Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
December-2016 Volume 12 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2016 Volume 12 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Suppression of PDCD4 mediated by the long non-coding RNA HOTAIR inhibits the proliferation and invasion of glioma cells

  • Authors:
    • Yong'an Chen
    • Yusong Bian
    • Shanpeng Zhao
    • Fanqiang Kong
    • Xin'gang Li
  • View Affiliations / Copyright

    Affiliations: Department of Neurosurgery, Qilu Hospital of Shandong University, Jinan, Shandong 250012, P.R. China, Emergency Centre, Yantai Yuhuangding Hospital Affiliated to Qingdao University Medical College, Yantai, Shandong 264000, P.R. China
  • Pages: 5170-5176
    |
    Published online on: October 27, 2016
       https://doi.org/10.3892/ol.2016.5323
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Programmed cell death protein 4 (PDCD4) has recently been demonstrated to be implicated in translation and transcription, and the regulation of cell growth. However, the mechanisms underlying PDCD4 function in glioma cells remain to be elucidated. The current study investigated the function and regulation of PDCD4 and the results demonstrated that the expression of PDCD4 was significantly reduced in glioma cells compared with normal cells. When PDCD4 was overexpressed in glioma cells, the proliferation rate and invasive capability of the cells greatly decreased, suggesting that PDCD4 functions as a tumor suppressor in this cell type. In addition, the histone modification status of the PDCD4 gene was analyzed, and chromatin immunoprecipitation assay identified a high density of histone 3 lysine 27 trimethylation on the promoter of PDCD4, which was associated with the long non‑coding RNA, homeobox transcript antisense RNA (HOTAIR). The expression of HOTAIR was significantly increased in glioma cells compared with normal cells, and it exerted its function in a polycomb repressive complex 2‑dependent manner. These results may provide novel approaches to therapeutically target PDCD4 and HOTAIR in patients with gliomas.

Introduction

Human gliomas are the most prevalent malignant neoplasms of the central nervous system, with an annual incidence of ~5/100,000 worldwide (1). Despite the use of aggressive surgery in combination with chemotherapy, biological therapy and radiotherapy, gliomas continue to be therapeutically challenging (2). For patients with glioblastoma, the relative 5-year survival rate is <5% (3). Novel therapies for the treatment of glioma are warranted; recent advances in the understanding of the molecular and biological nature of this disease may facilitate the development of successful therapeutics (4).

PDCD4 protein was initially determined to be overexpressed during apoptosis, which subsequently suppresses tumorigenesis (5,6). Loss of PDCD4 expression is closely associated with the progression of a number of tumors, including glioblastomas (7), and kidney, ovarian and lung cancer (8–10). Low PDCD4 expression levels correlate with poor outcomes in patients with glioblastoma multiforme (11). The frequent loss of PDCD4 in glioblastoma multiforme is partly due to epigenetic silencing secondary to 5′ cytosine-phosphate-guanine island methylation (12), in addition to overexpression of microRNA (miRNA)-21, which targets PDCD4 mRNA for degradation (13). Although several studies have examined PDCD4 in glioma, the detailed molecular mechanisms underlying the role of PDCD4 in glioma remain poorly understood.

Long non-coding RNAs (lncRNAs) are non-protein coding transcripts longer than 200 nucleotides, which are involved in various important events, including transcriptional, epigenetic and post-transcriptional regulation (14,15). A previous study profiled the lncRNA homeobox transcript antisense RNA (HOTAIR), and the results demonstrated that HOTAIR was closely correlated with poor prognosis, molecular subtype and tumor grade in patients with glioma (16). However, the details of how HOTAIR regulates tumor suppressors, including PDCD4, remain unclear.

The results of the present study demonstrated that PDCD4 functions as a tumor suppressor in glioma cells, and its downregulation is associated with a high level of histone 3 lysine 27 trimethylation (H3K27me3) at the PDCD4 promoter, a level that is mediated by HOTAIR in a polycomb repressive complex 2 (PRC2)-dependent manner.

Materials and methods

Experimental subjects

A total of 24 brain glioma tissue samples and their matched adjacent normal tissues from 24 patients obtained following surgical resection were collected from the Department of Neurosurgery, Yantai Yuhuangding Hospital Affiliated to Qingdao University Medical College (Yantai, China) between August 2010 and September 2012. Adjacent tissues were located 1 cm away from lesions. All specimens were obtained under sterile conditions during surgery, and immediately placed into Eppendorf tubes and frozen at −80°C. The present study was approved by the ethics committee of Shandong University (Jinan, China; approval no. 20130041). Written informed consent was obtained from all patients.

