This article is mentioned in:

Introduction

Adoptive immunotherapy is an effective and safe anticancer therapy (1), and currently used for various tumor treatments, including renal cell carcinoma (2), lung cancer (3), breast cancer (4), melanoma (5), and hepatoma (6).

As a valuable cancer therapeutic scheme, numerous studies focused on T cells in order to further improve the antitumor activity of adoptive immunotherapy (1). Rettinger et al (7) and Meng et al (8) demonstrated that IL-15 and IL-21, respectively were able to promote the proliferative, and cytotoxic activity of cytokine-induced killer cells (CIKs). Rutella et al (9) noted that thymoglobulin efficiently expanded the CIK population, and that the CIKs generated by thymoglobulin were feasible and safe for solid tumor treatment. Tan et al (10) verified that K-ras dendritic cells were able to enhance CIK proliferation and increase the killing effect on pancreatic cancer cells. Though the activity of CIKs may be enhanced by technological strategies, maneuvers to improve the antitumor efficacy through the use of T cells have been under exploration (11). However, the proteins associated with CIK activity remain unclear.

In the present study, it was demonstrated that the cytotoxicity of CIKs was significantly influenced following gentamicin treatment. Further research verified that a protein identified by proteomic and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) strategies was associated with CIK activity. The results of the current study have important implications for the investigation of the CIK activity-enhancement mechanism.

Materials and methods

CIK culture and protein extraction

Peripheral blood was donated from a 31-year-old male volunteer following written informed consent being obtained. The present study was approved by the Animal Welfare and Research Ethics Committee of the Institute of University of South China (Hengyang, China).

Lymphocytes were separated and cultured as reported by Pan et al (12), and Laport et al (13) with certain modifications. Equivalent volumes of peripheral blood and 0.9% physiological saline were mixed followed with ficoll gradient separation (LymphoPrep; PAA Laboratories; GE Healthcare, Chicago, IL, USA). Following centrifugation at 800 × g for 20 min at room temperature, the leukocyte layer was collected and washed twice with 0.9% physiological saline. Following centrifugation at 500 × g for 7 min at room temperature, the cells cultured with gentamicin (80 U/ml; Yichang Humanwell Pharmaceutical Co., Ltd., Yichang, China) were defined as the experiment group, and the cells cultured with no gentamicin were defined as the control group. The lymphocytes were cultured in GT-T551 medium (Takara Biotechnology Co., Ltd., Dalian, China) with 1,000 U/ml γ-interferon (Beijing Biocoen Biotechnology Co., Ltd., Beijing, China) and 10% autologous plasma added on day 0. Then, 50 µg/ml CD3 monoclonal antibody (catalogue no. Mab-37; Skoda Biotechnology Co., Ltd., Shanghai, China) and 100 U/ml interleukin 1α PeproTech China, Suzhou, China) were added on day 1. Subsequently, 1,000 U/ml recombinant human interleukin 2 (SL Pharma Labs, Inc., Wilmington, DE, USA) and 2% autologous plasma were added to the medium from day 1 onward. The cells were cultured at 37°C with 5% CO2 until the 11th day.

The CIK protein was extracted as reported by Gao et al (14) with certain modifications. The CIKs were centrifuged at 150 × g for 10 min at 4°C, and the precipitate was washed with 1 ml 0.9% physiological saline three times. After resuspension in 0.1 ml 0.9% physiological saline, the CIKs were lysed by freezing-thawing from −80°C to room temperature five times, and then centrifuged at 13,000 × g for 10 min at 4°C. After determining the protein concentration using the Bradford method (15), the supernatant was collected and stored at −20°C with 1 Mm phenylmethanesulfonyl fluoride (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) for subsequent analysis.

