Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
October-2016 Volume 12 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2016 Volume 12 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Tumor‑suppressing effects of microRNA‑429 in human renal cell carcinoma via the downregulation of Sp1

  • Authors:
    • Deyao Wu
    • Xiaobing Niu
    • Huixing Pan
    • Yunfeng Zhou
    • Zichun Zhang
    • Ping Qu
    • Jian Zhou
  • View Affiliations / Copyright

    Affiliations: Department of Urology, The Fourth Affiliated Hospital of Nantong Medical College, Yancheng City No. 1 People's Hospital, Yancheng, Jiangsu 224001, P.R. China, Department of Urology, Huai'An First People's Hospital, Nanjing Medical University, Huai'an, Jiangsu 223300, P.R. China
  • Pages: 2906-2911
    |
    Published online on: August 5, 2016
       https://doi.org/10.3892/ol.2016.4953
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

MicroRNA (miR)-429 has been frequently reported to be downregulated in various tumors, including renal cell carcinoma (RCC), nasopharyngeal carcinoma, Ehrlich ascites tumor cells, gastric cancer, non‑small cell lung cancer and endometrial endometrioid carcinoma. The present study investigated the effects of miR‑429 on human RCC A498 and 786‑O cells. Following transfection of cells with miR‑429 mimics and scrambled control, MTT, cell migration, cell invasion and luciferase assays were performed. In addition, western blotting was performed in order to assess the expression of specificity protein 1 (Sp1), which was predicted to be a target of miR‑429 by TargetScan. The present results revealed that miR‑429 inhibited cell proliferation, migration and invasion of 786‑O and A498 cells. In addition, the present results demonstrated that miR‑429 overexpression downregulated Sp1 protein expression, which provides evidence that miR‑429 may directly target Sp1 in RCC. These results suggest that miR‑429 may be investigated for use as a predictive marker for early detection of tumor metastasis and blocking RCC cells from becoming invasive.

Introduction

Renal cell carcinoma (RCC) represents the most common malignancy of the adult kidney and comprises 2–3% of all malignant tumors in adults (1). In 2014, there were 63,920 novel cases of kidney cancer diagnosed in the USA (2). RCC accounts for ~90% of all kidney malignancies, with a rising incidence over the past decade (3). RCC is an epithelial neoplasm, since it originates from the transformation of cells that constitute the epithelium of the proximal convoluted tubule (4). RCC includes several histological subtypes that possess distinct biological behaviors and prognoses. The principal histological subtypes are as follows: Clear cell RCC (75–80% of RCC); papillary or chromophile RCC (10–15%); and chromophobe RCC (4–6%) (4). Although the majority of patients with early-stage RCC may be cured surgically, 10–20% of patients present with metastasis at the time of diagnosis (5–7). In addition, ~50% of RCC patients that have undergone curative surgery may be expected to develop a recurrence with distant metastasis, and the prognosis of RCC patients with metastatic or recurrent disease is poor, with a 5-year survival rate of <20% (8). The most common sites of metastatic spread in RCC are lung, bone, adrenal gland, liver and brain, and more than one organ is often involved (9). Therefore, the molecular mechanisms of cancer cell dissemination from the primary tumor are important when considering treatment and observational strategies for RCC patients.

MicroRNAs (miRs) are 21–25 nucleotide single-stranded, non-coding RNA molecules that exert their functions by binding to the 3′-untranslated regions (UTRs) of their corresponding mRNA targets, which leads to target mRNA cleavage or translational repression (10). It has been widely accepted that miRs are important in numerous biological processes, including differentiation, proliferation, apoptosis, cell cycle, migration and invasion (11). Research has revealed that a single miR targets hundreds of mRNAs, and ~50% of miR genes are located in cancer-associated chromosomal regions (12). In addition, mature miRs regulate the expression of ~10–30% of all human genes (13). miRs function as either tumor suppressors or oncogenes, depending on the genes that they target (14); tumor suppressive miRs are usually downregulated, while oncogenic miRs are upregulated in cancer (15). Recent evidence indicates that the aberrant regulation of miRs are important in RCC pathogenesis (16). Therefore, miRs are being investigated as potential biomarkers for diagnosis and prognosis of human malignancies, due to their tissue and disease-specific expression and regulatory functions (17).

miR-429 has been frequently reported to be downregulated in various tumors, including RCC (18), nasopharyngeal carcinoma (19), Ehrlich ascites tumor cells (20), gastric cancer (21), non-small cell lung cancer (22) and endometrial endometrioid carcinoma (23). However, the function of miR-429 has yet to be elucidated in RCC. The aim of the present study was to investigate the effect of miR-429 on RCC and to elucidate its underlying mechanisms.

