Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
October-2017 Volume 14 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2017 Volume 14 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

FHIT promoter DNA methylation and expression analysis in childhood acute lymphoblastic leukemia

  • Authors:
    • Gholamreza Bahari
    • Mohammad Hashemi
    • Majid Naderi
    • Simin Sadeghi‑Bojd
    • Mohsen Taheri
  • View Affiliations / Copyright

    Affiliations: Cellular and Molecular Research Center, Zahedan University of Medical Sciences, Zahedan 98167‑43181, Iran, Department of Pediatrics, Zahedan University of Medical Sciences, Zahedan 98167‑43181, Iran, Genetics of Non‑Communicable Disease Research Center, Zahedan University of Medical Sciences, Zahedan 98167‑43181, Iran
  • Pages: 5034-5038
    |
    Published online on: August 23, 2017
       https://doi.org/10.3892/ol.2017.6796
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Fragile histidine triad (FHIT) is a tumor suppressor gene, which is involved in several malignancies. Epigenetic alterations in FHIT have been hypothesized to contribute to tumorigenesis. The present study aimed to examine DNA promoter methylation and gene expression levels of FHIT in childhood acute lymphoblastic leukemia (ALL), in a sample of Iranian patients. The promoter methylation status of FHIT was analyzed in 100 patients diagnosed with ALL and 120 healthy control patients. mRNA expression levels were assessed in 30 new cases of ALL compared with 32 healthy controls. Hypermethylation of the FHIT promoter was significantly more frequent in patients with ALL than in healthy controls (OR=3.83, 95% CI=1.51‑9.75, P=0.007). Furthermore, FHIT mRNA expression levels were significantly reduced in childhood ALL patients compared with healthy controls (P=0.032). The results of the present study revealed that dysregulation of the FHIT gene may contribute to the pathogenesis of childhood ALL. Future studies investigating a larger sample population with greater ethnic diversity would be beneficial, to confirm the results from the present study.

Introduction

Acute lymphoblastic leukemia (ALL) is the most common type of childhood cancer (1). In all cases of childhood leukemia, ~80% are ALL, which represents ~25% of cancers in children diagnosed <15 years of age in the United States in 2014 (2). Although the etiology of ALL is largely unknown, it has been proposed that multiple gene alterations, including inactivation of tumor suppressor genes, activation of proto-oncogenes and chromosomal rearrangements, in addition to gene-environmental interplay, are involved in disease development (1,3,4). Chromosomal abnormalities, including homozygous deletions and loss of heterozygosity, are among the most common characteristics of human tumors. The fragile histidine triad (FHIT) gene is located on the short arm of human chromosome-3 (3p14.2) which is a major site of chromosomal rearrangement (5).

FHIT protein has previously been proposed to act as a tumor suppressor (6–8). However, the exact mechanisms by which FHIT mediates its suppressive functions are not well understood. Several researchers have indicated that restoration of FHIT expression suppresses tumorigenicity, and transfection of FHIT in FHIT-deficient human cancer cells appears to induce apoptosis and inhibit cell growth (8–11). DNA hypermethylation may occur in genes involved in the cell cycle, DNA damage repair and signaling pathways. DNA methylation is a well-studied epigenetic modification, which significantly contributes to leukemia development (12). Several studies have demonstrated an association between FHIT hypermethylation and an increased risk of non-small-cell lung carcinoma (NSCLC) (13), breast cancer (14,15), cervical cancer (16), hepatocellular carcinoma (17) and thyroid carcinoma (18). Furthermore, downregulation of FHIT expression has been observed in acute lymphoblastic leukemia (ALL) (19), gastric cancer (20), colon adenocarcinoma (21), nasopharyngeal carcinoma (22) and colorectal cancer (23).

It has been proposed that the loss of normal FHIT function may be involved in the pathogenesis of several human leukemias, and the aberrant expression of FHIT is specific and frequent in leukemia samples (24,25). The frequent loss of FHIT expression in ALL suggests that inactivating alterations at the FHIT locus may contribute to the development of leukemias (26). The present study aimed to assess promoter methylation status and expression levels of the FHIT gene in childhood ALL.