Flow cytometry analysis

A total of 1 ml CIK suspension was collected following centrifugation at 150 × g for 10 min at room temperature, the precipitate was resuspended in 1 ml of 0.9% physiological saline and centrifuged at 150 × g for 10 min at room temperature. The precipitate was then resuspended in 150 µl 0.9% physiological saline and divided into two groups. One group as the isotype control with FITC mouse IgG 2α (5 µl; catalogue no. 555573; BD Biosciences, Franklin Lakes, NJ, USA) added, and the control or experiment groups had FITC mouse anti-human CD3 (5 µl; catalogue no. 555339; BD Biosciences) added. The three groups were all incubated 15 min at room temperature, then resuspended in 1 ml 0.9% physiological saline, and centrifuged at 150 × g for 10 min at room temperature. Finally, the precipitate was resuspended in 0.2 ml 0.9% physiological saline, and prepared for analysis using a BD Accuri C6 flow cytometer (BD Biosciences).

MTT analysis

The HepG2 hepatoma cell line, which was purchased from the Advanced Research Center of Central South University (Changsha, China), was cultured in Dulbecco's modified Eagle's medium (Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% FBS (Thermo Fisher Scientific, Inc.) at 37°C and in 5% CO2. Hepatoma cells used as target cells were obtained at the logarithmic growth phase and the concentration was adjusted to 4×104 cells/ml. CIKs cultured for 11 days were used as effector cells and mixed with target cells in the ratio 40:1 (effector cell:target cell). A total of 10 ml CIK culture medium was collected following centrifugation at 150 × g for 10 min at room temperature. The precipitate was resuspended in GT-T551 containing 2% autologous plasma and diluted to 1.6×106 cells/ml. The suspension was divided into three groups: The effector-target group, 100 µl effector and target cells; effector cell group, 100 µl effector cells and GT-T551 culture medium; target cell group, 100 µl target cells and GT-T551 culture medium. All groups were cultured at 37°C and 5% CO2 for 24 h. A total of five parallel experiments were used in each group. Then, 10 µl MTT (5 mg/ml) was added and cultured at 37°C with 5% CO2 for 4 h. Following centrifugation at 900 × g for 5 min at room temperature, the precipitate was dissolved with 100 µl DMSO, agitated for 15 min at 37°C, and the optical density (OD) was detected at 490 nm. The killing rate (%) was calculated as follows: [1 - (ODeffector-target cell well - ODeffector cell well) / ODtarget cell well × 100%.

One-dimensional gel electrophoresis (1-DE) analysis

1-DE was performed using a 5% stacking gel (pH 6.8) and an 8% separating gel (pH 8.9) in Tris-glycine buffer (pH 8.3), and 10 µg protein was analyzed. The gels were run at 60 V for 45 min, then 120 V for 2–3 h per gel in an ice-bath until the bromophenol blue dye had migrated to <1 cm from the bottom of the gel. Subsequently, The gels were stained with coomassie brilliant blue R-250 at room temperature for 15 min. The bands was analyzed using Quantity One 4.6.2 (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Mass spectrometry analysis

Differentially expressed proteins bands were excised from 1-DE gels for LC-MS/MS mass spectrometry analysis. Briefly, after the gel plug was digested with trypsin, 10 µl of the peptide mixture was separated with a linear gradient of 5–80% buffer B [100% acetonitrile, 0.1% formic acid (FA)] at a flow rate of 400 nl/min on a C18-reversed phase column packed in-house with Eprogen-Pur C18-AQ 5 µm resin in buffer A (100% H2O, 0.1% FA). A prominence nano 2D chromatography system (Shimadzu Corp., Kyoto, Japan) was coupled online to the micrOTOF-QII (Bruker Corporation, Billerica, MA, USA). The data was collected using BrukerDaltonicsmicrOTOFcontrol software 3.2 (Bruker Corporation) with the conditions 50–2,200 m/z scan range, 1,500 V capillary voltages, and 150°C drying argon gas temperature. Finally, the selected peptide masses were analyzed using DataAnalysis software 4.1 (Bruker Corporation) and searched using the Mascot search engine version 2.3.01 (http://www.bgi-proteomics.cn/tocsam/cgi/master_results_2.pl?file=20140317%2FF044726.dat;pr.eh=3%2C3p#tc:rf:hits:3).

