatment with aza and TSA alone, and aza and TSA in combination. Untreated cells served as controls. aza, 5 aza 2′ deoxycytidin; TSA, Trichostatin A.

Migration inhibition by epigenetic modifiers

Migration was significantly inhibited by combined treatment of aza and TSA in the low grade RT-4 (P=0.004) and RT-112 (P=0.004) cell lines, and slightly less inhibited in the high grade T-24 cell line (P=0.045). No significant difference was observed for VMCUB-1 cells (P=0.092) (Fig. 2).

Figure 2.

Migration of untreated and sequentially aza and TSA-treated human urinary bladder cancer (A) RT-4 (B) RT-112, (C) VMCUB-1 and (D) T-24 cells. Data are presented as the mean ± standard deviation of three independent triple experiments. aza, 5-aza-2′-deoxycytidin; TSA, Trichostatin A.

Invasion inhibition by epigenetic modifiers

Cell invasion was significantly inhibited by combined treatment of aza and TSA in the low grade RT-4 (P=0.001) and RT-112 (P=0.044) cell lines, and the high grade T-24 cell line (P=0.013). No significant difference was observed in VMCUB-1 cells (P=0.552) (Fig. 3).

Figure 3.

Invasion of untreated and sequentially aza and TSA-treated human urinary bladder cancer (A) RT-4 (B) RT-112, (C) VMCUB-1 and (D) T-24 cells. Data are presented as the mean ± standard deviation of three independent triple experiments. aza, 5-aza-2′-deoxycytidin; TSA, Trichostatin A.

Effects of epigenetic modifiers on MMP, TIMP and EMMPRIN mRNA expression
Overall

All data regarding smRNA expression levels and the effect of epigenetic modifiers are summarized in Fig. 4 and Table II.

Figure 4.

MMPs, TIMPs and mRNA expression in 5-aza-2′-deoxycytidin and Trichostatin A-treated human urinary bladder cancer (A) RT-4 (B) RT-112, (C) VMCUB-1 and (D) T-24 cells, using quantitative polymerase chain reaction. Values >100 have been equated with 100. The color of the column indicates the level of mRNA expression, according to the Cq. MMP-9 did not exhibit any expression and is not included. MMP, Matrix metalloproteinase; TIMP, tissue inhibitor matrix metalloproteinase; EMMPRIN, extracellular matrix metalloproteinase inducer.

Table II.

P-values for mRNA expression of MMPs, TIMs and EMMPRIN in human urinary bladder cancer cell lines agaisnt untreated cells.

Table II.

P-values for mRNA expression of MMPs, TIMs and EMMPRIN in human urinary bladder cancer cell lines agaisnt untreated cells.

Cell lines, P-value

RT-4RT-112VMCUB-1T-24
EMMPRIN   0.0254   0.0193   0.0618   0.0518
MMP-1   0.0104   0.0010   0.0199   0.0015
MMP-2   0.7801   0.0206   0.0002a   <0.0001a
MMP-3   0.0001   0.1097a   0.3396   0.0006
MMP-7   0.0009   0.0123   0.0027   0.0004
MMP-8   0.0611   0.0879   0.1041   0.0566
MMP-9NENENENE
MMP-10   0.0108   0.0076   0.0068   0.0015
MMP-11   0.0099   0.0274   0.0048   0.0602
MMP-12   0.0003   0.0036a   0.0023a   <0.0001a
MMP-13<0.0001   0.0002   0.0017<0.0001
MMP-14 (MT1-MMP)   0.2083<0.0001   0.0005   0.0003
MMP-15 (MT2-MMP)<0.0001   0.0036   0.0004   0.0002
MMP-16 (MT3-MMP)   0.0011   0.0002   0.0201   0.0875
MMP-17 (MT4-MMP)<0.0001<0.0001<0.0001   0.0130
MMP-19   0.8661   0.0002   0.0011<0.0001
MMP-20   <0.0001a   0.0035a   0.0008a   0.0065a
MMP-21<0.0001   0.0210   0.0127   0.0083
MMP-23   0.0534   0.6542   0.0009   0.0013
MMP-24 (MT5-MMP)<0.0001   0.0054   0.0014<0.0001
MMP-25 (MT6-MMP)   <0.0001a<0.0001   0.0325a   0.6737a
MMP-26   0.1823   0.2333   0.1719   0.4009
MMP-28   0.0130   0.0307   0.0161   0.1305
TIMP-1   0.0506   0.0004   0.0026   0.1179
TIMP-2<0.0001   0.0051   0.0006   0.0025
TIMP-3   0.0106   0.1888   0.0002   0.0002
TIMP-4   0.0073   0.0797   0.0028   0.0094

a Cq values >42 were set to 42; NE, no expression; MMP, matrix metalloproteinase; TIMP, tissue inhibitor matrix metalloproteinase; EMMPRIN, extracellular matrix metalloproteinase inducer; MT, membrane type.