Materials and methods

Patients

A case-control study was conducted, in which 100 children diagnosed with ALL (54 male, 46 female; age, 5.5±3.6 years) and 120 age and sex matched healthy controls (58 male, 62 female; age, 5.6±2.9 years) in Zahedan, Iran were enrolled. All subjects were selected from the Ali-Ebne-Abitaleb Hospital, Zahedan University of Medical Sciences (Zahedan, Iran) between February 2013 and May 2014. Details of the study design and enrolment process have been previously described (27–29). Analysis of DNA methylation in the FHIT promoter was performed in 100 ALL cases and 120 healthy age and sex matched cases. Analysis of FHIT mRNA expression levels was conducted in 30 new cases of childhood ALL (20 males and 10 females; mean age, 5.5±3.4 years; age range, 1–15 years) and 32 healthy age and sex matched children (15 males and 17 females; mean age, 5.0±4.1 years; age range, 1–15 years). The subjects were selected from the Ali-Ebne-Abitaleb Hospital, Zahedan University of Medical Sciences (Zahedan, Iran) between February 2013 and May 2014. The local ethics committee of Zahedan University of Medical Sciences (Zahedan, Iran) approved the studies and written informed consent was obtained from parents of cases and controls.

Promoter methylation

A methylation specific PCR (MSP) technique was used for determination of promoter DNA methylation status. Whole blood samples (2 ml) were collected in EDTA-containing tubes, and genomic DNA was extracted using the salting out method as described previously (30). DNA was modified by sodium bisulfite using the CPGenome™ Direct Prep Bisulfite Modification kit (Merck KGaA, Darmstadt, Germany). An MSP was established for the evaluation of FHIT promoter methylation. The primer sequences are listed in Table I. To each 0.2 ml PCR reaction tube, 1 µl bisulfite-converted DNA, 1 µl of forward and reverse primer (10 µM) and 17 µl dH2O were added with HotStart PCR PreMix (AccuPower, Bionner Corp, Daejean, South Korea). The PCR conditions were set as follows: 95°C for 5 min, 30 cycles of 95°C for 30 sec, 58°C for 30 sec, and 72°C for 30 sec, with a final extension step of 72°C for 5 min. The PCR product (623 bp) was used as a template for MSP. MSP was performed using two pairs of primers; one pair specific for methylated and the other for unmethylated template (Table I). In each 0.2 ml PCR reaction tube, 0.5 µl nested PCR product, 1 µl of each primer (10 µM) and 10 µl 2X Prime Taq Premix (GeNet Bio, Daejean, South Korea) and 7 µl dH2O were added. MSP conditions included an initial denaturation step at 95°C for 5 min, followed by 30 cycles of 30 sec at 95°C, annealing at 58°C for 30 sec, and extension at 72°C for 30 sec, with a final extension step at 72°C for 5 min. The methylated and unmethylated PCR products were 157 and 159 bp, respectively (Fig. 1).

Figure 1.

Electrophoresis pattern of promoter methylation of FHIT using methylation specific polymerase chain reaction. Lane 1, MU; lane 2, MM; lane 3, UU. M, DNA marker; FHIT, fragile histidine triad; MU, methylated unmethylated; MM, methylated methylated; UU, unmethylated unmethylated.

Table I.

Primer sequences for MS-PCR and RT-qPCR.

Table I.

Primer sequences for MS-PCR and RT-qPCR.

GenePrimers (5′-3′)Amplicon size (bp)
NestedF: TTGATGGATTAAGTTAGGGATTGTAA623
R: CCCCTACCTTCCAAAATATTAACA
FHIT MF: TTTTCGTTTTTGTTTTTAGATAAGC157
R: AAAAATATACCCACTAAATAACCGC
FHIT UF: TGGTTTTTGTTTTTGTTTTTAGATAAGT159
R: AAAATATACCCACTAAATAACCACC
FHIT RT-qPCRF: ACCTGCGTCCTGATGAAGTG144
R: CGTGAACGTGCTTCACAGTC
GAPDH RT-qPCRF: GAAGGTGAAGGTCGGAGTC226
R: GAAGATGGTGATGGGATTTC

[i] MS-PCR, methylation specific polymerase chain reaction; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; FHIT, fragile histidine triad; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Analysis of FHIT gene expression by RT-qPCR in patients with ALL and healthy controls