Materials and methods

Cell culture and transfection

Human RCC 786-O and A498 cell lines were purchased from the Shanghai Institute of Cell Biology, Chinese Academy of Science (Shanghai, China). The cells were cultured in RPMI-1640 medium (Gibco®; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% heat-inactivated fetal calf serum (FCS; Gibco®), 100 U/ml penicillin and 100 mg/l streptomycin. Cultures were maintained at 37°C in a humidified atmosphere with 5% CO2.

Mature miR-429 mimics (UAAUACUGUCUGGUAAAACCGU), scrambled control (NC; UUCUCCGAACGUGUCACGUTT) and luciferase reporter plasmid were purchased from Shanghai GenePharma Co., Ltd. (Shanghai, China). Transient transfection of miR-429 mimics and/or plasmid were performed using Lipofectamine® 2000 (Invitrogen™; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol.

Cell viability assay

A MTT assay was used to estimate the proliferation ability of the cells. Cells transfected with miR-429 mimics or NC were seeded in 96-well plates at a density of 3,000 cells/well for 24, 48, 72, 96, 120 and 144 h. Briefly, the cells were incubated with 20 ml MTT (5 mg/ml) for 4 h at 37°C. The plates were agitated and 200 µl dimethyl sulfoxide was added to solubilize the crystals for 20 min following the removal of the culture supernatant. Absorbance was measured at 490 nm using an automatic multi-well spectrophotometer (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The suppression rate was calculated using the following formula: Suppression rate = [1 - optical density (ODmiR-429 / ODNC)] × 100. All the experiments were performed in triplicate.

Cell migration and invasion assay

Cell migration and invasion assays were evaluated using Transwell chambers (Corning Incorporated, Corning, NY, USA). The upper and lower culture compartments were separated by polycarbonate filters with a 8 mm pore size. Prior to the invasion assays, the filters of the Transwell chambers were coated with 30 µg Matrigel (BD Biosciences, San Jose, CA, USA) to form a reconstituted basement membrane. Transfected cells (miR-429 mimics and NC) in the log phase were treated with trypsin/EDTA solution, washed once with serum-containing RPMI-1640 medium, centrifuged (at 200 × g for 10 min) and re-suspended as single-cell solutions. A total of 1×105 cells in 0.2 ml serum-free RPMI-1640 medium were seeded into the Transwell chambers. The lower chamber contained RPMI −1640 supplemented with 20% FCS to stimulate invasion. The cells were incubated for 12 h for the migration assay and 24 h for the invasion assay. Non-migrating and -invading cells on the top of the membrane were removed by scraping. Cells that migrated to the bottom surface of the insert were fixed with 100% methanol, stained with 0.5% crystal violet, and subjected to microscopic inspection (magnification, ×200). Values for invasion and migration were obtained by counting five fields per membrane, and represent the average of three independent experiments.

Western blotting

Western blotting was performed as described previously (24). Primary antibodies used in the present study were rabbit anti-human specificity protein 1 (SP1) monoclonal antibody (1:1,000 dilution; catalog no. 9389; Cell Signaling Technology, Inc., Danvers, MA, USA) and rabbit anti-human anti-β-actin monoclonal antibody (1:1,000 dilution; catalog no. AP0060; Bioworld Technology, Inc., Louis Park, MN, USA). Total protein was extracted using ice-cold radioimmunoprecipitation assay buffer (Beyotime Institute of Biotechnology, Jiangsu, Haimen, China). Equal amounts of protein were subjected to 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membranes (Bio-Rad Laboratories, Inc.). Following blocking with 5% non-fat milk in Tris-buffered saline with 0.1% Tween 20, the membranes were incubated overnight at 4°C with the appropriate primary antibody. Following washing, the blots were incubated with goat anti-rabbit horseradish peroxidase-conjugated secondary antibody (1:2,000 dilution; catalog no. 7074; Cell Signaling Technology, Inc.) at room temperature for 1 h. The intensity of each blot was read and analyzed with AlphaEaseFC™ software (version 4.0.1; Cell Biosciences, Palo Alto, CA, USA). β-actin was used as a loading control.

Luciferase assay

Reporter plasmids (pmirGLO-SP1-3′UTR wild-type and pmirGLO-SP1-3′UTR mutant) were synthesized and purified by GenePharma. Cells were plated in a 12-well plate at ~90% confluence and transfected with reporter plasmid, miR-429 mimics or NC using Lipofectamine 2000. Each sample was also cotransfected with 0.05 µg pRL-CMV plasmid expressing Renilla Luciferase (Promega Corporation, Madison, WI, USA), as an internal control for transfection efficiency. Subsequent to 24 h, luciferase activity was measured using the Dual-Luciferase® Reporter Assay System (Promega Corporation), according to the manufacturer's protocol. Firefly luciferase activities and Renilla luciferase activities were measured with a luminometer (Tecan Group, Ltd, Männedorf, Switzerland). Each assay was replicated three times.