EMMPRIN expression

TSA and aza induced a significant mRNA increase in the low-grade RT-4 (P=0.0254) and RT-112 (P=0.0193) cell lines. This induction was nearly significant in VMCUB-1 (P=0.0618) and T-24 (P=0.0518) cells.

Membrane-type (MT) MMPs

With the exception of RT-4 cells (P=0.2083), MMP-14 mRNA expression was significantly suppressed by epigenetic modifier treatment in RT-112 (P<0.0001), VMCUB-1 (P=0.0005) and T-24 (P=0.0003) cell lines. The mRNA expression of all other MT-MMPs was increased in RT-4, RT-112, VMCUB-1 and T-24 cell lines, the latter exhibited an alteration in MMP-16 and MMP-25 mRNA expression. However, MMP 25 mRNA was expressed only at a very low level. All P-values are provided in Table II.

Gelatinases

MMP-9 mRNA was not detected in the cell lines. By contrast to a significant mRNA suppression in RT-112 cells (P=0.0206), MMP-2 mRNA expression was not altered in RT-4 cells (P=0.7801). MMP-2 mRNA expression was clearly induced in the high-grade cell lines at a low level (VMCUB-1, P=0.0002; T-24, P<0.0001).

Collagenases

MMP-1 was induced significantly in all cell lines. MMP-8 mRNA increased from a low level. In all four cell lines, MMP-13 mRNA expression increased significantly from a high base level. All P-values are provided in Table II.

Stromelysins

MMP-3 mRNA was expressed in high-grade VMCUB-1 and T-24 cell lines at a high level, in contrast to RT-4 and RT-112 cell lines. However, only RT-4 and T-24 cells upregulated MMP-3 mRNA significantly (P=0.0001 and P=0.0006, respectively). The same result was observed for MMP-10 and MMP-11 mRNA, with the exception of MMP-11 in the T-24 cell line (Table II).

Other MMPs

Notably, mRNA of MMP-12, which is typically expressed in macrophages, exhibited a high expression level in RT-4 cells and was significantly induced in other cell lines. MMP-28 mRNA was suppressed by epigenetic modifier treatment in RT-4 and RT-112 cells. The mRNA expression levels of MMP-19, −20, −21, −23 and −27 exhibited individual patterns, which were either stable or induced following treatment with epigenetic modifiers. P-values are provided in Table II.

TIMPs

TIMP-3 was upregulated following treatment with TSA and aza combination, which was at higher level in RT-4 and RT-112 cells compared to VMCUB-1 and T-24 cells. TIMP-1 and TIMP-2 mRNA was scantly expressed, but significantly upregulated in all four cell lines, with the exception of TIMP-2 mRNA in T-24 cells. Treatment with epigenetic modifiers significantly induced the expression of TIMP-4 mRNA in RT-4, VCUMB-1 and T-24 cell lines, whereas in RT-112 cells this appeared to be a statistical trend. All P-values are provided in Table II.

Discussion

Epigenetics may offer additional treatment options for solid malignancies. The present study analyzed the effects of the histone deacetylase inhibitor Trichostatin A (TSA) and the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (aza) on proliferation, migration and invasion of four urothelial cancer cell lines with various proliferation characteristics. In addition, the present study analyzed the mRNA expression of a broad panel of MMPs, TIMPs and EMMPRIN following TSA and aza treatment.