Total mRNA extraction from fresh whole blood was conducted using the commercially available kit, GeneJET RNA Purification kit (Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's protocol. cDNA synthesis was performed using the AccuPower CycleScript RT PreMix kit (Bioneer Corp., Daejeon, Korea) in a final volume of 20 µl according to the manufacturer's protocol. The mRNA expression levels of FHIT and an internal control gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were detected by qPCR using SYBR Green 2X RealQ Plus master mix (Amplicon; Bio, Korea; www.amplicon.com) on the ABI quantitative Real-Time PCR system (Applied Biosystems, Thermo Fisher Scientific, Inc.). All primer sequences are presented in Table I. To each 0.2 ml PCR reaction tube, 1 µl of cDNA, 1 µl of forward and reverse primers, 10 µl 2X RealQ Plus Master Mix Green High Rox (Amplicon Bio, Korea) and 7 µl dH2O was added. The PCR conditions were set as follows: 95°C for 6 min, 40 cycles of 95°C for 40 sec, 63°C for 40 sec, and 72°C for 35 sec, with a final extension step of 72°C for 10 min. Results are presented as gene expression fold change of ALL samples compared with controls, according to the 2−∆∆Cq method (31).

Statistical analysis

Statistical analysis was performed using SPSS 20.0 software (IBM Corp., Armonk, NY, USA). Data were analyzed using an independent sample t-test for continuous data and Fisher's exact test or χ2 test for categorical data. The odds ratio (OR) and 95% confidence intervals (CI) were calculated from logistic regression analysis to identify the associations between methylation status and ALL. P<0.05 was considered to indicate a statistically significant difference.

Results

The case-control study was conducted on 100 childhood ALL cases (54 male, 46 female; age, 5.5±3.6 years) and 120 healthy children (58 male, 62 female; age, 5.6±2.9 years). No significant differences were observed between groups regarding sex and age (P=0.419 and 0.761, respectively). Table II presents the promoter DNA methylation status of the FHIT gene in patients with ALL and controls. The frequency distribution of non-methylation, partial methylation and hypermethylation in cases and controls were 12.0, 65.0, and 23.0%, and 25.0, 62.5, and 12.5%, respectively. Hypermethylation of the FHIT gene was significantly more frequent in children with ALL than in healthy controls (OR=3.83, 95% CI=1.51–9.75, P=0.007). FHIT mRNA expression levels in ALL cases and controls are presented in Fig. 2. These results revealed that the gene expression of FHIT was significantly downregulated in ALL cases compared with that in healthy children (1.231±0.204 vs. 2.124±0.349; P=0.032).

Figure 2.

Relative mRNA expression of FHIT in patients with childhood ALL and controls. mRNA expression levels of FHIT were significantly downregulated in ALL (P=0.032). Statistical analysis was performed using an unpaired t-test with Welch's correction. FHIT, fragile histidine triad; ALL, acute lymphoblastic leukeamia.

Table II.

Promoter DNA methylation of the FHIT gene in patients with ALL and controls.

Table II.

Promoter DNA methylation of the FHIT gene in patients with ALL and controls.

Methylation statusCases, n (%)Controls, n (%)OR (95% CI)P-value
Absent12 (12.0)30 (25.0)1.00
Partial65 (65.0)75 (62.5)2.17 (1.03–4.58)0.050a
Present23 (23.0)15 (12.5)3.83 (1.51–9.75)0.007a
Partial + present88 (88.0)90 (75.0)2.44 (1.18–5.080.016a

a P<0.05. OR, odds ratio; CI, confidence interval.

Discussion

FHIT is a candidate tumor suppressor gene in multiple types of cancer, although the mechanism of tumor suppression by FHIT is not fully understood. Several investigations have revealed that FHIT overexpression leads to the activation of the two main apoptotic pathways, the extrinsic caspase-8 pathway and the intrinsic mitochondrial pathway (32–34). The inactivation of programmed cell death may lead to tumorigenesis (35).

In the present study, hypermethylation of the FHIT gene was demonstrated to be significantly more frequent in children with ALL than in healthy controls. Furthermore, the gene expression of FHIT was significantly lower in patients with childhood ALL compared with healthy controls. The results of the present study indicated that epigenetic modifications and altered gene expression of FHIT in childhood ALL, may contribute to the development of this disease.

In agreement with results of the present study, Malak et al (19) demonstrated that the expression of FHIT was significantly lower in childhood ALL compared with healthy children. In addition, Chen et al (36) reported that mRNA expression of FHIT was significantly lower and methylation frequency of FHIT was significantly higher in ALL samples compared with controls.