Cell preparation and culture

The human astrocyte HA cell line was purchased from ScienCell Research Laboratories (San Diego, CA, USA). The human glioma cell lines U251, U87, LN-18 and H4 were all purchased from the American Type Culture Collection (Manassas, VA, USA). All cell lines were maintained in Dulbecco's modified Eagle's medium (DMEM; GE Healthcare Life Sciences, Logan, UT, USA) supplemented with heat-inactivated 10% fetal calf serum (GE Healthcare Life Sciences), 2 mM L-glutamine and 100 U/ml penicillin/streptomycin. Cells were incubated at 37°C in a humidified atmosphere with 5% CO2.

Cell transfection and RNA interference

The lentivirus for PDCD4 overexpression (Lenti-PDCD4) and the control (Lenti-Empty) were commercially constructed by Genechem Co., Ltd. (Shanghai, China). The lentivirus was packaged in HEK-293T cells and collected from the supernatant following the manufacturer's protocol. Glioma cells were infected with lentiviral particles. Cell lines stably expressing PDCD4 were established using puromycin as the selection marker.

Small interfering RNA (siRNA) targeting HOTAIR was purchased from Thermo Fisher Scientific, Inc. (Waltham, MA, USA). Cells were transfected using Lipofectamine® 2000 (Thermo Fisher Scientific, Inc.) following the manufacturer's protocol.

Reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR)

RNA was isolated from the human glioma cell lines using RNAzol® reagent (Vigorous Biotechnology Co., Ltd., Beijing, China), according to the manufacturer's protocol. The RNA was treated with DNase H (Beyotime Institute of Biotechnology, Haimen, China) to remove contaminating genomic DNA. cDNA was synthesized in a 25 µl reaction mixture consisting of 2 µg total RNA, 1 µl M-MLV Reverse Transcriptase 2 µl dNTPs, 5 µl 5X buffer, 1 µl random primers, 0.5 µl RNasin and diethylpyrocarbonate (all Promega Corporation, Madison, WI, USA). qPCR was performed using the ABI 7300 Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) with reagents from the SYBR® Green Real-Time PCR Master Mix (Toyobo Co., Ltd., Osaka, Japan) and the appropriate primers, which are presented in Table I. The PCR cycling conditions were as follows: 95°C for 15 min, followed by 40 cycles of denaturation at 94°C for 15 sec, annealing at 60°C for 30 sec, and extension at 72°C for 30 sec. Relative mRNA expression levels were determined following normalization to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) using the 2−ΔΔCq method (17).

Table I.

Primer sequences for each gene.

Table I.

Primer sequences for each gene.

GenePrimer sequences, 5′-3′Product size, bp
GAPDH 116
  Forward TGTGGGCATCAATGGATTTGG
  Reverse ACACCATGTATTCCGGGTCAAT
PDCD4 108
  Forward GGGAGTGACGCCCTTAGAAG
  Reverse ACCTTTCTTTGGTAGTCCCCTT
HOTAIR 135
  Forward GGCAGCACAGAGCAACTCTA
  Reverse GAGTGCAAAGTCCCGTTTG

[i] GAPDH, glyceraldehyde 3-phosphate dehydrogenase; PDCD4, programmed cell death protein 4; HOTAIR, homeobox transcript antisense RNA.

Cell proliferation

Cell Counting kit-8 (CCK-8; Dojindo Molecular Technologies, Inc., Kumamoto, Japan) was used to determine cell proliferation rate according to the manufacturer's protocol at the indicated time points. Briefly, cells were seeded in 96-well plates at a density of 2,000 cells/well. Cell proliferation reagent (10 µl) was added to each well, and the cells were incubated for 2 h at 37°C. Cell numbers were estimated by measuring the optical density at 450 nm. The absorbance of cell-free wells containing medium was set as zero. Data was obtained from three separate experiments and three replications were performed each time.

