Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
March-2018 Volume 15 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March-2018 Volume 15 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Dihydroartemisinin-induced apoptosis in human acute monocytic leukemia cells

  • Authors:
    • Jia‑Tian Cao
    • Hui‑Min Mo
    • Yue Wang
    • Kai Zhao
    • Tian‑Tian Zhang
    • Chang‑Qian Wang
    • Kai‑Lin Xu
    • Zhi‑Hua Han
  • View Affiliations / Copyright

    Affiliations: Department of Cardiology, The Ninth People's Hospital, Shanghai Jiaotong University Medical School, Shanghai 200011, P.R. China, Institute of Hematology, Xuzhou Medical University, Xuzhou, Jiangsu 221002, P.R. China
  • Pages: 3178-3184
    |
    Published online on: December 19, 2017
       https://doi.org/10.3892/ol.2017.7644
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Dihydroartemisinin (DHA) is a derivative of artemisinin. The present study aimed to investigate whether DHA induces apoptosis in the THP‑1 human acute monocytic leukemia cell line (AMoL), and to identify the relative molecular mechanisms. The results of the present study demonstrated that the viability of THP‑1 cells were inhibited by DHA in a dose‑ and time‑dependent manner, which was accompanied by morphological characteristics associated with apoptosis. After 24 h of 200 µM DHA treatment, the proportion of apoptotic cells was significantly increased compared with the untreated controls (P<0.01). In addition, DHA downregulated the levels of B‑cell lymphoma (Bcl)‑2, protein kinase B (Akt)1, Akt2 and Akt3 gene expression, and increased the expression of the Bcl‑2‑associated X protein apoptosis regulator. The protein expression of phospho‑Akt and phospho‑extracellular signal‑regulated kinase (ERK) was also decreased, and the protein expression level of cleaved caspase‑3 was increased following treatment with DHA. Therefore, DHA may induce apoptosis in the AMoL THP‑1 cell line via currently unknown underlying molecular mechanisms, including the downregulation of ERK and Akt, and the activation of caspase-3.

Introduction

Acute myeloid leukemia (AML) is a clonal disorder that comprises a group of clonal malignant diseases, in which the cancer cells originate from the bone marrow and display genetic instability, leading to the accumulation of abnormal immature myeloid cells in the bone marrow and blood (1). The principal therapeutic strategies for patients with AML are aggressive chemotherapeutic regimens and hematopoietic stem cell transplantation (HSCT) (1–3). However, AML consists of 8 subtypes, including M0 (minimally differentiated AML), M1 (AML without maturation), M2 (AML with maturation), M3 (acute promyelocytic leukemia), M4 (acute myelomonocytic leukemia), M5 [acute monocytic leukemia (AMoL)], M6 (erythroleukemia) and M7 (acute megakaryoblastic leukemia). Patients with AML who receive intensive chemotherapy may achieve complete remission; however, the overall survival rate of patients with AML is poor and the treatment is typically associated with serious complications (4). In addition, there is no optimal therapeutic schedule for each type of AMoL (5). Therefore, the aim of the present study was to identify a novel drug for treating M5 (AMoL).

The development of AMoL is a complex, multistep and multifactorial process. Features of M5 typically include increased numbers of white blood cells, an increased rate of marrow infiltration and an increase in chromosomal aberrations including translocation, mutation, aneuploidy and the formation of fusion genes (6,7). Furthermore, the clinical complete remission rate is low with poor prognosis. A total of 87 different translocations have been identified, with 11q23 chromosomal abnormalities accounting for ~22% of M5 cases. There are various chemotherapy regimens used to treat patients with AMoL including: i) Homoharringtonine, cytarabine and etoposide; ii) daunorubicin, Ara-c and teniposide; and iii) mitoxantrone, Ara-c and teniposide (7). However, AMoL is insensitive to a number of chemotherapy regimens, thus patients with AMoL exhibit a low remission rate and decreased survival time (2,6,7). Therefore, novel effective drugs are required.

Since novel antitumor drugs fell under investigation, bioactive natural products have emerged and gained considerable attention. Artemisinin is an effective drug for treating malaria and belongs to the family of sesquiterpene lactones, which are produced by the Artemisia annua plant (8). Dihydroartemisinin (DHA) is a water-soluble semi-synthetic derivative of artemisinin (9), and it is commercially combined with piperaquine as an effective therapy for malaria with limited side effects (10,11). In addition, DHA has been identified to exhibit inhibitory effects on cancer cells, including lung carcinoma (12), osteosarcoma (13) and ovarian cancer (14). Previous studies have demonstrated that DHA may inhibit molt-4 acute lymphoid cell leukemia cells (15,16). However, the effects and underlying mechanisms of action of DHA in AMoL remain unknown.