For optimum treatment, the two inhibitors were combined and this treatment combination exhibited the strongest antiproliferative effects in all cell lines. This has already been reported by Karam et al (19) in urothelial carcinoma cell lines and Cecconi et al (20) in an endocrine pancreatic carcinoma cell line. The effect of the inhibitors may be associated with the re-expression of cell cycle regulatory proteins and the activation of key genes of the apoptotic cascade (21). In the present study, treatment with aza and TSA combination on the low-proliferating RT-4 cell line resulted in clear antiproliferative effects. This may be due to the switch-off of additional cell-cycle-promoting proteins or the switch-on of cell-cycle-controlling proteins. The requirement of a combined epigenetic modification, leading to a decreased proliferation in the other cell lines (RT-112, VMCUB-1 and T-24), suggests that there are pre-existing structural gene alterations of cell cycle promoting or controlling proteins, whose effects are affected by combined TSA and aza treatment.

Invasiveness is a complex function of migration and extracellular matrix remodelling. As summarized in Fig. 4 aza/TSA-treatment stimulated the expression of the majority of MMPs and TIMPs. Sato et al (22) observed increased invasiveness in pancreatic cancer cells and an induction of MMP-1, −2, −3, −7, −9 and −14 following aza treatment. In contrast to the other cell lines, in RT112 cells, aza/TSA-treatment suppressed MMP-2 and MMP-28 mRNA expression. Shukeir et al (23) identified a decreased MMP 2 expression triggered by gene methylation in highly invasive prostate cancer cell lines. Couillard et al (21) described an increased MMP-3 expression in colon cancer cell lines following demethylating treatment with aza. However, in that study MMP-10 expression was not affected by aza treatment. Furthermore, in B-cell lymphoma cells a MMP-10 induction, but not a MMP-3 induction, was observed (21). Chen et al (24) described a clear inhibitory effect on the invasiveness of bladder cancer cells treated with the histone deacetylase inhibitor valproic acid; however, inhibition of migration was not observed. Since, epigenetic modifiers induce antiproliferative effects, it is necessary to dissect antiproliferative from anti-migratory and anti-invasive effects. Therefore, the present study corrected migration and invasion assays against antiproliferative effects. With the exception of VMCUB-1 cells, a significant inhibition in migration and invasion was observed in all cell lines, and VMCUB-1 cells exhibited a trend towards reduced invasion. These various, somewhat contradictory, results suggest an epigenetic effect on the invasiveness and migratory behavior in a cell- or tissue-specific manner.

In the present study, MMP-14 suppression by aza/TSA treatment was a constant effect in all tested cell lines. MMP-14, also known as MT1-MMP, and TIMP-2 form an activating complex with proMMP-2 on the cell surface (25). As shown by qPCR in the present study, MMP-14 mRNA expression was suppressed, possibly resulting in a reduction of activating complexes. Selective inhibition of MMP-14 is capable of blocking invasion and tumour growth (26). Itoh and Seiki (27) underlined the essential role of MMP-14 in the regulation of invasion and migration in tumour cells via homodimerization on the cell surface for pericellular collagenolysis, a mechanism that has also been identified for the collagenase MMP-13 (28). Notably, MMP-13 was significantly induced in all cell lines in the present study following treatment with aza and TSA combination. Therefore, the reduction in invasion and migration in the present experiments may be explained by the inhibition of MMP-14 expression. Kitagawa et al (29) found that the mRNA of MMP-14 and MMP-15 was significantly overexpressed in urothelial carcinoma in comparison with normal mucosa. High mRNA expression of the two MMPs was associated with multilocular tumours (29). In contrast, mRNA expression of MMP-16, which is also a proMMP-2 activator, was detected at a much lower level without any particular association (29). In the present study, MMP-16 was significantly stimulated in the low grade cell lines RT-4 and RT-112. In contrast, this MMP-16 mRNA expression was suppressed in the high grade cell lines VMCUB-1 and T-24. In colorectal cancer and cancer cell lines, MMP-16 promoter hypermethylation was reported to be associated with a decreased mRNA expression (30). Treatment with 5-aza 2′-deoxycytidine restored this mRNA expression in colorectal cancer cell lines (30). Knockdown of mRNA expression was associated with cell migration, re-expression and overexpression of genes and proteins, with reduced migration (30). These observations confirm the findings from the present study regarding mRNA expression of MMP-16 in the low grade urothelial cancer cell lines, RT-4 and RT-112, but are in contrast to the findings of the present study that regard migration and the effects in the high grade cell lines, VMCUB-1 and T-24. Therefore, it is likely that regulatory pathways are more complex. Furthermore, Moon et al (30) did not consider the potential anti-proliferative effects of aza treatment. TIMP proteins are genuine inhibitors of MMPs, but they also perform additional functions. TIMP-3 overexpression is associated with the induction of apoptosis (31,32), while TIMP-1 and TIMP-2 protect B cells and melanoma cells, respectively, from apoptosis (33). In the present study, TIMP mRNA expression was increased in all cell lines. An alteration in the MMP/TIMP ratio towards TIMPs and suppression of MMP-14, coupled with inhibited migratory properties, may be essential for the observed reduced invasiveness of RT-4, RT-112 and T-24 cell lines. In VMCUB-1 cells, no effects on migration and invasion were observed; therefore, other extracellular matrix remodelling proteinases, including urokinase and plasminogen activator-1, may be of importance in this cell line.