Previous studies have provided evidence that DNA methylation is the most commonly detected alteration in adult ALL (37–40). Genome-wide DNA methylation profiles are commonly altered in pediatric ALL (41). It has been demonstrated that hypermethylation of multiple genes may be involved in the relapse of childhood ALL (42). Suppression of FHIT may be involved in the development of rearranged acute lymphoblastic leukemia, an aggressive type of ALL (43).

A meta-analysis performed by Wu et al (13) indicated that FHIT hypermethylation, which induces the inactivation of the FHIT gene, is associated with an increased risk and adverse clinical outcome of NSCLC. It has been demonstrated that FHIT promoter hypermethylation is associated with the development of breast cancer and certain poor prognostic features of the disease (14). FHIT may be a potential drug target for the development of demethylation treatment for patients with breast cancer (44). Furthermore, hypermethylation of the FHIT promoter was previously demonstrated to be involved in the development and transformation of fetal mesenchymal stem cells into F6 tumor cells (45). In conclusion, the results of the present study suggested that hypermethlation and mRNA downregulation of FHIT gene may be involved in the development of pediatric ALL. Further studies are required to reveal the exact role of FHIT on ALL risk.

Acknowledgements

The present study was supported by a dissertation grant (no. 6858) from the Zahedan University of Medical Sciences.

References

1 

Belson M, Kingsley B and Holmes A: Risk factors for acute leukemia in children: A review. Environ Health Perspect. 115:138–145. 2007. View Article : Google Scholar : PubMed/NCBI

2 

Ward E, DeSantis C, Robbins A, Kohler B and Jemal A: Childhood and adolescent cancer statistics, 2014. CA Cancer J Clin. 64:83–103. 2014. View Article : Google Scholar : PubMed/NCBI

3 

Guo LM, Xi JS, Ma Y, Shao L, Nie CL and Wang GJ: ARID5B gene rs10821936 polymorphism is associated with childhood acute lymphoblastic leukemia: A meta-analysis based on 39,116 subjects. Tumour Biol. 35:709–713. 2014. View Article : Google Scholar : PubMed/NCBI

4 

Ma Y, Sui Y, Wang L and Li H: Effect of GSTM1 null genotype on risk of childhood acute leukemia: A meta-analysis. Tumour Biol. 35:397–402. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Pekarsky Y, Zanesi N, Palamarchuk A, Huebner K and Croce CM: FHIT: From gene discovery to cancer treatment and prevention. Lancet Oncol. 3:748–754. 2002. View Article : Google Scholar : PubMed/NCBI

6 

Ohta M, Inoue H, Cotticelli MG, Kastury K, Baffa R, Palazzo J, Siprashvili Z, Mori M, McCue P, Druck T, et al: The FHIT gene, spanning the chromosome 3p14.2 fragile site and renal carcinoma-associated t (3;8) breakpoint, is abnormal in digestive tract cancers. Cell. 84:587–597. 1996. View Article : Google Scholar : PubMed/NCBI

7 

Brenner C, Bieganowski P, Pace HC and Huebner K: The histidine triad superfamily of nucleotide-binding proteins. J Cell Physiol. 181:179–187. 1999. View Article : Google Scholar : PubMed/NCBI

8 

Siprashvili Z, Sozzi G, Barnes LD, McCue P, Robinson AK, Eryomin V, Sard L, Tagliabue E, Greco A, Fusetti L, et al: Replacement of Fhit in cancer cells suppresses tumorigenicity. Proc Natl Acad Sci USA. 94:13771–13776. 1997. View Article : Google Scholar : PubMed/NCBI

9 

Ji L, Fang B, Yen N, Fong K, Minna JD and Roth JA: Induction of apoptosis and inhibition of tumorigenicity and tumor growth by adenovirus vector-mediated fragile histidine triad (FHIT) gene overexpression. Cancer Res. 59:3333–3339. 1999.PubMed/NCBI

10 

Sard L, Accornero P, Tornielli S, Delia D, Bunone G, Campiglio M, Colombo MP, Gramegna M, Croce CM, Pierotti MA and Sozzi G: The tumor-suppressor gene FHIT is involved in the regulation of apoptosis and in cell cycle control. Proc Natl Acad Sci USA. 96:8489–8492. 1999. View Article : Google Scholar : PubMed/NCBI

11 

Sevignani C, Calin GA, Cesari R, Sarti M, Ishii H, Yendamuri S, Vecchione A, Trapasso F and Croce CM: Restoration of fragile histidine triad (FHIT) expression induces apoptosis and suppresses tumorigenicity in breast cancer cell lines. Cancer Res. 63:1183–1187. 2003.PubMed/NCBI