Statistical analysis

Data are presented as the mean ± standard deviation, and compared using Student's t-test in Stata version 10.0 software (StataCorp LP, College Station, TX, USA). Double-tailed P<0.05 was considered to indicate a statistically significant difference.

Results

miR-429 suppresses cell proliferation in RCC cell lines

MTT assays were employed to detect the proliferation of 786-O and A498 cell lines following transfection with miR-429 or NC. As shown in Fig. 1, overexpression of miR-429 in 786-O and A498 cells inhibited cell proliferation. Compared with the NC-transfected cells, the suppression rate of miR-429 reached 33.50±2.90% in 786-O cells (P=0.010) and 43.31±4.20% in A498 cells (P=0.002) following 144 h of treatment.

Figure 1.

Cell proliferation was analyzed by MTT assay in human RCC 786-O and A498 cell lines. A growth curve is shown for each treatment at 0, 24, 48, 72, 96, 120 and 144 h following transfection of cells with miR-429 mimics and NC. The results indicated that upregulation of miR-429 significantly suppressed cell proliferation in RCC cell lines. *P<0.05 vs. NC-transfected cells. miR, microRNA; RCC, renal cell carcinoma; NC, scrambled control.

miR-429 inhibits cell migration and invasion in RCC cell lines

To determine whether miR-429 regulates human RCC cell migration and invasion, migration and invasion assays were performed on miR-429 mimic- and NC-transfected RCC 786-O and A498 cell lines. As expected, overexpression of miR-429 significantly decreased the migration (P=0.024 for 786-O cells and P=0.029 for A498 cells) and invasion (P=0.020 for 786-O cells and P=0.039 for A498 cells) capability of the 786-O and A498 cells (Fig. 2). These observations indicated that miR-429 was a negative regulator of RCC migration and invasion.

Figure 2.

Inhibition of tumor cell migration and invasion by miR-429 in human renal cell carcinoma 786-O and A498 cell lines. The results indicated that miR-429 inhibited cell migration and invasion in 786-O and A498 cells compared with NC-transfected cells (magnification, ×200). *P<0.05 vs. NC. miR, microRNA; NC, scrambled control.

miR-429 suppresses the expression of Sp1 in RCC cell lines

TargetScan (version 5.2; www.targetscan.org) predicted that Sp1 was a direct target gene of miR-429, and revealed that Sp1 mRNA contained a miR-429 7-nucleotide seed match at position 2490–2496 of the Sp1 3′-UTR (Fig. 3A).

Figure 3.

(A) TargetScan version 5.2 revealed that Sp1 mRNA contained a miR-429 7-nucleotide seed match at position 2490–2496 of the Sp1 3′-UTR. (B) Sp1 protein expression was significantly decreased in human renal cell carcinoma 786-O and A498 cells following transfection with miR-429 mimic. *P<0.05 vs. NC. miR, microRNA; NC, scrambled control; Sp1, specificity protein 1; UTR, untranslated region.

Therefore, the present study performed western blot analysis to investigate whether Sp1 protein level was decreased following overexpression of miR-429. As shown in Fig. 3B, Sp1 was significantly decreased in 786-O (P=0.018) and A498 cell lines (P=0.012) 72 h subsequent to transfection of miR-429 compared with cells transfected with NC. These data reveal that Sp1 is a direct functional target of miR-429.

Sp1 is a direct target of miR-429

To further confirm that Sp1 is a direct target for miR-429, a luciferase reporter assay was performed in RCC 786-O and A498 cell lines. As shown by Fig. 4, transfection of cells with miR-429 mimic significantly decreased the Sp1 3′-UTR luciferase reporter activity compared with cells transfected with NC. Overexpression of miR-429 suppressed Sp1 3′-UTR-luciferase activity by 63% in 786-O cells (P=0.020) and 44% in A498 cells (P=0.034). In addition, this effect was abolished when the nucleotides in the seed binding sites of the Sp1 3′-UTR were mutated (Fig. 4).

Figure 4.

Sp1 may be a direct target of miR-429 in vitro. miR-429 suppressed Sp1 3′-UTR-luciferase activity by 63 and 44% in human renal cell carcinoma 786-O and A498 cells, respectively, following transfection with miR-429 mimic. This effect was abolished with Sp1 3′-UTR Mut. *P<0.05 vs. NC. miR, microRNA; NC, scrambled control; Sp1, specificity protein 1; Mut, mutated; UTR, untranslated region.