In conclusion, the present study revealed that the epigenetic modifications of aza and TSA suppressed the motility and invasiveness of three out of four urothelial cancer cell lines. The inhibitory effect on cell motility appears to be crucial for reduced invasive properties. However, even a broad spectrum mRNA analysis of the MMP/TIMP axis does not sufficiently explain the loss of invasiveness, since it leaves no scope for functional conclusions, such as the homodimerization of MMP-14 or MMP-13. Further complex urothelial tumour models should be applied to investigate whether epigenetic therapeutic approaches may be used in urothelial cancer.

References

1 

Kanwal R and Gupta S: Epigenetic modifications in cancer. Clin Genet. 81:303–311. 2012. View Article : Google Scholar : PubMed/NCBI

2 

Ades L and Santini V: Hypomethylating agents and chemotherapy in MDS. Best Pract Res Clin Haematol. 26:411–419. 2013. View Article : Google Scholar : PubMed/NCBI

3 

Kim TK, Gore SD and Zeidan AM: Epigenetic therapy in acute myeloid leukemia: Current and future directions. Semin Hematol. 52:172–183. 2015. View Article : Google Scholar : PubMed/NCBI

4 

Boumber Y and Issa JP: Epigenetics in cancer: What's the future? Oncology (Williston Park). 25:220–226, 228. 2011.PubMed/NCBI

5 

Montero AJ, Diaz-Montero CM, Mao L, Youssef EM, Estecio M, Shen L and Issa JP: Epigenetic inactivation of EGFR by CpG island hypermethylation in cancer. Cancer Biol Ther. 5:1494–1501. 2006. View Article : Google Scholar : PubMed/NCBI

6 

Bauman J, Verschraegen C, Belinsky S, Muller C, Rutledge T, Fekrazad M, Ravindranathan M, Lee SJ and Jones D: A phase I study of 5-azacytidine and erlotinib in advanced solid tumor malignancies. Cancer Chemother Pharmacol. 69:547–554. 2012. View Article : Google Scholar : PubMed/NCBI

7 

Vigushin DM, Ali S, Pace PE, Mirsaidi N, Ito K, Adcock I and Coombes RC: Trichostatin A is a histone deacetylase inhibitor with potent antitumor activity against breast cancer in vivo. Clin Cancer Res. 7:971–976. 2001.PubMed/NCBI

8 

Ailenberg M and Silverman M: Trichostatin A-histone deacetylase inhibitor with clinical therapeutic potential-is also a selective and potent inhibitor of gelatinase A expression. Biochem Biophys Res Commun. 298:110–115. 2002. View Article : Google Scholar : PubMed/NCBI

9 

Christman JK: 5-Azacytidine and 5-aza-3′-deoxycytidine as inhibitors of DNA methylation: mechanistic studies and their implications for cancer therapy. Oncogene. 21:5483–5495. 2002. View Article : Google Scholar : PubMed/NCBI

10 

Ferguson AT, Lapidus RG, Baylin SB and Davidson NE: Demethylation of the estrogen receptor gene in estrogen receptor-negative breast cancer cells can reactivate estrogen receptor gene expression. Cancer Res. 55:2279–2283. 1995.PubMed/NCBI

11 

Yuecheng Y, Hongmei L and Xiaoyan X: Clinical evaluation of E-cadherin expression and its regulation mechanism in epithelial ovarian cancer. Clin Exp Metastasis. 23:65–74. 2006. View Article : Google Scholar : PubMed/NCBI

12 

Kang SH, Choi HH, Kim SG, Jong HS, Kim NK, Kim SJ and Bang YJ: Transcriptional inactivation of the tissue inhibitor of metalloproteinase-3 gene by dna hypermethylation of the 3′-CpG island in human gastric cancer cell lines. Int J Cancer. 86:632–635. 2000. View Article : Google Scholar : PubMed/NCBI