Therefore, the aim of the present study was to analyze the antitumor effects of DHA against AMoL and to investigate its underlying biological mechanisms. An in vitro approach (Fig. 1A) was used to elucidate the molecular mechanisms underlying these effects of DHA. The results of the present study verified that DHA exhibited effective antitumor activity against AMoL in vitro via the downregulation of phospho-protein kinase B (p-Akt) and p-extracellular signal-regulated kinase (ERK) protein expression, and the upregulation of cleaved caspase-3 levels.

Figure 1.

Proliferation inhibition of THP-1 cells following treatment with DHA. (A) Schematic of the approach used in this study. (B) The morphology of THP-1 cells at ×40 and ×100 following 0, 25, 50, 100, 150 and 200 µM DHA treatment. (C) CCK-8 assay indicated that DHA could inhibit the proliferation of THP-1 cells in a dose- and time-dependent manner. Data are presented as the mean ± standard deviation. **P<0.01, *P<0.05. All data were obtained from at least three independent experiments. DHA, dihydroartemisinin; CCK-8, Cell Counting Kit-8.

Materials and methods

Reagents and antibodies

The chemical reagents, including DHA, used in the present study were purchased from Sigma-Aldrich (Merck KGaA, Darmstadt, Germany) unless stated otherwise. A stock solution (200 mM) of DHA was prepared in dimethyl sulfoxide (Sigma-Aldrich; Merck KGaA) and stored at −20°C. Primary antibodies against p-ERK (cat. no. 4348S), total (t)-ERK (cat. no. 4695S), p-Akt (cat. no. 4060S), t-Akt (cat. no. 4685S), cleaved caspase-3 (cat. no. 1050S), β-actin (cat. no. 4970S) and secondary antibodies (cat. no. 7074) were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA).

Cell culture

The THP-1 human acute monocytic leukemia cell line was purchased from the Chinese Academy of Sciences (Shanghai, China). THP-1 cells were cultured in RPMI-1640 (HyClone; GE Healthcare, Logan, UT, USA) supplemented with 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin (all from HyClone; GE Healthcare) at 37°C in a humidified atmosphere containing 5% CO2. All cells were used within 20 passages.

Cell viability assay

DHA cytotoxicity was determined using a Cell Counting Kit-8 (CCK-8; Dojindo Molecular Technologies, Inc., Kumamoto, Japan), which evaluated the metabolic activity of viable cells. A total of 20,000 cells/well were seeded into 96-well plates in RPMI-1640 medium, which contained 100 nM phorbol 12-myristate 13-acetate to induce adherence as THP-1 cells were suspending cells, and subsequently treated with 0, 25, 50, 100, 150 or 200 µM DHA for 24, 48, 72 and 96 h at 37°C. Following treatment with DHA for 24, 48, 72 and 96 h, the RPMI-1640 medium was removed and the cells were washed with PBS. Subsequently, 100 µl RPMI-1640 medium and 10 µl CCK-8 solution was added to each well and incubated at 37°C for 2.5 h. The optical density (OD) at 450 nm was determined daily for the following 4 days using a microplate reader (BioTek Instruments, Inc., Winooski, VT, USA). All measurements were repeated in triplicate. The cell viability compared with the control group was calculated using the following equation: Cell viability to control (%)=ODdrug-treated group/ODcontrol group.

Apoptosis analysis

Cells were seeded at 1×106 cells/well in 6-well plates and harvested 24 h after treatment with 0, 25, 50, 100, 150 and 200 µM DHA. Cells were centrifuged at 500 × g for 5 min at 4°C and the supernatants were discarded. Subsequently, the cells were resuspended in 1X annexin-binding buffer (BD Biosciences, Franklin Lakes, NJ, USA). Apoptotic cells were determined using annexin V-fluorescein isothiocyanate and propidium iodide staining (BD Biosciences, Franklin Lakes, NJ, USA) and quantified using a flow cytometer (BD Biosciences). FlowJo software (version 7.6.1; FlowJo LLC, Ashland, OR, USA) was used to analyze the rate of apoptosis. The cell proliferation results presented in Fig. 1B and C demonstrate the inhibitory effect of DHA on THP-1 cell proliferation. Therefore, further analysis was used to determine whether DHA is able to induce apoptosis. In Fig. 2A, the lower right quadrant represents early apoptosis, whereas the upper right quadrant represents late apoptosis. The proportion of apoptotic cells identified includes cells in early and late apoptosis.