The present results suggest that Sp1 is a target gene of miR-429.

Discussion

miR-429 belongs to a small miR family, which includes miR-200c, miR-141, miR-200b and miR-200a (25), and is located on chromosome 1. Downregulation of miR-429 may be important in tumor progression, and previous studies have revealed that miR-429 is frequently downregulated in various tumors, including RCC (18), nasopharyngeal carcinoma (19), Ehrlich ascites tumor cells (20), gastric cancer (21), non-small cell lung cancer (22) and endometrial endometrioid carcinoma (23). However, miR-429 has been demonstrated to be upregulated in bladder cancer, and an increased expression was correlated with poor prognosis in serous ovarian carcinoma patients (26,27). Therefore, miR-429 appears to be involved in carcinogenesis and cancer progression, and plays various roles depending on the type of cancer.

In gastric cancer, miR-429 inhibits the proliferation, migration and invasion of tumor cells. In addition, the expression levels of miR-429 in the tissues of gastric cancer patients with lymph node metastasis were significantly lower compared with patients without lymph node metastasis (28). In colorectal cancer, miR-429 was revealed to be significantly downregulated in the majority of tumor tissues investigated, particularly tissue from stages II and III, relative to adjacent or distant normal mucosa. Survival analysis also indicated a low expression of miR-429 is significantly associated with poor prognosis (29). Upregulation of miR-429 suppressed cell growth, invasion and the expression of epithelial-mesenchymal transition-association marker genes, including E-cadherin, catenin (CTNN) A1, CTNNB1, transferring N-terminal half-molecule, cluster of differentiation 44, matrix metallopeptidase 2, vimentin, Slug, Snail and zinc finger E-box binding homeobox (ZEB) 2 (18). These results suggest that downregulation of miR-429 in tumour cells may play a role in the development of cancer by enhancing cell proliferation and promoting cell migration and invasion.

Identification of miR-429 target genes is critical for understanding the role of miR-429 in tumorigenesis, and is important for defining novel therapeutic targets. Previous studies have demonstrated that miR-429 regulates oncogenic expression in human cells, including c-myc (28), onecut 2 (18), ZEB1 (30), v-crk avian sarcoma virus CT10 oncogene homolog-like (31) and B-cell lymphoma 2 (32). Therefore, upregulation of miR-429 or providing analogous pharmaceutical compounds exogenously may be effective cancer therapy for RCC, leading to the regulation of these oncogenic transcripts. The present results suggest multiple inhibitory effects of miR-429 in human RCC 786-O and A498 cell lines, including cell proliferation and invasion suppression, via the downregulation of the expression of Sp1. The present findings suggest that miR-429 may be used for the development of novel molecular markers and therapeutics for RCC.

Sp1 is an ubiquitously expressed transcription factor, and was the first transcription factor to be cloned from mammalian cells in 1983 (33). It maps to 12q13.1 and encodes a protein of 785 amino acids (34). Sp1 recognizes GC-rich regions and binds to DNA through three C2H2-type zinc fingers in the C-terminal domain (35,36). Each zinc finger of Sp1 recognizes three bases in one strand and a single base in the complementary strand, constituting a consensus binding sequence of 5′-(G/T) GGGCGG (G/A) (G/A) (C/T)-3′ (37). Originally, Sp1 was considered to be a general transcription factor required for transcription of a large number of ‘housekeeping genes’ (38). However, recently a study has indicated that many of these housekeeping genes are crucial in tumorigenesis and cancer progression (39). Consequently, Sp1 has been demonstrated to be important in tumor progression, including cell proliferation, angiogenesis, differentiation, apoptosis, migration and invasion, revealing it as an ideal target for cancer treatment (40).

Sp1 has been identified to be upregulated in various types of human cancer, including breast carcinoma (41), thyroid cancer (42), hepatocellular carcinoma (43), pancreatic cancer (44), colorectal cancer (45), gastric cancer (46) and lung cancer (47). Sp1 expression is tightly regulated throughout the various stages of tumorigenesis, which affects cancer progression (48). Previous studies concerning Sp1 expression in tumorigenesis suggest that increased transcription is the most important mechanism for Sp1 accumulation during cancer formation (49,50). Sp1 contributes to cancer progression and is regulated by many miRs. In non-small cell lung cancer cells, miR-335 and miR-27b suppressed the proliferation, invasion and induced apoptosis in cells by targeting Sp1 (51,52). In prostate cancer, Mao et al (53) demonstrated that miR-330 suppressed cell motility by targeting Sp1. In squamous cervical cancer, Wang et al (54) revealed that miR-375 inhibited cell migration and invasion by targeting Sp1. The present study revealed that miR-429 suppressed RCC cell viability, migration and invasion via the downregulation of Sp1. Therefore, Sp1 may be investigated as a predictive marker for the early detection of tumor recurrence, and be used in therapeutics to block RCC cells from becoming invasive.