12 

Agrawal S, Unterberg M, Koschmieder S, zur Stadt U, Brunnberg U, Verbeek W, Büchner T, Berdel WE, Serve H and Müller-Tidow C: DNA methylation of tumor suppressor genes in clinical remission predicts the relapse risk in acute myeloid leukemia. Cancer Res. 67:1370–1377. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Wu X, Wu G, Yao X, Hou G and Jiang F: The clinicopathological significance and ethnic difference of FHIT hypermethylation in non-small-cell lung carcinoma: A meta-analysis and literature review. Drug Des Devel Ther. 10:699–709. 2016.PubMed/NCBI

14 

Zaki SM, Abdel-Azeez HA, El Nagar MR, Metwally KAS and Ahmed MM: Analysis of FHIT gene methylation in egyptian breast cancer women: Association with clinicopathological features. Asian Pac J Cancer Prev. 16:1235–1239. 2015. View Article : Google Scholar : PubMed/NCBI

15 

Liu L, Sun L, Li C, Li X, Zhang Y, Yu Y and Xia W: Quantitative detection of methylation of FHIT and BRCA1 promoters in the serum of ductal breast cancer patients. Biomed Mater Eng. 26 Suppl 1:S2217–S2222. 2015.PubMed/NCBI

16 

Banzai C, Nishino K, Quan J, Yoshihara K, Sekine M, Yahata T and Tanaka K: Gynecological Cancer Registry of Niigata: Promoter methylation of DAPK1, FHIT, MGMT, and CDKN2A genes in cervical carcinoma. Int J Clin Oncol. 19:127–132. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Zhang X, Li HM, Liu Z, Zhou G, Zhang Q, Zhang T, Zhang J and Zhang C: Loss of heterozygosity and methylation of multiple tumor suppressor genes on chromosome 3 in hepatocellular carcinoma. J Gastroenterol. 48:132–143. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Yin DT, Wang L, Sun J, Yin F, Yan Q, Shen R, He G and Gao JX: Association of the promoter methylation and protein expression of Fragile Histidine Triad (FHIT) gene with the progression of differentiated thyroid carcinoma. Int J Clin Exp Pathol. 3:482–491. 2010.PubMed/NCBI

19 

Malak CA, Elghanam DM and Elbossaty WF: FHIT gene expression in acute lymphoblastic leukemia and its clinical significance. Asian Pac J Cancer Prev. 16:8197–8201. 2015. View Article : Google Scholar : PubMed/NCBI

20 

Liao J, Wen S, Cao L, Zhou Y and Feng Z: Effect of eradication of Helicobacter pylori on expression levels of FHIT, IL-8 and P73 in gastric mucosa of first-degree relatives of gastric cancer patients. PLoS One. 10:e01245762015. View Article : Google Scholar : PubMed/NCBI

21 

Kapitanović S, Čačev T, Lončar B, Ivković Catela T, Križanac Š and Pavelić K: Reduced FHIT expression is associated with tumor progression in sporadic colon adenocarcinoma. Exp Mol Pathol. 96:92–97. 2014. View Article : Google Scholar : PubMed/NCBI

22 

Chen X, Li P, Yang Z and Mo WN: Expression of fragile histidine triad (FHIT) and WW-domain oxidoreductase gene (WWOX) in nasopharyngeal carcinoma. Asian Pac J Cancer Prev. 14:165–171. 2013. View Article : Google Scholar : PubMed/NCBI

23 

Al-Temaimi RA, Jacob S, Al-Ali W, Thomas DA and Al-Mulla F: Reduced FHIT expression is associated with mismatch repair deficient and high CpG island methylator phenotype colorectal cancer. J Histochem Cytochem. 61:627–638. 2013. View Article : Google Scholar : PubMed/NCBI

24 

Sugimoto K, Yamada K, Miyagawa K, Hirai H and Oshimi K: Decreased or altered expression of the FHIT gene in human leukemias. Stem Cells. 15:223–228. 1997. View Article : Google Scholar : PubMed/NCBI

25 

Iwai T, Yokota S, Nakao M, Nakazawa N, Taniwaki M, Kimura T, Sonoda Y, Kaneko H, Okuda T, Azuma H, et al: Frequent aberration of FHIT gene expression in acute leukemias. Cancer Res. 58:5182–5187. 1998.PubMed/NCBI

