This article is mentioned in:

Introduction

Acute lymphoblastic leukemia (ALL) is the most common type of childhood cancer (1). In all cases of childhood leukemia, ~80% are ALL, which represents ~25% of cancers in children diagnosed <15 years of age in the United States in 2014 (2). Although the etiology of ALL is largely unknown, it has been proposed that multiple gene alterations, including inactivation of tumor suppressor genes, activation of proto-oncogenes and chromosomal rearrangements, in addition to gene-environmental interplay, are involved in disease development (1,3,4). Chromosomal abnormalities, including homozygous deletions and loss of heterozygosity, are among the most common characteristics of human tumors. The fragile histidine triad (FHIT) gene is located on the short arm of human chromosome-3 (3p14.2) which is a major site of chromosomal rearrangement (5).

FHIT protein has previously been proposed to act as a tumor suppressor (6–8). However, the exact mechanisms by which FHIT mediates its suppressive functions are not well understood. Several researchers have indicated that restoration of FHIT expression suppresses tumorigenicity, and transfection of FHIT in FHIT-deficient human cancer cells appears to induce apoptosis and inhibit cell growth (8–11). DNA hypermethylation may occur in genes involved in the cell cycle, DNA damage repair and signaling pathways. DNA methylation is a well-studied epigenetic modification, which significantly contributes to leukemia development (12). Several studies have demonstrated an association between FHIT hypermethylation and an increased risk of non-small-cell lung carcinoma (NSCLC) (13), breast cancer (14,15), cervical cancer (16), hepatocellular carcinoma (17) and thyroid carcinoma (18). Furthermore, downregulation of FHIT expression has been observed in acute lymphoblastic leukemia (ALL) (19), gastric cancer (20), colon adenocarcinoma (21), nasopharyngeal carcinoma (22) and colorectal cancer (23).

It has been proposed that the loss of normal FHIT function may be involved in the pathogenesis of several human leukemias, and the aberrant expression of FHIT is specific and frequent in leukemia samples (24,25). The frequent loss of FHIT expression in ALL suggests that inactivating alterations at the FHIT locus may contribute to the development of leukemias (26). The present study aimed to assess promoter methylation status and expression levels of the FHIT gene in childhood ALL.

Materials and methods

Patients

A case-control study was conducted, in which 100 children diagnosed with ALL (54 male, 46 female; age, 5.5±3.6 years) and 120 age and sex matched healthy controls (58 male, 62 female; age, 5.6±2.9 years) in Zahedan, Iran were enrolled. All subjects were selected from the Ali-Ebne-Abitaleb Hospital, Zahedan University of Medical Sciences (Zahedan, Iran) between February 2013 and May 2014. Details of the study design and enrolment process have been previously described (27–29). Analysis of DNA methylation in the FHIT promoter was performed in 100 ALL cases and 120 healthy age and sex matched cases. Analysis of FHIT mRNA expression levels was conducted in 30 new cases of childhood ALL (20 males and 10 females; mean age, 5.5±3.4 years; age range, 1–15 years) and 32 healthy age and sex matched children (15 males and 17 females; mean age, 5.0±4.1 years; age range, 1–15 years). The subjects were selected from the Ali-Ebne-Abitaleb Hospital, Zahedan University of Medical Sciences (Zahedan, Iran) between February 2013 and May 2014. The local ethics committee of Zahedan University of Medical Sciences (Zahedan, Iran) approved the studies and written informed consent was obtained from parents of cases and controls.