Cell invasion assay

Transwell chambers (8.0 µm pore size; Corning Incorporated, Corning, NY, USA) coated with Matrigel (BD Biosciences, Franklin Lakes, NJ, USA) were used to measure the invasiveness of glioma cells. In brief, 5×104 cells/well were seeded in the upper chamber in DMEM without serum, and the lower chamber contained DMEM supplemented with 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.) to stimulate cell invasion. Following 48 h of incubation at 37°C, cells that migrated to the bottom of the chamber insert were fixed with 3% paraformaldehyde, stained with 0.1% crystal violet, extracted with 33% acetic acid and finally detected quantitatively using a standard microplate reader (at 570 nm). Data was obtained from three separate experiments and three replications were performed each time.

Western blot analysis

Protein extracts (10 µg) prepared with radioimmunoprecipitation assay buffer were separated by 12% SDS-PAGE and transferred to nitrocellulose membranes by electroblotting. Subsequent to blocking with 5% non-fat milk, the membranes were incubated overnight at 4°C with mouse anti-PDCD4 (#sc-376430) and mouse anti-GAPDH (#sc-25778) monoclonal antibodies (dilutions, 1:1,000; Santa Cruz Biotechnology, Inc., Dallas, TX, USA). Blots were then incubated with peroxidase-conjugated goat anti-mouse secondary antibodies (dilution, 1:1,000; #ZB2305 and #ZB2307; Beijing Zhongshan Jinqiao Biotechnology, Co., Ltd., Beijing, China) for 1 h at room temperature and developed using a SuperSignal™ West Pico Chemilumiscent substrate (Pierce Biotechnology, Inc., Rockford, IL, USA). Immunoblots were scanned using Image Lab™ software, version 1709690 (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Chromatin immunoprecipitation (ChIP) assay

Cells were fixed with 10% formaldehyde and sonicated to prepare the chromatin sample. Chromatin samples were immunoprecipitated with mouse anti-H3K27me3 monoclonal antibody (#ab6002; Abcam, Cambridge, MA, USA), rabbit anti-enhancer of zeste homolog 2 (EZH2) polyclonal antibody (#ab3748; Abcam) or rabbit immunoglobulin G (IgG; #ab6785; Abcam) at 4°C for 3 h. Following crosslink reversal, precipitated DNA was analyzed by PCR for fragments of the PDCD4 promoter using the following primers: Forward, 5′-GGGAGGAGGAATCGGACAG-3′; and reverse, 5′-TATGTTGGGAGGCGTGGC-3′ (141 bp). The PCR cycling conditions were as follows: 95°C for 15 min, followed by 40 cycles of denaturation at 94°C for 15 sec, annealing at 60°C for 30 sec, and extension at 72°C for 30 sec. The data obtained were normalized to those of corresponding DNA precipitated by IgG.

Statistical analysis

All data are expressed as the mean ± standard deviation. Comparisons between two groups were performed using Student's t-test or among groups with one-way analysis of variance. Statistical analyses were conducted using SPSS 13.0 software (SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

PDCD4 expression is downregulated in glioma cells

Human glioma tissue samples (n=24) were analyzed to detect the change in expression of PDCD4 in glioma. RT-qPCR demonstrated that PDCD4 was significantly downregulated in glioma tissues (by ~20%), as compared with adjacent normal tissues (P=0.034; Fig. 1A), which was supported by western blot analysis (Fig. 1B). In a few samples, no PDCD4 expression was detected.

Figure 1.

PDCD4 expression is downregulated in glioma cells. (A) ΔCq values for PDCD4 RNA levels in 24 glioma tissue samples. (B) PDCD4 protein levels in 3 representative glioma tissue samples. (C) Relative PDCD4 RNA levels in the HA, H4, U87, LN-18 and U251 cells. Data represents the results of three independent experiments. (D) PDCD4 protein levels in the HA, H4, U87, LN-18 and U251 cells. *P<0.05 vs. negative control. PDCD4, programmed cell death protein 4; Cq, quantification cycle; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

This experiment was repeated with glioma cell lines (U251, LN-18, U87 and H4), and the human astrocyte HA cell line was used as the control. RT-qPCR and western blot analysis demonstrated that PDCD4 expression was suppressed in all glioma cell lines compared with the HA cells, and its expression was the lowest in the U251 cells (Fig. 1C and D).