13 

Izawa JI, Slaton JW, Kedar D, Karashima T, Perrotte P, Czerniak B, Grossman HB and Dinney CP: Differential expression of progression-related genes in the evolution of superficial to invasive transitional cell carcinoma of the bladder. Oncol Rep. 8:9–15. 2001.PubMed/NCBI

14 

Hara I, Miyake H, Hara S, Arakawa S and Kamidono S: Significance of matrix metalloproteinases and tissue inhibitors of metalloproteinase expression in the recurrence of superficial transitional cell carcinoma of the bladder. J Urol. 165:1769–1772. 2001. View Article : Google Scholar : PubMed/NCBI

15 

National Institute for Health and Care Excellence: Bladder cancer: Diagnosis and management. NICE Guideline 2. National Collaborating Centre for Cancer (Cardiff). 2015.https://www.nice.org.uk/guidance/ng2/resources/bladder-cancer-diagnosis-and-management-of-bladder-cancer-51036766405Accessed. June 10–2016

16 

Elmamoun MH, Christmas TJ and Woodhouse CR: Destruction of the bladder by single dose Mitomycin C for low-stage transitional cell carcinoma (TCC) - avoidance, recognition, management and consent. BJU Int. 113:E34–E38. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Pommier JD, Ben Lasfar N, Van Grunderbeeck N, Burdet C, Laouénan C, Rioux C, Pierre-Audigier C, Meybeck A, Choudat L, Benchikh A, et al: Complications following intravesical bacillus Calmette-Guerin treatment for bladder cancer: A case series of 22 patients. Infect Dis (Lond). 47:725–731. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

19 

Karam JA, Fan J, Stanfield J, Richer E, Benaim EA, Frenkel E, Antich P, Sagalowsky AI, Mason RP and Hsieh JT: The use of histone deacetylase inhibitor FK228 and DNA hypomethylation agent 5-azacytidine in human bladder cancer therapy. Int J Cancer. 120:1795–1802. 2007. View Article : Google Scholar : PubMed/NCBI

20 

Cecconi D, Donadelli M, Dalla Pozza E, Rinalducci S, Zolla L, Scupoli MT, Righetti PG, Scarpa A and Palmieri M: Synergistic effect of trichostatin A and 5-aza-3′-deoxycytidine on growth inhibition of pancreatic endocrine tumour cell lines: A proteomic study. Proteomics. 9:1952–1966. 2009. View Article : Google Scholar : PubMed/NCBI

21 

Couillard J, Demers M, Lavoie G and St-Pierre Y: The role of DNA hypomethylation in the control of stromelysin gene expression. Biochem Biophys Res Commun. 342:1233–1239. 2006. View Article : Google Scholar : PubMed/NCBI

22 

Sato N, Maehara N, Su GH and Goggins M: Effects of 5-aza-3′-deoxycytidine on matrix metalloproteinase expression and pancreatic cancer cell invasiveness. J Natl Cancer Inst. 95:327–330. 2003. View Article : Google Scholar : PubMed/NCBI

23 

Shukeir N, Pakneshan P, Chen G, Szyf M and Rabbani SA: Alteration of the methylation status of tumor-promoting genes decreases prostate cancer cell invasiveness and tumorigenesis in vitro and in vivo. Cancer Res. 66:9202–9210. 2006. View Article : Google Scholar : PubMed/NCBI

24 

Chen CL, Sung J, Cohen M, Chowdhury WH, Sachs MD, Li Y, Lakshmanan Y, Yung BY, Lupold SE and Rodriguez R: Valproic acid inhibits invasiveness in bladder cancer but not in prostate cancer cells. J Pharmacol Exp Ther. 319:533–542. 2006. View Article : Google Scholar : PubMed/NCBI

25 

Kinoshita T, Sato H, Okada A, Ohuchi E, Imai K, Okada Y and Seiki M: TIMP-2 promotes activation of progelatinase A by membrane-type 1 matrix metalloproteinase immobilized on agarose beads. J Biol Chem. 273:16098–16103. 1998. View Article : Google Scholar : PubMed/NCBI