Figure 2.

Apoptosis of THP-1 cells following DHA treatment. (A) Flow cytometry-based assessment of apoptosis in THP-1 cells with treated with various concentrations of DHA. (B) Early apoptosis rates of THP-1 cells. (C) Late apoptosis rates of THP-1 cells. (D) Total apoptosis rates of THP-1 cells. Data are presented as the mean ± standard deviation. ***P<0.001, **P<0.01. All data were obtained from at least three independent experiments. DHA, dihydroartemisinin.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

THP-1 cells (1×106 cells/well) were seeded at in 6-well plates and harvested following treatment with 0, 25, 50, 100, 150 and 200 µM DHA for 24 h. Cells were centrifuged at 500 × g for 5 min at 4°C and the supernatants were discarded. Total RNA was isolated from THP-1 cells treated with 0, 25, 50, 100, 150 and 200 µM DHA using the AxyPrep™ Multisource Total RNA Miniprep kit (Axygen Scientific, Inc., Union City, CA, USA). Equivalent amounts of RNA were converted into cDNA using the PrimeScript™ RT Reagent kit (Takara Bio, Inc., Otsu, Japan) at 37°C for 15 min and 85°C for 5 sec. cDNA was measured using a Nanodrop 2000 instrument (Thermo Fisher Scientific, Waltham, MA, USA). qPCR was performed using an ABI 7500 Sequencing Detection System and SYBR® Premix Ex Taq (Takara Bio, Inc.). All procedures were performed according to the manufacturers' protocols. Cycling conditions included 40 cycles of 95°C for 5 sec and 60°C for 34 sec. Gene expression was quantified using the 2−∆∆Cq method (17). β-actin was used as the reference gene and all primer sequences are listed in Table I.

Table I.

Sequences of primers used in reverse transcription-quantitative polymerase chain reaction.

Table I.

Sequences of primers used in reverse transcription-quantitative polymerase chain reaction.

GeneDirectionPrimer sequence (5′-3′)
Akt1Forward ATGAGCGACGTGGCTATTGTGAAG
Reverse GAGGCCGTCAGCCACAGTCTGGATG
Akt2Forward ATGAATGAGGTGTCTGTCATCAAAGAAGGC
Reverse TGCTTGAGGCTGTTGGCGACC
Akt3Forward CAGTCTGTCTGCTACAGCCTGGATA
Reverse ATGAGCGATGTTACCATTGT
Bcl-2Forward GAACTGGGGGAGGATTGTGG
Reverse CCGTACAGTTCCACAAAGGC
BaxForward CCAGAGGCGGGGTTTCAT
Reverse GGAAAAAGACCTCTCGGGGG
β-actinForward CCAACCGCGAGAAGATGA
Reverse CCAGAGGCGTACAGGGATAG

[i] ERK, extracellular-signal-regulated kinase; Akt, protein kinase B; Bcl-2, B-cell lymphoma 2; Bax, Bcl-2-associated X protein.

Western blot analysis

THP-1 cells were analyzed using qPCR and cells were lysed in lysis buffer containing complete EDTA-free tablets which are a protease inhibitor cocktail containing phenylmethylsulfonyl fluoride, aprotinin, bestatin, E-64, leupeptin and pepstatin A (Roche Applied Science, Penzbery, Germany). The protein concentration was quantified using the bicinchoninic acid protein assay kit (Santa Cruz Biotechnology, Inc., Dallas, TX, USA). For western blot analysis, 20 µg total protein were boiled and subsequently separated by SDS-PAGE using a 10% gel for p-Akt, total (t-) Akt, p-ERK, t-ERK and β-actin and a 12.5% gel for cleaved caspase-3. Following electrophoresis, proteins were blotted onto polyvinylidene difluoride membranes and blocked by 5% skimmed milk suspended in Tris-buffered saline with Tween-20 for 1 h at room temperature. Each membrane was incubated with appropriate primary antibodies against p-Akt, t-Akt, p-ERK, t-ERK, cleaved caspase-3 and β-actin, with a dilution ratio of 1:1,000 at 4°C overnight. Blots were subsequently incubated with a horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature. Protein bands were visualized using X-ray films and an enhanced chemiluminescence detection system (GE Healthcare Life Sciences, Little Chalfont, UK). Positive immunoreactive bands were densitometrically quantified and normalized to β-actin. Adobe Photoshop (Creative Suite 5; Adobe Systems, Inc., San Jose, CA, USA) was used for densitometry.