Promoter methylation

A methylation specific PCR (MSP) technique was used for determination of promoter DNA methylation status. Whole blood samples (2 ml) were collected in EDTA-containing tubes, and genomic DNA was extracted using the salting out method as described previously (30). DNA was modified by sodium bisulfite using the CPGenome™ Direct Prep Bisulfite Modification kit (Merck KGaA, Darmstadt, Germany). An MSP was established for the evaluation of FHIT promoter methylation. The primer sequences are listed in Table I. To each 0.2 ml PCR reaction tube, 1 µl bisulfite-converted DNA, 1 µl of forward and reverse primer (10 µM) and 17 µl dH2O were added with HotStart PCR PreMix (AccuPower, Bionner Corp, Daejean, South Korea). The PCR conditions were set as follows: 95°C for 5 min, 30 cycles of 95°C for 30 sec, 58°C for 30 sec, and 72°C for 30 sec, with a final extension step of 72°C for 5 min. The PCR product (623 bp) was used as a template for MSP. MSP was performed using two pairs of primers; one pair specific for methylated and the other for unmethylated template (Table I). In each 0.2 ml PCR reaction tube, 0.5 µl nested PCR product, 1 µl of each primer (10 µM) and 10 µl 2X Prime Taq Premix (GeNet Bio, Daejean, South Korea) and 7 µl dH2O were added. MSP conditions included an initial denaturation step at 95°C for 5 min, followed by 30 cycles of 30 sec at 95°C, annealing at 58°C for 30 sec, and extension at 72°C for 30 sec, with a final extension step at 72°C for 5 min. The methylated and unmethylated PCR products were 157 and 159 bp, respectively (Fig. 1).

Figure 1. Electrophoresis pattern of promoter methylation of FHIT using methylation specific polymerase chain reaction. Lane 1, MU; lane 2, MM; lane 3, UU. M, DNA marker; FHIT, fragile histidine triad; MU, methylated unmethylated; MM, methylated methylated; UU, unmethylated unmethylated.

Table I. Primer sequences for MS-PCR and RT-qPCR.

Table I.

Primer sequences for MS-PCR and RT-qPCR.

Gene	Primers (5′-3′)	Amplicon size (bp)
Nested	F: TTGATGGATTAAGTTAGGGATTGTAA	623
	R: CCCCTACCTTCCAAAATATTAACA
FHIT M	F: TTTTCGTTTTTGTTTTTAGATAAGC	157
	R: AAAAATATACCCACTAAATAACCGC
FHIT U	F: TGGTTTTTGTTTTTGTTTTTAGATAAGT	159
	R: AAAATATACCCACTAAATAACCACC
FHIT RT-qPCR	F: ACCTGCGTCCTGATGAAGTG	144
	R: CGTGAACGTGCTTCACAGTC
GAPDH RT-qPCR	F: GAAGGTGAAGGTCGGAGTC	226
	R: GAAGATGGTGATGGGATTTC

[i] MS-PCR, methylation specific polymerase chain reaction; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; FHIT, fragile histidine triad; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Analysis of FHIT gene expression by RT-qPCR in patients with ALL and healthy controls

Total mRNA extraction from fresh whole blood was conducted using the commercially available kit, GeneJET RNA Purification kit (Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's protocol. cDNA synthesis was performed using the AccuPower CycleScript RT PreMix kit (Bioneer Corp., Daejeon, Korea) in a final volume of 20 µl according to the manufacturer's protocol. The mRNA expression levels of FHIT and an internal control gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were detected by qPCR using SYBR Green 2X RealQ Plus master mix (Amplicon; Bio, Korea; www.amplicon.com) on the ABI quantitative Real-Time PCR system (Applied Biosystems, Thermo Fisher Scientific, Inc.). All primer sequences are presented in Table I. To each 0.2 ml PCR reaction tube, 1 µl of cDNA, 1 µl of forward and reverse primers, 10 µl 2X RealQ Plus Master Mix Green High Rox (Amplicon Bio, Korea) and 7 µl dH2O was added. The PCR conditions were set as follows: 95°C for 6 min, 40 cycles of 95°C for 40 sec, 63°C for 40 sec, and 72°C for 35 sec, with a final extension step of 72°C for 10 min. Results are presented as gene expression fold change of ALL samples compared with controls, according to the 2−∆∆Cq method (31).

Statistical analysis

Statistical analysis was performed using SPSS 20.0 software (IBM Corp., Armonk, NY, USA). Data were analyzed using an independent sample t-test for continuous data and Fisher's exact test or χ2 test for categorical data. The odds ratio (OR) and 95% confidence intervals (CI) were calculated from logistic regression analysis to identify the associations between methylation status and ALL. P<0.05 was considered to indicate a statistically significant difference.