In summary, the present study is, to the best of our knowledge, the first study to demonstrate that miR-429 contributes to cell viability, migration and invasion in RCC. The identification of candidate target genes of miR-429, such as Sp1, may provide an understanding of the potential carcinogenic mechanisms in RCC. These findings have therapeutic implications and may be used for novel treatment strategies for RCC.

References

1 

Escudier B: Emerging immunotherapies for renal cell carcinoma. Ann Oncol. 23(Suppl 8): viii35–viii40. 2012. View Article : Google Scholar : PubMed/NCBI

2 

Siegel R, Ma J, Zou Z and Jemal A: Cancer statistics, 2014. CA Cancer J Clin. 64:9–29. 2014. View Article : Google Scholar : PubMed/NCBI

3 

Xu S, Wu H, Nie H, Yue L, Jiang H, Xiao S and Li Y: AIF downregulation and its interaction with STK3 in renal cell carcinoma. PLoS One. 9:e1008242014. View Article : Google Scholar : PubMed/NCBI

4 

Srigley JR, Delahunt B, Eble JN, Egevad L, Epstein JI, Grignon D, Hes O, Moch H, Montironi R, Tickoo SK, et al: The international society of urological pathology (ISUP) vancouver classification of renal neoplasia. Am J Surg Pathol. 37:1469–1489. 2013. View Article : Google Scholar : PubMed/NCBI

5 

Yang YQ and Chen J: Predictive role of vascular endothelial growth factor polymorphisms in the survival of renal cell carcinoma patients. Genet Mol Res. 13:5011–5017. 2014. View Article : Google Scholar : PubMed/NCBI

6 

Flanigan RC, Campbell SC, Clark JI and Picken MM: Metastatic renal cell carcinoma. Curr Treat Options Oncol. 4:385–390. 2003. View Article : Google Scholar : PubMed/NCBI

7 

Athar U and Gentile TC: Treatment options for metastatic renal cell carcinoma: A review. Can J Urol. 15:3954–3966. 2008.PubMed/NCBI

8 

Irani J: Sunitinib versus interferon-alpha in metastatic renal-cell carcinoma. Prog Urol. 17:9962007.(In French). View Article : Google Scholar : PubMed/NCBI

9 

Toma MI, Erdmann K, Diezel M, Meinhardt M, Zastrow S, Fuessel S, Wirth MP and Baretton GB: Lack of ephrin receptor A1 is a favorable independent prognostic factor in clear cell renal cell carcinoma. PLoS One. 9:e1022622014. View Article : Google Scholar : PubMed/NCBI

10 

Lai EC: Micro RNAs are complementary to 3′ UTR sequence motifs that mediate negative post-transcriptional regulation. Nat Genet. 30:363–364. 2002. View Article : Google Scholar : PubMed/NCBI

11 

Miao J, Wu S, Peng Z, Tania M and Zhang C: MicroRNAs in osteosarcoma: Diagnostic and therapeutic aspects. Tumour Biol. 34:2093–2098. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Ma XP, Zhang T, Peng B, Yu L and Jiang de K: Association between microRNA polymorphisms and cancer risk based on the findings of 66 case-control studies. PLoS One. 8:e795842013. View Article : Google Scholar : PubMed/NCBI

13 

Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH and Cuppen E: Phylogenetic shadowing and computational identification of human microRNA genes. Cell. 120:21–24. 2005. View Article : Google Scholar : PubMed/NCBI

14 

Cimmino A, Calin GA, Fabbri M, Iorio MV, Ferracin M, Shimizu M, Wojcik SE, Aqeilan RI, Zupo S, Dono M, et al: miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci USA. 102:13944–13949. 2005. View Article : Google Scholar : PubMed/NCBI

15 

Lee YS and Dutta A: MicroRNAs in cancer. Annu Rev Pathol. 4:199–227. 2009. View Article : Google Scholar : PubMed/NCBI

16 

Xu X, Wu J, Li S, Hu Z, Xu X, Zhu Y, Liang Z, Wang X, Lin Y, Mao Y, et al: Downregulation of microRNA-182-5p contributes to renal cell carcinoma proliferation via activating the AKT/FOXO3a signaling pathway. Mol Cancer. 13:1092014. View Article : Google Scholar : PubMed/NCBI