PDCD4 inhibits cell growth and invasion in glioma cells

Next, the potential functions of PDCD4 in glioma were investigated. A lentivirus was constructed, Lenti-PDCD4, containing the full length PDCD4 cDNA, and PDCD4 was overexpressed in U251 cells by infection with Lenti-PDCD4. Western blot analysis indicated that PDCD4 was successfully overexpressed compared with the Lenti-Empty construct (Fig. 2A). CCK-8 assay was employed to determine whether PDCD4 affects the proliferation of glioma cells. Glioma cells infected with Lenti-PDCD4 exhibited a significantly lower proliferation rate than the control at 48 and 60 h following transfection (P<0.05; Fig. 2B). In addition, Transwell migration assays were performed to verify invasive ability. The results demonstrated that PDCD4 overexpression resulted in a significant decrease in the invasion rate of U251 cells compared with the control (P<0.05; Fig. 2C).

Figure 2.

PDCD4 inhibits cell growth and invasion in glioma cells. (A) Expression level of PDCD4 in U251 cells infected with lentivirus overexpressing PDCD4 (Lenti-PDCD4). Lentivirus containing the empty vector (Lenti-Empty) was used as a negative control. (B) Cell counting kit-8 assay was performed on U251 cells overexpressing PDCD4. (C) Transwell analysis was performed to determine invasive capability and luciferase detection values for each cell type were compared. All experiments were repeated three times. *P<0.05 vs. negative control. PDCD4, programmed cell death protein 4; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; Con, control.

Histones at the PDCD4 promoter may be methylated by the PRC2 complex

Next, mechanisms underlying PDCD4 downregulation in glioma were investigated. Epigenetic modifications, particularly methylation at specific histone sites, are important in gene expression. ChIP assays demonstrated that the level of H3K27me3 at the PDCD4 promoter region increased significantly in the U251 cells, as compared wih the HA cells (P=0.019; Fig. 3A), thus favoring transcriptional silencing. Conversely, H3K4me3 exhibited little change between the HA and U251 cells (P>0.05; Fig. 3A). The levels of EZH2 and suppressor of zeste 12 (SUZ12), core components of the PRC2 complex, at the PDCD4 promoter region were significantly increased in the U251 cells, as compared with the HA cells (P<0.05; Fig. 3B). These results indicated that the PRC2 complex was able to downregulate PDCD4 expression by increasing the level of H3K27me3 at its promoter.

Figure 3.

Histones of the PDCD4 promoter may be methylated by the polycomb repressive complex 2 complex. (A) ChIP analysis of H3K4me3 and H3K27me3 histone modification at the PDCD4 promoter in HA and U251 cells. (B) ChIP analysis of EZH2 and SUZ12 recruitment to the PDCD4 promoter in HA and U251 cells. All experiments were repeated three times. *P<0.05 vs. negative control. PDCD4, programmed cell death protein 4; ChIP, chromatin immunoprecipitation; IgG, immunoglobulin G; H3K4me3, histone 3 lysine 4 trimethylation; H3K27me3, histone 3 lysine 27 trimethylation; EZH2, enhancer of zeste homolog 2; SUZ12, suppressor of zeste 12.

HOTAIR is upregulated in glioma cells

The expression of HOTAIR was measured in human glioma tissue samples. RT-qPCR demonstrated that HOTAIR expression was significantly elevated (by ~30-fold) in glioma tissues, as compared with normal tissues (P=0.039; Fig. 4A). A similar trend was observed in the glioma cell lines, in which HOTAIR RNA levels were significantly elevated compared with the HA cells (P<0.05; Fig. 4B). To investigate the function of HOTAIR, the gene was knocked down in U251 cells using siRNA, which significantly decreased its expression, as compared with the scramble RNA (P<0.05; Fig. 4C).

Figure 4.

HOTAIR is upregulated in glioma cells. (A) ΔCq values for HOTAIR RNA levels in 24 glioma tissue samples. (B) HOTAIR RNA levels in HA, H4, U87, LN-18 and U251 cells. Data represents the results of three independent experiments. (C) Relative expression levels of HOTAIR in U251 cells treated with siRNA targeting HOTAIR. *P<0.05 vs. negative control. HOTAIR, homeobox transcript antisense RNA; Cq, quantification cycle; siRNA, small interfering RNA; Con, control; Scr, scramble.