Statistical analysis

SPSS software (version 19.0; IBM Corp., Armonk, NY, USA) was used to analyze the data. The differences between the experimental groups and controls were assessed using the Student's t-test or one-way analysis of variance as appropriate. The data are expressed as the mean ± standard deviation. All data were obtained from at least three independent experiments. P<0.05 was considered to indicate a statistically significant difference.

Results

THP-1 cell viability decreases following DHA treatment

To investigate the effects of DHA, a cell viability assay using CCK-8 was performed on THP-1 cells. The viability of THP-1 cells was inhibited following treatment with DHA, accompanied by the appearance of morphological characteristics of apoptosis (Fig. 1B). The inhibitory effect of DHA on the viability of THP-1 cells was markedly increased at higher DHA concentrations following 96 h of treatment (P<0.05; Fig. 1C). DHA may inhibit the proliferation of THP-1 cells in a dose- and time-dependent manner.

DHA induces the apoptosis of THP-1 cells

As presented in Fig. 2, flow cytometry analysis was used to evaluate DHA-induced apoptosis. DHA significantly increased the total apoptosis rate (4.9 control vs. 12.77, 13.24, 20.28, 33.68 and 65.08% when treated with 25, 50, 100, 150 and 200 µM DHA, respectively; P<0.05; Fig. 2A and D), and quantitative data regarding the early and late apoptosis rate were consistent with this (Fig. 2B and C). The results of the present study validated the inhibitory function of DHA functioned via the activation of the apoptosis pathway in THP-1 cells.

Downstream gene expression

To investigate the molecular mechanisms underlying the inhibitory effects of DHA in THP-1 human monocytic leukemia cells, RT-qPCR was used to examine variations in gene expression. It was demonstrated that the gene expression levels of Akt1, Akt2, Akt3 and B-cell lymphoma 2 (Bcl-2) were decreased in DHA-treated THP-1 cells in a dose-dependent manner, whereas the expression of Bcl-2-associated X protein (Bax) was upregulated (Fig. 3). The results indicated that these genes are potential downstream targets of DHA in monocytic leukemia treatment.

Figure 3.

Apoptosis-associated gene expression in THP-1 cells following DHA treatment. RT-qPCR was employed to detect the expression of (A) Akt1, (B) Akt2, (C) Akt3, (D) Bcl-2 and (E) Bax in DHA-treated THP-1 cells. Data are presented as the mean ± standard deviation. ***P<0.001, **P<0.01, *P<0.05. All data were obtained from at least three independent experiments. RT-qPCR, reverse transcription quantitative polymerase chain reaction; Akt, protein kinase B; Bcl-2, B cell lymphoma 2; Bax, Bcl-2-associated X protein; DHA, dihydroartemisinin.

Akt, ERK and cleaved caspase-3 are potential downstream targets of DHA

Western blot analysis was used to determine the protein expression levels of phospho (p)-Akt/total-Akt, p-ERK/total-ERK and cleaved caspase-3 in THP-1 cells, following different concentrations of DHA treatment. The results revealed that the levels of p-Akt and p-ERK with increasing concentrations of DHA (Fig. 4A-C). However, DHA increased the levels of cleaved caspase-3 in a dose-dependent manner (Fig. 4A and D). Therefore, the results suggested that Akt, ERK and cleaved caspase-3 are potential downstream targets of DHA-induced apoptosis in THP-1 cells.

Figure 4.

Western blots of p-t-Akt, p-ERK/t-ERK and cleaved caspase-3 levels following the DHA-induced apoptosis of THP-1 cells. (A) Expression of p/total-Akt, p-ERK/total-ERK and cleaved caspase-3 in THP-1 cells following DHA treatment. Levels of (B) p-t-Akt, (C) p-ERK/t-ERK and (D) cleaved caspase-3 in THP-1 cells. Results are expressed as the ratio of cleaved caspase-3 to β-actin, p-Akt to t-Akt and p-ERK to t-ERK. Data are presented as the mean ± standard deviation. ***P<0.001, **P<0.01. All data were obtained from at least three independent experiments. p-, phosphorylated; t-, total; DHA, dihydroartemisinin; Akt, protein kinase B; ERK, extracellular-signal-regulated kinase.