26 

Hallas C, Albitar M, Letofsky J, Keating MJ, Huebner K and Croce CM: Loss of FHIT expression in acute lymphoblastic leukemia. Clin Cancer Res. 5:2409–2414. 1999.PubMed/NCBI

27 

Hashemi M, Sheybani-Nasab M, Naderi M, Roodbari F and Taheri M: Association of functional polymorphism at the miR-502-binding site in the 3′ untranslated region of the SETD8 gene with risk of childhood acute lymphoblastic leukemia, a preliminary report. Tumour Biol. 35:10375–10379. 2014. View Article : Google Scholar : PubMed/NCBI

28 

Hasani SS, Hashemi M, Eskandari-Nasab E, Naderi M, Omrani M and Sheybani-Nasab M: A functional polymorphism in the miR-146a gene is associated with the risk of childhood acute lymphoblastic leukemia: A preliminary report. Tumour Biol. 35:219–225. 2014. View Article : Google Scholar : PubMed/NCBI

29 

Hashemi M, Ebrahimi M, Amininia S, Naderi M, Eskanadri-Nasab E and Taheri M: Evaluation of rs3102735 and rs2073617 osteoprotegerin gene polymorphisms and the risk of childhood acute lymphocytic leukemia in Zahedan Southeast Iran. Int J Hematol Oncol Stem Cell Res. 8:39–44. 2014.PubMed/NCBI

30 

Hashemi M, Moazeni-Roodi AK, Fazaeli A, Sandoughi M, Bardestani GR, Kordi-Tamandani DM and Ghavami S: Lack of association between paraoxonase-1 Q192R polymorphism and rheumatoid arthritis in southeast Iran. Genet Mol Res. 9:333–339. 2010. View Article : Google Scholar : PubMed/NCBI

31 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

32 

Ishii H, Dumon KR, Vecchione A, Trapasso F, Mimori K, Alder H, Mori M, Sozzi G, Baffa R, Huebner K and Croce CM: Effect of adenoviral transduction of the fragile histidine triad gene into esophageal cancer cells. Cancer Res. 61:1578–1584. 2001.PubMed/NCBI

33 

Roz L, Gramegna M, Ishii H, Croce CM and Sozzi G: Restoration of fragile histidine triad (FHIT) expression induces apoptosis and suppresses tumorigenicity in lung and cervical cancer cell lines. Proc Natl Acad Sci USA. 99:3615–3620. 2002. View Article : Google Scholar : PubMed/NCBI

34 

Dumon KR, Ishii H, Vecchione A, Trapasso F, Baldassarre G, Chakrani F, Druck T, Rosato EF, Williams NN, Baffa R, et al: Fragile histidine triad expression delays tumor development and induces apoptosis in human pancreatic cancer. Cancer Res. 61:4827–4836. 2001.PubMed/NCBI

35 

Ghavami S, Hashemi M, Ande SR, Yeganeh B, Xiao W, Eshraghi M, Bus CJ, Kadkhoda K, Wiechec E, Halayko AJ and Los M: Apoptosis and cancer: Mutations within caspase genes. J Med Genet. 46:497–510. 2009. View Article : Google Scholar : PubMed/NCBI

36 

Chen X, Zhang H, Li P, Yang Z, Qin L and Mo W: Gene expression of WWOX, FHIT and p73 in acute lymphoblastic leukemia. Oncol Lett. 6:963–969. 2013.PubMed/NCBI

37 

Garcia-Manero G, Daniel J, Smith TL, Kornblau SM, Lee MS, Kantarjian HM and Issa JP: DNA methylation of multiple promoter-associated CpG islands in adult acute lymphocytic leukemia. Clin Cancer Res. 8:2217–2224. 2002.PubMed/NCBI

38 

Yang Y, Takeuchi S, Hofmann WK, Ikezoe T, van Dongen JJ, Szczepański T, Bartram CR, Yoshino N, Taguchi H and Koeffler HP: Aberrant methylation in promoter-associated CpG islands of multiple genes in acute lymphoblastic leukemia. Leuk Res. 30:98–102. 2006. View Article : Google Scholar : PubMed/NCBI

39 

Garcia-Manero G, Yang H, Kuang SQ, O'Brien S, Thomas D and Kantarjian H: Epigenetics of acute lymphocytic leukemia. Semin Hematol. 46:24–32. 2009. View Article : Google Scholar : PubMed/NCBI