HOTAIR participates in the silencing of PDCD4 in glioma cells

The present study investigated how the expression of PDCD4 was silenced in glioma cells. It was hypothesized that HOTAIR may induce the recruitment of PRC2 to the PDCD4 promoter. Western blot analysis indicated that PDCD4 expression was upregulated when HOTAIR was knocked down in glioma cells (Fig. 5A). Histone modifications at the PDCD4 promoter were measured by ChIP assays. The results demonstrated that when HOTAIR was knocked down in glioma cells, the H3K27me3 level at the PDCD4 promoter was significantly reduced compared with the control (P=0.031; Fig. 5B). Furthermore, the recruitment of EZH2 and SUZ12 to the PDCD4 promoter was measured, and the results indicated that the level of PRC2 components at the PDCD4 promoter was decreased in glioma cells following HOTAIR-knockdown compared with the control (Fig. 5C). These results suggest that the upregulation of HOTAIR results in PDCD4 silencing in glioma cells.

Figure 5.

HOTAIR participates in the silencing of PDCD4 in glioma cells. (A) PDCD4 expression level in U251 cells treated with siRNA targeting HOTAIR. Scr RNA was used as the negative control. (B) ChIP analysis of H3K27me3 histone modification at the PDCD4 promoter in U251 cells treated with siRNA. (C) ChIP analysis of EZH2 and SUZ12 recruitment to the PDCD4 promoter in U251 cells treated with siRNA. All experiments were repeated three times. *P<0.05 vs. negative control. HOTAIR, homeobox transcript antisense RNA; PDCD4, programmed cell death protein 4; siRNA, small interfering RNA; Scr, scramble; ChIP, chromatin immunoprecipitation; H3K27me3, histone 3 lysine 27 trimethylation; EZH2, enhancer of zeste homolog 2; SUZ12, suppressor of zeste 12; Con, control.

Discussion

Glioma is the most aggressive form of tumor located in the human brain, and despite advances in available therapies, glioma remains incurable (18). The tumors are particularly difficult to eradicate due to their highly invasive and metastatic capabilities (19). In the present study, it was demonstrated that PDCD4 expression was suppressed in glioma cells, which suggested that PDCD4 may participate in glioma tumorigenesis.

As a potential tumor suppressor, PDCD4 regulates the expression of a variety of proteins, including p21 (20), urokinase receptor (21), hematopoietic progenitor kinase 1 (22), ornithine decarboxylase (23), carbonic anhydrase II (24) and c-Jun N-terminal kinase/c-Jun/activator protein 1 (25). In glioma cells, the function of PDCD4 remains poorly understood. Liwak et al (26) reported that the loss of PDCD4 expression contributes to increased chemotherapy resistance in glioblastoma multiforme by derepressing B-cell lymphoma-extra large translation. Gaur et al (27) reported that PDCD4 downregulation by miRNA-21 promotes glioblastoma proliferation in vivo. In the current study, when PDCD4 was overexpressed in glioma cells, the proliferation rate and invasive capability significantly increased compared with the control. However, no information regarding the regulation of PDCD4 in glioma has been reported. The present study therefore proposes that PDCD4 regulation depends on alterations in histone modification at promoter region.

LncRNAs are generally defined as mRNA-like, non-protein coding transcripts that are >200 nucleotides in length (28,29). Using the most advanced sequencing platforms and algorithms for assembling transcripts from deep RNA-sequencing reads, it is estimated that there are ~20,000 distinct lncRNAs in humans (30). LncRNAs demonstrate unique profiles in different forms of human cancer, which serve as predictors of patient outcomes and reflect disease progression (31,32). It was recently identified that lncRNAs function in a number of aspects of cell biology and may aid the development of tumors (33). HOTAIR, a well-studied lncRNA, has emerged as an important regulator of carcinogenesis and metastasis, and as a potential prognostic marker (34,35). Therefore, an increasing amount of research has focused on determining its functions, in addition to identifying its target genes. The present study observed that the expression of HOTAIR was dramatically upregulated in glioma cells compared with normal human astrocyte cells.

Regarding the function of HOTAIR, previous studies identified a possible role for HOTAIR in cancer. HOTAIR interacts with PRC2, which increases the level of H3K27me3, and subsequently decreases the expression of various genes, particularly metastasis-suppressing genes (36,37). Furthermore, the present study investigated the association between HOTAIR and PDCD4. The results demonstrated that the elevated expression of HOTAIR participated in PDCD4 regulation in a PRC2-dependent manner.