Discussion

Induction failure and a high incidence of relapse due to drug resistance are the principal problems surrounding AML treatment (2,18). The use of novel drugs is one approach for treating patients who are resistant to standard therapies (19). Clinical evaluation of potentially effective drugs is essential to cancer chemotherapy, and may improve the prognosis of patients with refractory leukemia (20). AMoL is a rare but distinct disease, the increasing number of monocytes throughout its clinical course characterizes the disease, and cytogenetic characterization is required for diagnosis and prognosis stratification (21,22). Thus, there is a requirement to identify less toxic and more efficacious treatment alternatives. As a result, increasing attention has been focused on the application of natural products in the treatment of AMoL (3).

DHA, one of the bioactive derivatives of artemisinin, has been investigated for the treatment of certain tumor types; Professor Tu YouYou, who discovered DHA, was awarded the Nobel Prize in 2015 (23,24). A number of additional pharmacological effects of DHA have been identified, including antitumor activity towards hepatocellular carcinoma in vitro and in vivo (25). Furthermore, DHA was identified to prevent breast cancer-induced osteolysis via inhibiting breast cancer cells and osteoclasts (26). For leukemia treatment, DHA can induce autophagy and inhibit the growth of iron-loaded human myeloid leukemia K562 cells via reactive oxygen species toxicity (27); DHA and its derivative induce apoptosis in acute myeloid leukemia cells through the Noxa-mediated pathway, requiring iron and an endoperoxide moiety (28). However, the effect of DHA on AMoL has yet to be fully elucidated.

The aim of the present study was to investigate whether DHA had antitumor activity against human AMoL. It was identified that DHA has a strong anti-leukemia effect in the THP-1 AMoL cell line in vitro. The results indicated that DHA inhibited the spontaneous growth of THP-1 cells in a time- and dose-dependent manner. To further investigate the mechanisms of DHA anti-leukemia activity, the effect of DHA was analyzed with regards to apoptosis and the activation of Akt/ERK survival signaling and Bcl-2/Bax/caspase-3 apoptosis pathways that are constitutively expressed in THP-1 cells. Results of the present study indicated that DHA-induced apoptosis was caused by downregulating Akt/ERK signaling and activating the caspase-3 pathway, following the balance of the Bcl-2/Bax axis.

Distinct from normal cells, leukemia cells often express constitutively active survival-signaling pathways, such as Akt and ERK among others, due to gene mutations, rearrangements and chromosomal translocations; these survival signaling pathways serve vital roles in tumorigenesis, proliferation, anti-apoptosis and drug resistance (29–31). The higher the number of constitutively active growth signaling pathways in acute myelogenous leukemia, the poorer the prognosis. Results indicated that, in the acute monoblastic leukemia cell line THP-1, the Akt and ERK signal transduction pathways were suppressed simultaneously, and that the caspase-3 apoptosis signaling pathway was activated by the downregulation of the Bcl-2/Bax ratio following DHA treatment. It was speculated that DHA-mediated inhibition of Akt/ERK pathway activation and the promotion of caspase-3 activation would result in a more effective response to anti-leukemia therapy, as the inhibitors would simultaneously target three pathways in THP-1 cells.

A number of specific inhibitors target a single signaling molecule in the treatment of leukemia; however, DHA may be more effective compared with common inhibitors as drug resistance frequently emerges following the hyperactivation of alternative signaling pathways under treatment of a single target. It is predicted that DHA-resistance in AMoL may rarely occur, the response to DHA may be increased and response duration may be longer as DHA exhibited multi-targeting characteristics. Inhibition of multiple signaling pathways increases the therapeutic ability of DHA.

In the present study, the role of DHA in restricting the proliferation and inducing apoptosis in AMoL cells was investigated. DHA may directly or indirectly affect the activation of Akt/ERK survival signaling and caspase-3 apoptosis signaling pathways, all of which are key regulators of cell survival and apoptosis, particularly during AMoL treatment (32,33). However, additional in-depth investigations must follow this preliminary study. First, the intermediate molecular mechanisms underlying DHA-mediated changes to cell survival and apoptosis signaling pathways must be clarified. Secondly, in vivo experiments must be carried out to verify the treatment effects of DHA. Finally, the results must be validated through clinical trials and applications.