40 

Paulsson K, An Q, Moorman AV, Parker H, Molloy G, Davies T, Griffiths M, Ross FM, Irving J, Harrison CJ, et al: Methylation of tumour suppressor gene promoters in the presence and absence of transcriptional silencing in high hyperdiploid acute lymphoblastic leukaemia. Br J Haematol. 144:838–847. 2009. View Article : Google Scholar : PubMed/NCBI

41 

Chatterton Z, Morenos L, Mechinaud F, Ashley DM, Craig JM, Sexton-Oates A, Halemba MS, Parkinson-Bates M, Ng J, Morrison D, et al: Epigenetic deregulation in pediatric acute lymphoblastic leukemia. Epigenetics. 9:459–467. 2014. View Article : Google Scholar : PubMed/NCBI

42 

Matsushita C, Yang Y, Takeuchi S, Matsushita M, Van Dongen JJ, Szczepanski T, Bartram CR, Seo H, Koeffler HP and Taguchi H: Aberrant methylation in promoter-associated CpG islands of multiple genes in relapsed childhood acute lymphoblastic leukemia. Oncol Rep. 12:97–99. 2004.PubMed/NCBI

43 

Stam RW, den Boer ML, Passier MM, Janka-Schaub GE, Sallan SE, Armstrong SA and Pieters R: Silencing of the tumor suppressor gene FHIT is highly characteristic for MLL gene rearranged infant acute lymphoblastic leukemia. Leukemia. 20:264–271. 2006. View Article : Google Scholar : PubMed/NCBI

44 

Su Y, Wang X, Li J, Xu J and Xu L: The clinicopathological significance and drug target potential of FHIT in breast cancer, a meta-analysis and literature review. Drug Des Devel Ther. 9:5439–5445. 2015.PubMed/NCBI

45 

Xu XJ, Gao S, Wang M, Qian H, Gu GY, Zhang K and Xu WR: Methylation status of the gene in the transformed human mesenchymal F6 stem cell line. Oncol Lett. 9:2661–2666. 2015.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Bahari G, Hashemi M, Naderi M, Sadeghi‑Bojd S and Taheri M: FHIT promoter DNA methylation and expression analysis in childhood acute lymphoblastic leukemia. Oncol Lett 14: 5034-5038, 2017.
APA
Bahari, G., Hashemi, M., Naderi, M., Sadeghi‑Bojd, S., & Taheri, M. (2017). FHIT promoter DNA methylation and expression analysis in childhood acute lymphoblastic leukemia. Oncology Letters, 14, 5034-5038. https://doi.org/10.3892/ol.2017.6796
MLA
Bahari, G., Hashemi, M., Naderi, M., Sadeghi‑Bojd, S., Taheri, M."FHIT promoter DNA methylation and expression analysis in childhood acute lymphoblastic leukemia". Oncology Letters 14.4 (2017): 5034-5038.
Chicago
Bahari, G., Hashemi, M., Naderi, M., Sadeghi‑Bojd, S., Taheri, M."FHIT promoter DNA methylation and expression analysis in childhood acute lymphoblastic leukemia". Oncology Letters 14, no. 4 (2017): 5034-5038. https://doi.org/10.3892/ol.2017.6796
Copy and paste a formatted citation
x
Spandidos Publications style
Bahari G, Hashemi M, Naderi M, Sadeghi‑Bojd S and Taheri M: FHIT promoter DNA methylation and expression analysis in childhood acute lymphoblastic leukemia. Oncol Lett 14: 5034-5038, 2017.
APA
Bahari, G., Hashemi, M., Naderi, M., Sadeghi‑Bojd, S., & Taheri, M. (2017). FHIT promoter DNA methylation and expression analysis in childhood acute lymphoblastic leukemia. Oncology Letters, 14, 5034-5038. https://doi.org/10.3892/ol.2017.6796
MLA
Bahari, G., Hashemi, M., Naderi, M., Sadeghi‑Bojd, S., Taheri, M."FHIT promoter DNA methylation and expression analysis in childhood acute lymphoblastic leukemia". Oncology Letters 14.4 (2017): 5034-5038.
Chicago
Bahari, G., Hashemi, M., Naderi, M., Sadeghi‑Bojd, S., Taheri, M."FHIT promoter DNA methylation and expression analysis in childhood acute lymphoblastic leukemia". Oncology Letters 14, no. 4 (2017): 5034-5038. https://doi.org/10.3892/ol.2017.6796
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team