17 

Bartels CL and Tsongalis GJ: MicroRNAs: Novel biomarkers for human cancer. Ann Biol Clin (Paris). 68:263–272. 2010.(In French). PubMed/NCBI

18 

Sun Y, Shen S, Liu X, Tang H, Wang Z, Yu Z, Li X and Wu M: MiR-429 inhibits cells growth and invasion and regulates EMT-related marker genes by targeting Onecut2 in colorectal carcinoma. Mol Cell Biochem. 390:19–30. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Bartis D, Mise N, Mahida RY, Eickelberg O and Thickett DR: Epithelial-mesenchymal transition in lung development and disease: Does it exist and is it important? Thorax. 69:760–765. 2014. View Article : Google Scholar : PubMed/NCBI

20 

Said NA and Williams ED: Growth factors in induction of epithelial-mesenchymal transition and metastasis. Cells Tissues Organs. 193:85–97. 2011. View Article : Google Scholar : PubMed/NCBI

21 

Yang J and Weinberg RA: Epithelial-mesenchymal transition: At the crossroads of development and tumor metastasis. Dev Cell. 14:818–829. 2008. View Article : Google Scholar : PubMed/NCBI

22 

Zhu W, He J, Chen D, Zhang B, Xu L, Ma H, Liu X, Zhang Y and Le H: Expression of miR-29c, miR-93, and miR-429 as potential biomarkers for detection of early stage non-small lung cancer. PLoS One. 9:e877802014. View Article : Google Scholar : PubMed/NCBI

23 

Miyazono K: Transforming growth factor-beta signaling in epithelial-mesenchymal transition and progression of cancer. Proc Jpn Acad Ser B Phys Biol Sci. 85:314–323. 2009. View Article : Google Scholar : PubMed/NCBI

24 

Wu D, Zhou Y, Pan H, Zhou J, Fan Y and Qu P: microRNA-99a inhibiting cell proliferation, migration and invasion by targeting fibroblast growth factor receptor 3 in bladder cancer. Oncol Lett. 7:1219–1224. 2014.PubMed/NCBI

25 

Hu X, Macdonald DM, Huettner PC, Feng Z, El Naqa IM, Schwarz JK, Mutch DG, Grigsby PW, Powell SN and Wang X: A miR-200 microRNA cluster as prognostic marker in advanced ovarian cancer. Gynecol Oncol. 114:457–464. 2009. View Article : Google Scholar : PubMed/NCBI

26 

Xie P, Xu F, Cheng W, Gao J, Zhang Z, Ge J, Wei Z, Xu X and Liu Y: Infiltration related miRNAs in bladder urothelial carcinoma. J Huazhong Univ Sci Technolog Med Sci. 32:576–580. 2012. View Article : Google Scholar : PubMed/NCBI

27 

Nam EJI, Yoon H, Kim SW, Kim H, Kim YT, Kim JH, Kim JW and Kim S: MicroRNA expression profiles in serous ovarian carcinoma. Clin Cancer Res. 14:2690–2695. 2008. View Article : Google Scholar : PubMed/NCBI

28 

Sun T, Wang C, Xing J and Wu D: miR-429 modulates the expression of c-myc in human gastric carcinoma cells. Eur J Cancer. 47:2552–2559. 2011. View Article : Google Scholar : PubMed/NCBI

29 

Sun Y, Shen S, Tang H, Xiang J, Peng Y, Tang A, Li N, Zhou W, Wang Z, Zhang D, et al: miR-429 identified by dynamic transcriptome analysis is a new candidate biomarker for colorectal cancer prognosis. OMICS. 18:54–64. 2014. View Article : Google Scholar : PubMed/NCBI

30 

Liu X, Liu Y, Wu S, Shi X, Li L, Zhao J and Xu H: Tumor-suppressing effects of miR-429 on human osteosarcoma. Cell Biochem Biophys. 70:215–224. 2014. View Article : Google Scholar : PubMed/NCBI

31 

Ye ZB, Ma G, Zhao YH, Xiao Y, Zhan Y, Jing C, Gao K, Liu ZH and Yu SJ: miR-429 inhibits migration and invasion of breast cancer cells in vitro. Int J Oncol. 46:531–538. 2015.PubMed/NCBI

32 

Wang Y, Li M, Zang W, Ma Y, Wang N, Li P, Wang T and Zhao G: MiR-429 up-regulation induces apoptosis and suppresses invasion by targeting Bcl-2 and SP-1 in esophageal carcinoma. Cell Oncol (Dordr). 36:385–394. 2013. View Article : Google Scholar : PubMed/NCBI