In conclusion, to the best of our knowledge, the current study investigated the association between the tumor suppressor PDCD4 and the lncRNA HOTAIR in glioma cells for the first time, with the results demonstrating that suppression of PDCD4 mediated by HOTAIR inhibits glioma cell proliferation and invasion in a PRC2-dependent manner. The results of the present study may aid the understanding of the detailed molecular mechanisms underlying glioma tumorigenesis, and support the notion that understanding the regulation of PDCD4 expression via HOTAIR intervention may contribute to the development of therapeutic strategies for the treatment of gliomas.

References

1 

Morgan LL: The epidemiology of glioma in adults: A ‘state of the science’ review. Neuro-Oncol. 17:623–624. 2015. View Article : Google Scholar : PubMed/NCBI

2 

Grauer OM, Wesseling P and Adema GJ: Immunotherapy of diffuse gliomas: Biological background, current status and future developments. Brain Pathol. 19:674–693. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Cloughesy TF, Cavenee WK and Mischel PS: Glioblastoma: From molecular pathology to targeted treatment. Annu Rev Pathol. 9:1–25. 2014. View Article : Google Scholar : PubMed/NCBI

4 

Gu JJ, Gao GZ and Zhang SM: miR-218 inhibits the migration and invasion of glioma U87 cells through the Slit2-Robo1 pathway. Oncol Lett. 9:1561–1566. 2015.PubMed/NCBI

5 

Cmarik JL, Min H, Hegamyer G, Zhan S, Kulesz-Martin M, Yoshinaga H, Matsuhashi S and Colburn NH: Differentially expressed protein Pdcd4 inhibits tumor promoter-induced neoplastic transformation. Proc Natl Acad Sci USA. 96:14037–14042. 1999. View Article : Google Scholar : PubMed/NCBI

6 

Lankat-Buttgereit B and Göke R: The tumour suppressor Pdcd4: Recent advances in the elucidation of function and regulation. Biol Cell. 101:309–317. 2009. View Article : Google Scholar : PubMed/NCBI

7 

Gao F, Zhang P, Zhou C, Li J, Wang Q, Zhu F, Ma C, Sun W and Zhang L: Frequent loss of PDCD4 expression in human glioma: Possible role in the tumorigenesis of glioma. Oncol Rep. 17:123–128. 2007.PubMed/NCBI

8 

Chen Y, Knösel T, Kristiansen G, Pietas A, Garber ME, Matsuhashi S, Ozaki I and Petersen I: Loss of PDCD4 expression in human lung cancer correlates with tumour progression and prognosis. J Pathol. 200:640–646. 2003. View Article : Google Scholar : PubMed/NCBI

9 

Li Y, Li W, Yang Y, Lu Y, He C, Hu G, Liu H, Chen J, He J and Yu H: MicroRNA-21 targets LRRFIP1 and contributes to VM-26 resistance in glioblastoma multiforme. Brain Res. 1286:13–18. 2009. View Article : Google Scholar : PubMed/NCBI

10 

Wei NA, Liu SS, Leung TH, Tam KF, Liao XY, Cheung AN, Chan KK and Ngan HY: Loss of programmed cell death 4 (Pdcd4) associates with the progression of ovarian cancer. Mol Cancer. 8:702009. View Article : Google Scholar : PubMed/NCBI

11 

Liwak U, L E Jordan, Von-Holt SD, Singh P, Hanson JE, Lorimer IA, Roncaroli F and Holcik M: Loss of PDCD4 contributes to enhanced chemoresistance in Glioblastoma multiforme through de-repression of Bcl-xL translation. Oncotarget. 4:1365–1372. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Gao F, Wang X, Zhu F, Wang Q, Zhang X, Guo C, Zhou C, Ma C, Sun W, Zhang Y, et al: PDCD4 gene silencing in gliomas is associated with 5′CpG island methylation and unfavourable prognosis. J Cell Mol Med. 13:4257–4267. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Chen Y, Liu W, Chao T, Zhang Y, Yan X, Gong Y, Qiang B, Yuan J, Sun M and Peng X: MicroRNA-21 down-regulates the expression of tumor suppressor PDCD4 in human glioblastoma cell T98 G. Cancer Lett. 272:197–205. 2008. View Article : Google Scholar : PubMed/NCBI

14 

Mercer TR, Dinger ME and Mattick JS: Long non-coding RNAs: Insights into functions. Nat Rev Genet. 10:155–159. 2009. View Article : Google Scholar : PubMed/NCBI