Western blot analysis

Following 1-DE, the gel was separately transferred to a polyvinylidene fluoride (PVDF) membrane for 90 min at 300 mA in transfer buffer (25 mM Tris, 0.1 M glycine, and 20% methanol). Subsequently, the membranes were blocked for 1 h in TBS-Tween 20 (TBST; 0.05% Tween-20, 20 mM Tris, 150 mM NaCl, pH 7.4) containing 5% skim milk at room temperature. After washing three times with TBS for 5 min each, the PVDF membrane was incubated with rabbit anti-human haptoglobin (catalogue no. BA3744; Wuhan Boster Biological Technology, Ltd., Wuhan, China) at a dilution of 1:200 in TBST containing 5% skim milk at room temperature for 1 h. The membrane was washed three times with TBS for 20 min and incubated with goat anti-rabbit IgG-horseradish peroxidase antibody (catalogue no. MBS856805; Sino-American Bio. Corp., Luoyang, China) at a dilution of 1:1,000 in TBST containing 5% skim milk at room temperature for 40 min. Next, the membrane was washed two times with TBS for 20 min and analyzed using the ECL Plus (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) chemiluminescence detection method. Finally, the results were analyzed using Quantity One 4.6.2 (Bio-Rad Laboratories, Inc.).

RNA isolation and RT-qPCR analysis

Total RNA was extracted from CIKs using the RNAsimple Total RNA Kit (Tiangen Biotech Co., Ltd., Beijing, China) according to the manufacturer's protocol. A total of 1 µg RNA was synthesized to cDNA using the RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Following cDNA synthesis, a RT-qPCR assay was performed as Livak and Schmittgen (16) reported with some modification. A segment of 141 and 221 bp was amplified using primer sets Haptoglobin-F/Haptoglobin-R (Table I) and β-actin-F/β-actin-R (Table I), respectively. RT-qPCR was performed in a volume of 20 µl containing 10 µl 2X Master mix (Maxima SYBR Green/ROX qPCR Master Mix kit; Thermo Fisher Scientific, Inc.), 0.3 µl of 10 µM Forward Primer, 0.3 µl of 10 µM Reverse Primer, 0.8 µl cDNA and 8.6 µl dH2O. Next, the 20-µl mixture was analyzed using ABI Stepone Plus (Thermo Fisher Scientific, Inc.), under the following thermocycling conditions: 1 cycle of 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec, 60°C for 30 sec and 72°C for 15 sec and a final cycle of 60°C for 1 min and 95°C for 15 sec. Data were normalized according to the 2−ΔΔCq method (16). The assays were performed in three independent experiments.

Table I. Nucleotide sequences of primers.

Table I.

Nucleotide sequences of primers.

Primera	Sequence (5′-3′)
Haptoglobin-F	CAGCCAGAAACATAACCC
Haptoglobin-R	TCTACACCCTAACTACTCCC
β-actin-F	ATCGTGCGTGACATTAAGGAG
β-actin-R	TAGGTGCTTTGATGGAAGTTGAG

a The primers of haptoglobin were designed according to its cDNA sequence (GenBank: K00422.1). F, forward; R, reverse.

Statistical analysis

The data were presented as the mean ± standard deviation. Statistical analyses were performed using SPSS version 17.0 (SPSS, Inc., Chicago, IL, USA). Differences were determined using the Student's t-test. P<0.05 or P<0.01 were respectively considered to indicate significant or very significant differences. All experiments were repeated at least three times.