33 

Dynan WS and Tjian R: The promoter-specific transcription factor Sp1 binds to upstream sequences in the SV40 early promoter. Cell. 35:79–87. 1983. View Article : Google Scholar : PubMed/NCBI

34 

Chang WC and Hung JJ: Functional role of post-translational modifications of Sp1 in tumorigenesis. J Biomed Sci. 19:942012. View Article : Google Scholar : PubMed/NCBI

35 

Kadonaga JT, Courey AJ, Ladika J and Tjian R: Distinct regions of Sp1 modulate DNA binding and transcriptional activation. Science. 242:1566–1570. 1988. View Article : Google Scholar : PubMed/NCBI

36 

Philipsen S and Suske G: A tale of three fingers: The family of mammalian Sp/XKLF transcription factors. Nucleic Acids Res. 27:2991–3000. 1999. View Article : Google Scholar : PubMed/NCBI

37 

Narayan VA, Kriwacki RW and Caradonna JP: Structures of zinc finger domains from transcription factor Sp1. Insights into sequence-specific protein-DNA recognition. J Biol Chem. 272:7801–7809. 1997. View Article : Google Scholar : PubMed/NCBI

38 

Black AR, Black JD and Azizkhan-Clifford J: Sp1 and krüppel-like factor family of transcription factors in cell growth regulation and cancer. J Cell Physiol. 188:143–160. 2001. View Article : Google Scholar : PubMed/NCBI

39 

Beishline K and Azizkhan-Clifford J: Sp1 and the ‘Hallmarks of Cancer’. FEBS J. 282:224–258. 2015. View Article : Google Scholar : PubMed/NCBI

40 

Sankpal UT, Goodison S, Abdelrahim M and Basha R: Targeting Sp1 transcription factors in prostate cancer therapy. Med Chem. 7:518–525. 2011. View Article : Google Scholar : PubMed/NCBI

41 

Yue L, Li L, Liu F, Hu N, Zhang W, Bai X, Li Y, Zhang Y, Fu L, Zhang X and Ye L: The oncoprotein HBXIP activates transcriptional coregulatory protein LMO4 via Sp1 to promote proliferation of breast cancer cells. Carcinogenesis. 34:927–935. 2013. View Article : Google Scholar : PubMed/NCBI

42 

Bonofiglio D, Qi H, Gabriele S, Catalano S, Aquila S, Belmonte M and Andò S: Peroxisome proliferator-activated receptor gamma inhibits follicular and anaplastic thyroid carcinoma cells growth by upregulating p21Cip1/WAF1 gene in a Sp1-dependent manner. Endocr Relat Cancer. 15:545–557. 2008. View Article : Google Scholar : PubMed/NCBI

43 

Yin P, Zhao C, Li Z, Mei C, Yao W, Liu Y, Li N, Qi J, Wang L, Shi Y, et al: Sp1 is involved in regulation of cystathionine gamma-lyase gene expression and biological function by PI3K/Akt pathway in human hepatocellular carcinoma cell lines. Cell Signal. 24:1229–1240. 2012. View Article : Google Scholar : PubMed/NCBI

44 

Huang C and Xie K: Crosstalk of Sp1 and Stat3 signaling in pancreatic cancer pathogenesis. Cytokine Growth Factor Rev. 23:25–35. 2012. View Article : Google Scholar : PubMed/NCBI

45 

Pathi S, Jutooru I, Chadalapaka G, Nair V, Lee SO and Safe S: Aspirin inhibits colon cancer cell and tumor growth and downregulates specificity protein (Sp) transcription factors. PLoS One. 7:e482082012. View Article : Google Scholar : PubMed/NCBI

46 

Xu Y, Zhao F, Wang Z, Song Y, Luo Y, Zhang X, Jiang L, Sun Z, Miao Z and Xu H: MicroRNA-335 acts as a metastasis suppressor in gastric cancer by targeting Bcl-w and specificity protein 1. Oncogene. 31:1398–1407. 2012. View Article : Google Scholar : PubMed/NCBI

47 

Wang YT, Chuang JY, Shen MR, Yang WB, Chang WC and Hung JJ: Sumoylation of specificity protein 1 augments its degradation by changing the localization and increasing the specificity protein 1 proteolytic process. J Mol Biol. 380:869–885. 2008. View Article : Google Scholar : PubMed/NCBI

48 

Hsu TI, Wang MC, Chen SY, Yeh YM, Su WC, Chang WC and Hung JJ: Sp1 expression regulates lung tumor progression. Oncogene. 31:3973–3988. 2012. View Article : Google Scholar : PubMed/NCBI