Results

The case-control study was conducted on 100 childhood ALL cases (54 male, 46 female; age, 5.5±3.6 years) and 120 healthy children (58 male, 62 female; age, 5.6±2.9 years). No significant differences were observed between groups regarding sex and age (P=0.419 and 0.761, respectively). Table II presents the promoter DNA methylation status of the FHIT gene in patients with ALL and controls. The frequency distribution of non-methylation, partial methylation and hypermethylation in cases and controls were 12.0, 65.0, and 23.0%, and 25.0, 62.5, and 12.5%, respectively. Hypermethylation of the FHIT gene was significantly more frequent in children with ALL than in healthy controls (OR=3.83, 95% CI=1.51–9.75, P=0.007). FHIT mRNA expression levels in ALL cases and controls are presented in Fig. 2. These results revealed that the gene expression of FHIT was significantly downregulated in ALL cases compared with that in healthy children (1.231±0.204 vs. 2.124±0.349; P=0.032).

Figure 2. Relative mRNA expression of FHIT in patients with childhood ALL and controls. mRNA expression levels of FHIT were significantly downregulated in ALL (P=0.032). Statistical analysis was performed using an unpaired t-test with Welch's correction. FHIT, fragile histidine triad; ALL, acute lymphoblastic leukeamia.

Table II. Promoter DNA methylation of the FHIT gene in patients with ALL and controls.

Table II.

Promoter DNA methylation of the FHIT gene in patients with ALL and controls.

Methylation status	Cases, n (%)	Controls, n (%)	OR (95% CI)	P-value
Absent	12 (12.0)	30 (25.0)	1.00
Partial	65 (65.0)	75 (62.5)	2.17 (1.03–4.58)	0.050a
Present	23 (23.0)	15 (12.5)	3.83 (1.51–9.75)	0.007a
Partial + present	88 (88.0)	90 (75.0)	2.44 (1.18–5.08	0.016a

a P<0.05. OR, odds ratio; CI, confidence interval.

Discussion

FHIT is a candidate tumor suppressor gene in multiple types of cancer, although the mechanism of tumor suppression by FHIT is not fully understood. Several investigations have revealed that FHIT overexpression leads to the activation of the two main apoptotic pathways, the extrinsic caspase-8 pathway and the intrinsic mitochondrial pathway (32–34). The inactivation of programmed cell death may lead to tumorigenesis (35).

In the present study, hypermethylation of the FHIT gene was demonstrated to be significantly more frequent in children with ALL than in healthy controls. Furthermore, the gene expression of FHIT was significantly lower in patients with childhood ALL compared with healthy controls. The results of the present study indicated that epigenetic modifications and altered gene expression of FHIT in childhood ALL, may contribute to the development of this disease.

In agreement with results of the present study, Malak et al (19) demonstrated that the expression of FHIT was significantly lower in childhood ALL compared with healthy children. In addition, Chen et al (36) reported that mRNA expression of FHIT was significantly lower and methylation frequency of FHIT was significantly higher in ALL samples compared with controls.

Previous studies have provided evidence that DNA methylation is the most commonly detected alteration in adult ALL (37–40). Genome-wide DNA methylation profiles are commonly altered in pediatric ALL (41). It has been demonstrated that hypermethylation of multiple genes may be involved in the relapse of childhood ALL (42). Suppression of FHIT may be involved in the development of rearranged acute lymphoblastic leukemia, an aggressive type of ALL (43).

A meta-analysis performed by Wu et al (13) indicated that FHIT hypermethylation, which induces the inactivation of the FHIT gene, is associated with an increased risk and adverse clinical outcome of NSCLC. It has been demonstrated that FHIT promoter hypermethylation is associated with the development of breast cancer and certain poor prognostic features of the disease (14). FHIT may be a potential drug target for the development of demethylation treatment for patients with breast cancer (44). Furthermore, hypermethylation of the FHIT promoter was previously demonstrated to be involved in the development and transformation of fetal mesenchymal stem cells into F6 tumor cells (45). In conclusion, the results of the present study suggested that hypermethlation and mRNA downregulation of FHIT gene may be involved in the development of pediatric ALL. Further studies are required to reveal the exact role of FHIT on ALL risk.

Acknowledgements

The present study was supported by a dissertation grant (no. 6858) from the Zahedan University of Medical Sciences.

References