Results

Ratio and activity analyzed for CIKs

In order to investigate the associated protein activity of CIKs cultured in vitro, gentamicin was selected as an activity inhibitor. Following stimulation, the ratio of CIKs in the control and experiment groups were 98.2 and 98.3%, respectively (Fig. 1A and B). However, the activity of CIKs in the experiment group (34.3%) was very significantly lower compared with the control group (55.2%; P<0.01; Fig. 1C) because of the effect of gentamicin.

Figure 1. Cytokine-induced killer cells purity and activity analyzed by flow cytometry and MTT methods. The ratio of the CD3+ subtype in the (A) control group and (B) experiment group by flow cytometry. (C) Antitumor activity of T cells on hepatoma cells investigated using an MTT assay. Bars represent mean + standard deviation. (n=3). **P<0.01. CD, cluster of differentiation.

Differentially expressed protein analyzed

Based on the changes in CIK activity, an unknown differential expression protein (P43) was identified using 1-DE (Fig. 2A). As presented in Fig. 2A, the P43 molecular weight was ~43 kDa, and the expression of P43 was significantly downregulated by 1.22-fold compared with the control group (P<0.05; Fig. 2B).

Figure 2. 1-DE was used to identify differentially expressed proteins in cytokine-induced killer cells. (A) 1-DE analysis of P43 protein: Lane 1, molecular mass markers; lane 2, control group; lane 3, experiment group. (B) The histogram analysis of gray values. Bars represent mean + standard deviation. (n=3). *P<0.05. 1-DE, One-dimensional gel electrophoresis.

Identification of P43

For further investigation on the P43 protein in CIKs, the P43 foci was detected as Homo sapien haptoglobin protein (P00738) using LC-MS/MS (Tables II and III). As Tables II and III demonstrates, the matched amino acid sequences of haptoglobin attained an overall score of 159, and the molecular and isoelectric point was 45861 Da, and 6.13, respectively. Following a 1-DE separation and western blotting, the P43 protein in CIKs lysis was demonstrated to specifically react with the rabbit anti-human-haptoglobin (Fig. 3A). Together, these results suggested that the P43 protein was haptoglobin.

Figure 3. Identification and analysis of haptoglobin. The rabbit anti-haptoglobin (1:200) or rabbit anti-β-actin (1:200), and goat anti-rabbit IgG-horseradish peroxidase (1:1,000) were used as the primary and secondary antibodies, respectively. (A) Haptoglobin identified by 1-DE and western blotting. Lane 1, 1-DE of T cell proteins; lane 2, western blotting. (B) Western blotting of haptoglobin from T cells. Lane 1, control group; Lane 2, experiment group for haptoglobin and β-actin. (C) The histogram analysis of gray values, gray value ratio=the gray value of haptoglobin/the gray value of β-actin. Bars represent mean + standard deviation. (n=3). *P<0.05. 1-DE, One-dimensional gel electrophoresis.

Table II. Identification of the differentially expressed protein in cytokine-induced killer cells using liquid chromatography-mass spectrometry.

Table II.

Identification of the differentially expressed protein in cytokine-induced killer cells using liquid chromatography-mass spectrometry.

Protein	Accession name	Description	Species	Mr (Da)	pI	Trends in expression
P43	P00738	Haptoglobin	Homo sapiens	45861	6.13	↓

[i] pI, isoelectric point; Mr, molecular weight.

Table III. Matched amino acid sequences of haptoglobin (P00738) protein identified using liquid chromatography-mass spectrometry.

Table III.

Matched amino acid sequences of haptoglobin (P00738) protein identified using liquid chromatography-mass spectrometry.

Observed	Mr (expt)	Mr (calc)	Delta	Miss	Score	Start-end	Sequence
709.9410	1417.8673	1417.8181	0.0493	1	56	216–228	DIAPTLTLYVGKK
854.4398	1706.8649	1706.8120	0.0529	0	27	298–311	YVMLPVADQDQCIR
724.7164	2171.1274	2171.0504	0.0770	0	34	326–345	SPVGVQPILNEHTFCAGMSK
602.3429	1202.6712	1202.6295	0.0417	0	42	392–401	VTSIQDWVQK

[i] Mr, molecular weight; expt, expected; calc, calculated.