26 

Devy L, Huang L, Naa L, Yanamandra N, Pieters H, Frans N, Chang E, Tao Q, Vanhove M, Lejeune A, et al: Selective inhibition of matrix metalloproteinase-14 blocks tumor growth, invasion, and angiogenesis. Cancer Res. 69:1517–1526. 2009. View Article : Google Scholar : PubMed/NCBI

27 

Itoh Y and Seiki M: MT1-MMP: A potent modifier of pericellular microenvironment. J Cell Physiol. 206:1–8. 2006. View Article : Google Scholar : PubMed/NCBI

28 

Leeman MF, Curran S and Murray GI: The structure, regulation, and function of human matrix metalloproteinase-13. Crit Rev Biochem Mol Biol. 37:149–66. 2002. View Article : Google Scholar : PubMed/NCBI

29 

Kitagawa Y, Kunimi K, Ito H, Sato H, Uchibayashi T, Okada Y, Seiki M and Namiki M: Expression and tissue localization of membrane-types 1, 2, and 3 matrix metalloproteinases in human urothelial carcinomas. J Urol. 160:1540–1545. 1998. View Article : Google Scholar : PubMed/NCBI

30 

Moon JW, Choi JH, Lee SK, Lee YW, Lee JO, Kim N, Lee HJ, Seo JS, Kim J, Kim HS, et al: Promoter hypermethylation of membrane type 3 matrix metalloproteinase is associated with cell migration in colorectal adenocarcinoma. Cancer Genet. 208:261–270. 2015. View Article : Google Scholar : PubMed/NCBI

31 

Baker AH, George SJ, Zaltsman AB, Murphy G and Newby AC: Inhibition of invasion and induction of apoptotic cell death of cancer cell lines by overexpression of TIMP-3. Br J Cancer. 79:1347–1355. 1999. View Article : Google Scholar : PubMed/NCBI

32 

Fata JE, Leco KJ, Voura EB, Yu HY, Waterhouse P, Murphy G, Moorehead RA and Khokha R: Accelerated apoptosis in the Timp-3-deficient mammary gland. J Clin Invest. 108:831–841. 2001. View Article : Google Scholar : PubMed/NCBI

33 

Valente P, Fassina G, Melchiori A, Masiello L, Cilli M, Vacca A, Onisto M, Santi L, Stetler-Stevenson WG and Albini A: TIMP-2 over-expression reduces invasion and angiogenesis and protects B16F10 melanoma cells from apoptosis. Int J Cancer. 75:246–253. 1998. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Brockmeyer P and Hemmerlein B: Epigenetic modification suppresses proliferation, migration and invasion of urothelial cancer cell lines. Oncol Lett 12: 1693-1700, 2016.
APA
Brockmeyer, P., & Hemmerlein, B. (2016). Epigenetic modification suppresses proliferation, migration and invasion of urothelial cancer cell lines. Oncology Letters, 12, 1693-1700. https://doi.org/10.3892/ol.2016.4877
MLA
Brockmeyer, P., Hemmerlein, B."Epigenetic modification suppresses proliferation, migration and invasion of urothelial cancer cell lines". Oncology Letters 12.3 (2016): 1693-1700.
Chicago
Brockmeyer, P., Hemmerlein, B."Epigenetic modification suppresses proliferation, migration and invasion of urothelial cancer cell lines". Oncology Letters 12, no. 3 (2016): 1693-1700. https://doi.org/10.3892/ol.2016.4877
Copy and paste a formatted citation
x
Spandidos Publications style
Brockmeyer P and Hemmerlein B: Epigenetic modification suppresses proliferation, migration and invasion of urothelial cancer cell lines. Oncol Lett 12: 1693-1700, 2016.
APA
Brockmeyer, P., & Hemmerlein, B. (2016). Epigenetic modification suppresses proliferation, migration and invasion of urothelial cancer cell lines. Oncology Letters, 12, 1693-1700. https://doi.org/10.3892/ol.2016.4877
MLA
Brockmeyer, P., Hemmerlein, B."Epigenetic modification suppresses proliferation, migration and invasion of urothelial cancer cell lines". Oncology Letters 12.3 (2016): 1693-1700.
Chicago
Brockmeyer, P., Hemmerlein, B."Epigenetic modification suppresses proliferation, migration and invasion of urothelial cancer cell lines". Oncology Letters 12, no. 3 (2016): 1693-1700. https://doi.org/10.3892/ol.2016.4877
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team