15 

Zhang J, Zhang A, Wang Y, Liu N, You Y, Kang C and Pu P: New insights into the roles of ncRNA in the STAT3 pathway. Future Oncol. 8:723–730. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Zhang JX, Han L, Bao ZS, Wang YY, Chen LY, Yan W, Yu SZ, Pu PY, Liu N, You YP, et al: HOTAIR, a cell cycle-associated long noncoding RNA and a strong predictor of survival, is preferentially expressed in classical and mesenchymal glioma. Neuro Oncol. 15:1595–1603. 2013. View Article : Google Scholar : PubMed/NCBI

17 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real time quantitative PCR and the 2(Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

18 

Hu Y, Gao H, Vo C, Ke C, Pan F, Yu L, Siegel E, Hess KR, Linskey ME and Zhou YH: Anti-EGFR function of EFEMP1 in glioma cells and patient prognosis. Oncoscience. 1:205–215. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Wang XP, Deng XL and Li LY: MicroRNA-584 functions as a tumor suppressor and targets PTTG1IP in glioma. Int J Clin Exp Pathol. 7:8573–8582. 2014.PubMed/NCBI

20 

Göke R, Barth P, Schmidt A, Samans B and Lankat-Buttgereit B: Programmed cell death protein 4 suppresses CDK1/cdc2 via induction of p21(Waf1/Cip1). Am J Physiol Cell Physiol. 287:C1541–C1546. 2004. View Article : Google Scholar : PubMed/NCBI

21 

Leupold JH, Yang HS, Colburn NH, Asangani I, Post S and Allgayer H: Tumor suppressor Pdcd4 inhibits invasion/intravasation and regulates urokinase receptor (u-PAR) gene expression via Sp-transcription factors. Oncogene. 26:4550–4562. 2007. View Article : Google Scholar : PubMed/NCBI

22 

Yang HS, Matthews CP, Clair T, Wang Q, Baker AR, Li CC, Tan TH and Colburn NH: Tumorigenesis suppressor Pdcd4 down-regulates mitogen-activated protein kinase kinase kinase kinase 1 expression to suppress colon carcinoma cell invasion. Mol Cell Biol. 26:1297–1306. 2006. View Article : Google Scholar : PubMed/NCBI

23 

Jansen AP, Camalier CE and Colburn NH: Epidermal expression of the translation inhibitor programmed cell death 4 suppresses tumorigenesis. Cancer Res. 65:6034–6041. 2005. View Article : Google Scholar : PubMed/NCBI

24 

Lankat-Buttgereit B, Gregel C, Knolle A, Hasilik A, Arnold R and Göke R: Pdcd4 inhibits growth of tumor cells by suppression of carbonic anhydrase type II. Mol Cell Endocrinol. 214:149–153. 2004. View Article : Google Scholar : PubMed/NCBI

25 

Bitomsky N, Böhm M and Klempnauer KH: Transformation suppressor protein Pdcd4 interferes with JNK-mediated phosphorylation of c-Jun and recruitment of the coactivator p300 by c-Jun. Oncogene. 23:7484–7493. 2004. View Article : Google Scholar : PubMed/NCBI

26 

Liwak U, Jordan LE, Von-Holt SD, Singh P, Hanson JE, Lorimer IA, Roncaroli F and Holcik M: Loss of PDCD4 contributes to enhanced chemoresistance in Glioblastoma multiforme through de-repression of Bcl-xL translation. Oncotarget. 4:1365–1372. 2013. View Article : Google Scholar : PubMed/NCBI

27 

Gaur AB, Holbeck SL, Colburn NH and Israel MA: Downregulation of Pdcd4 by mir-21 facilitates glioblastoma proliferation in vivo. Neuro Oncol. 13:580–590. 2011. View Article : Google Scholar : PubMed/NCBI

28 

Ernst C and Morton CC: Identification and function of long non-coding RNA. Front Cell Neurosci. 7:1682013. View Article : Google Scholar : PubMed/NCBI

29 

Ponting CP, Oliver PL and Reik W: Evolution and functions of long noncoding RNAs. Cell. 136:629–641. 2009. View Article : Google Scholar : PubMed/NCBI