Haptoglobin expression analyzed

To analyze the expression of haptoglobin protein, western blotting was performed (Fig. 3). In the CIK protein, only haptoglobin could specifically reacted with rabbit anti-haptoglobin (Fig. 3A). Further investigation revealed that the expression level of b-actin in the control and experiment groups was similar and the haptoglobin was significantly downregulated by 1.17-fold compared with the control group (P<0.05; Fig. 3B and C).

Haptoglobin mRNA analyzed

Based on the proteomic results, a RT-qPCR assay was performed to determine the transcription levels of haptoglobin in CIKs. As presented in Fig. 4, SpHMC mRNA in the experiment group was significantly downregulated by 1.73-fold compared with the control group (P<0.01; Fig. 4).

Figure 4. Reverse transcription-quantitative polymerase chain reaction analysis of haptoglobin mRNA transcripts in cytokine-induced killer cells. Haptoglobin mRNA was normalized against β-actin mRNA levels. Bars represent mean + standard deviation. (n=3). **P<0.01.

Discussion

CIKs adoptive immunotherapy is used in tumor treatment due to its efficiently antitumor activity (17–20). Gentamicin is a broad-spectrum antibiotic used to preserve the aseptic culture of cells (21–23). In the present study, it was demonstrated that the CIK activity was significant inhibited by gentamicin, and further research revealed that a protein P43 was associated with CIK activity.

To determine the identity of the P43 protein, 1-DE with LC-MS/MC was performed (24,25). The P43 protein was successfully identified as human haptoglobin. This was similar to the findings that an unknown protein spot identified as haptoglobin in patient sera using the mass spectra strategy (26–28). For further verification of the mass spectra results, western blotting was used (29), and the results demonstrated that haptoglobin protein was specificity connected with rabbit anti-human-haptoglobin. Therefore, it was concluded that the P43 protein was haptoglobin.

Haptoglobin is a hemoglobin-binding protein expressed by a genetic polymorphism for prevented oxidative damage in plasma (30–32). However, research has identified that haptoglobin was also involved in the immune response (33,34). Delanghe et al (35) demonstrated that haptoglobin phenotypes may influence T cells activation and effect the interplay of lymphocytes. Shen et al (36) reported that haptoglobin activates the innate immunity. Kreisel and Goldstein (37) noted that haptoglobin was a novel protein activator of the innate immune system and involved in immune modulatory as a known acute phase protein. These results demonstrated that the concentration of haptoglobin in CIKs treated with gentamicin was significantly downregulated by 1.17 using western blotting. Thus, it was deduced that the haptoglobin was associated with the enhancement of CIK activity.

To further illustrate the association of haptoglobin with CIKs activity, a quantitative RT-qPCR assay was performed. As a result, the mRNA level of haptoglobin in CIKs treated with gentamicin was significantly downregulated by 1.73-fold compared with the control group. This is similar to the finding that haptoglobin expression signal was decreased 5.1-fold in peripheral blood mononuclear cells from healthy participants compared with methotrexate-resistant patients with rheumatoid arthritis (38). Herein, these results suggest that haptoglobin was involved in the activity-enhancement of CIKs.

In conclusion, it was identified that haptoglobin in CIKs was an activity-enhancement-associated protein. To the best of our knowledge, this is the first study to demonstrate that haptoglobin may be associated with the activity-enhancement of CIKs. Further investigation is required to explore its exact role of the signaling pathway associated with an increase in CIK activity.

Acknowledgements

The present study was supported by The Foundation of Hunan Provincial Key Laboratory for Special Pathogens Prevention and Control Foundation (grant no. 2014-5), The Hunan Province Cooperative Innovation Center for Molecular Target New Drug Study (grant no. 2015-351), and National Natural Science Foundation of China (grant no. 81101274).

References