49 

Trisciuoglio D, Iervolino A, Candiloro A, Fibbi G, Fanciulli M, ZangemeisterWittke U, Zupi G and Del Bufalo D: Bcl-2 induction of urokinase plasminogen activator receptor expression in human cancer cells through Sp1 activation: involvement of ERK1/ERK2 activity. J Biol Chem. 279:6737–6745. 2004. View Article : Google Scholar : PubMed/NCBI

50 

DeSiervi A, Marinissen M, Diggs J, Wang XF, Pages G and Senderowicz A: Transcriptional activation of p21 (waf1/cip1) by alkylphospholipids: Role of the mitogen-activated protein kinase pathway in the transactivation of the human p21(waf1/cip1) promoter by Sp1. Cancer Res. 64:743–750. 2004. View Article : Google Scholar : PubMed/NCBI

51 

Wang H, Li M, Zhang R, Wang Y, Zang W, Ma Y, Zhao G and Zhang G: Effect of miR-335 upregulation on the apoptosis and invasion of lung cancer cell A549 and H1299. Tumour Biol. 34:3101–3109. 2013. View Article : Google Scholar : PubMed/NCBI

52 

Jiang J, Lv X, Fan L, Huang G, Zhan Y, Wang M and Lu H: MicroRNA-27b suppresses growth and invasion of NSCLC cells by targeting Sp1. Tumour Biol. 35:10019–10023. 2014. View Article : Google Scholar : PubMed/NCBI

53 

Mao Y, Chen H, Lin Y, Xu X, Hu Z, Zhu Y, Wu J, Xu X, Zheng X and Xie L: microRNA-330 inhibits cell motility by downregulating Sp1 in prostate cancer cells. Oncol Rep. 30:327–333. 2013.PubMed/NCBI

54 

Wang F, Li Y, Zhou J, Xu J, Peng C, Ye F, Shen Y, Lu W, Wan X and Xie X: miR-375 is down-regulated in squamous cervical cancer and inhibits cell migration and invasion via targeting transcription factor SP1. Am J Pathol. 179:2580–2588. 2011. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wu D, Niu X, Pan H, Zhou Y, Zhang Z, Qu P and Zhou J: Tumor‑suppressing effects of microRNA‑429 in human renal cell carcinoma via the downregulation of Sp1. Oncol Lett 12: 2906-2911, 2016.
APA
Wu, D., Niu, X., Pan, H., Zhou, Y., Zhang, Z., Qu, P., & Zhou, J. (2016). Tumor‑suppressing effects of microRNA‑429 in human renal cell carcinoma via the downregulation of Sp1. Oncology Letters, 12, 2906-2911. https://doi.org/10.3892/ol.2016.4953
MLA
Wu, D., Niu, X., Pan, H., Zhou, Y., Zhang, Z., Qu, P., Zhou, J."Tumor‑suppressing effects of microRNA‑429 in human renal cell carcinoma via the downregulation of Sp1". Oncology Letters 12.4 (2016): 2906-2911.
Chicago
Wu, D., Niu, X., Pan, H., Zhou, Y., Zhang, Z., Qu, P., Zhou, J."Tumor‑suppressing effects of microRNA‑429 in human renal cell carcinoma via the downregulation of Sp1". Oncology Letters 12, no. 4 (2016): 2906-2911. https://doi.org/10.3892/ol.2016.4953
Copy and paste a formatted citation
x
Spandidos Publications style
Wu D, Niu X, Pan H, Zhou Y, Zhang Z, Qu P and Zhou J: Tumor‑suppressing effects of microRNA‑429 in human renal cell carcinoma via the downregulation of Sp1. Oncol Lett 12: 2906-2911, 2016.
APA
Wu, D., Niu, X., Pan, H., Zhou, Y., Zhang, Z., Qu, P., & Zhou, J. (2016). Tumor‑suppressing effects of microRNA‑429 in human renal cell carcinoma via the downregulation of Sp1. Oncology Letters, 12, 2906-2911. https://doi.org/10.3892/ol.2016.4953
MLA
Wu, D., Niu, X., Pan, H., Zhou, Y., Zhang, Z., Qu, P., Zhou, J."Tumor‑suppressing effects of microRNA‑429 in human renal cell carcinoma via the downregulation of Sp1". Oncology Letters 12.4 (2016): 2906-2911.
Chicago
Wu, D., Niu, X., Pan, H., Zhou, Y., Zhang, Z., Qu, P., Zhou, J."Tumor‑suppressing effects of microRNA‑429 in human renal cell carcinoma via the downregulation of Sp1". Oncology Letters 12, no. 4 (2016): 2906-2911. https://doi.org/10.3892/ol.2016.4953
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team