30 

Moran VA, Perera RJ and Khalil AM: Emerging functional and mechanistic paradigms of mammalian long non-coding RNAs. Nucleic Acids Res. 40:6391–6400. 2012. View Article : Google Scholar : PubMed/NCBI

31 

Wang GY, Zhu YY and Zhang YQ: The functional role of long non-coding RNA in digestive system carcinomas. Bull Cancer. 101:E27–E31. 2014.PubMed/NCBI

32 

Bhan A and Mandal SS: Long noncoding RNAs: Emerging stars in gene regulation, epigenetics and human disease. ChemMedChem. 9:1932–1956. 2014. View Article : Google Scholar : PubMed/NCBI

33 

Liu MX, Chen X, Chen G, Cui QH and Yan GY: A computational framework to infer human disease-associated long noncoding RNAs. PLoS One. 9:e844082014. View Article : Google Scholar : PubMed/NCBI

34 

Wan Y and Chang HY: HOTAIR: Flight of noncoding RNAs in cancer metastasis. Cell Cycle. 9:3391–3392. 2010. View Article : Google Scholar : PubMed/NCBI

35 

Lv DW, Ge P, Zhang M, Cheng ZW, Li XH and Yan YM: Integrative network analysis of the signaling cascades in seedling leaves of bread wheat by large-scale phosphoproteomic profiling. J Proteome Res. 13:2381–2395. 2014. View Article : Google Scholar : PubMed/NCBI

36 

Gupta RA, Shah N, Wang KC, Kim J, Horlings HM, Wong DJ, Tsai MC, Hung T, Argani P, Rinn JL, et al: Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis. Nature. 464:1071–1076. 2010. View Article : Google Scholar : PubMed/NCBI

37 

Li L, Liu B, Wapinski OL, Tsai MC, Qu K, Zhang J, Carlson JC, Lin M, Fang F, Gupta RA, et al: Targeted disruption of Hotair leads to homeotic transformation and gene derepression. Cell Rep. 5:3–12. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Chen Y, Bian Y, Zhao S, Kong F and Li X: Suppression of PDCD4 mediated by the long non-coding RNA HOTAIR inhibits the proliferation and invasion of glioma cells. Oncol Lett 12: 5170-5176, 2016.
APA
Chen, Y., Bian, Y., Zhao, S., Kong, F., & Li, X. (2016). Suppression of PDCD4 mediated by the long non-coding RNA HOTAIR inhibits the proliferation and invasion of glioma cells. Oncology Letters, 12, 5170-5176. https://doi.org/10.3892/ol.2016.5323
MLA
Chen, Y., Bian, Y., Zhao, S., Kong, F., Li, X."Suppression of PDCD4 mediated by the long non-coding RNA HOTAIR inhibits the proliferation and invasion of glioma cells". Oncology Letters 12.6 (2016): 5170-5176.
Chicago
Chen, Y., Bian, Y., Zhao, S., Kong, F., Li, X."Suppression of PDCD4 mediated by the long non-coding RNA HOTAIR inhibits the proliferation and invasion of glioma cells". Oncology Letters 12, no. 6 (2016): 5170-5176. https://doi.org/10.3892/ol.2016.5323
Copy and paste a formatted citation
x
Spandidos Publications style
Chen Y, Bian Y, Zhao S, Kong F and Li X: Suppression of PDCD4 mediated by the long non-coding RNA HOTAIR inhibits the proliferation and invasion of glioma cells. Oncol Lett 12: 5170-5176, 2016.
APA
Chen, Y., Bian, Y., Zhao, S., Kong, F., & Li, X. (2016). Suppression of PDCD4 mediated by the long non-coding RNA HOTAIR inhibits the proliferation and invasion of glioma cells. Oncology Letters, 12, 5170-5176. https://doi.org/10.3892/ol.2016.5323
MLA
Chen, Y., Bian, Y., Zhao, S., Kong, F., Li, X."Suppression of PDCD4 mediated by the long non-coding RNA HOTAIR inhibits the proliferation and invasion of glioma cells". Oncology Letters 12.6 (2016): 5170-5176.
Chicago
Chen, Y., Bian, Y., Zhao, S., Kong, F., Li, X."Suppression of PDCD4 mediated by the long non-coding RNA HOTAIR inhibits the proliferation and invasion of glioma cells". Oncology Letters 12, no. 6 (2016): 5170-5176. https://doi.org/10.3892/ol.2016.5323
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team