In conclusion, the present study indicated that DHA exerted effective antitumor activities against AMoL in vitro. Furthermore, DHA downregulated the expression of p-Akt and p-ERK, whilst also upregulating the protein expression of cleaved caspase-3 through increasing the Bcl-2/Bax ratio. This may be one mechanism by which DHA exerts its effects in AMoL. However, further and more comprehensive studies are required to confirm this.

Acknowledgements

The present study was supported by grants from the Shanghai Health Development Planning Commission (grant no. ZY3-CCCX-3-3006), the National Natural Science Foundation of China (grant nos. 81500392 and 31201010), the Shanghai Committee of Science and Technology of China (grant nos. 12ZR1419500 and 114119a8700) and the Shanghai Health Bureau (grant no. ZYSNXD-CCZDYJ029).

References

1 

Ommen HB: Monitoring minimal residual disease in acute myeloid leukaemia: A review of the current evolving strategies. Ther Adv Hematol. 7:3–16. 2016. View Article : Google Scholar : PubMed/NCBI

2 

Peng H, Wang H, Xue P, Hou Y, Dong J, Zhou T, Qu W, Peng S, Li J, Carmichael PL, et al: Suppression of NRF2-ARE activity sensitizes chemotherapeutic agent-induced cytotoxicity in human acute monocytic leukemia cells. Toxicol Appl Pharmacol. 292:1–7. 2016. View Article : Google Scholar : PubMed/NCBI

3 

Guo Y, Shan Q, Gong Y, Lin J, Shi F, Shi R and Yang X: Curcumin induces apoptosis via simultaneously targeting AKT/mTOR and RAF/MEK/ERK survival signaling pathways in human leukemia THP-1 cells. Pharmazie. 69:229–233. 2014.PubMed/NCBI

4 

Ozpolat B, Akar U, Steiner M, Zorrilla-Calancha I, Tirado-Gomez M, Colburn N, Danilenko M, Kornblau S and Berestein GL: Programmed cell death-4 tumor suppressor protein contributes to retinoic acid-induced terminal granulocytic differentiation of human myeloid leukemia cells. Mol Cancer Res. 5:95–108. 2007. View Article : Google Scholar : PubMed/NCBI

5 

Murashige N, Tabanda R and Zalusky R: Occurrence of acute monocytic leukemia in a case of untreated Waldenstrom's macroglobulinemia. Am J Hematol. 71:94–97. 2002. View Article : Google Scholar : PubMed/NCBI

6 

Cline MJ: Histiocytes and histiocytosis. Blood. 84:2840–2853. 1994.PubMed/NCBI

7 

Kumar RK, Basu S, Lemke HD, Jankowski J, Kratz K, Lendlein A and Tetali SD: Effect of extracts of poly(ether imide) microparticles on cytotoxicity, ROS generation and proinflammatory effects on human monocytic (THP-1) cells. Clin Hemorheol Microcirc. 61:667–680. 2016. View Article : Google Scholar : PubMed/NCBI

8 

Li Y: Qinghaosu (artemisinin): Chemistry and pharmacology. Acta Pharmacol Sin. 33:1141–1146. 2012. View Article : Google Scholar : PubMed/NCBI

9 

Lin AJ, Klayman DL and Milhous WK: Antimalarial activity of new water-soluble dihydroartemisinin derivatives. J Med Chem. 30:2147–2150. 1987. View Article : Google Scholar : PubMed/NCBI

10 

Ashley EA, McGready R, Hutagalung R, Phaiphun L, Slight T, Proux S, Thwai KL, Barends M, Looareesuwan S, White NJ and Nosten F: A randomized, controlled study of a simple, once-daily regimen of dihydroartemisinin-piperaquine for the treatment of uncomplicated, multidrug-resistant falciparum malaria. Clin Infect Dis. 41:425–432. 2005. View Article : Google Scholar : PubMed/NCBI

11 

Gordi T and Lepist EI: Artemisinin derivatives: Toxic for laboratory animals, safe for humans? Toxicol Lett. 147:99–107. 2004. View Article : Google Scholar : PubMed/NCBI

12 

Mi YJ, Geng GJ, Zou ZZ, Gao J, Luo XY, Liu Y, Li N, Li CL, Chen YQ, Yu XY and Jiang J: Dihydroartemisinin inhibits glucose uptake and cooperates with glycolysis inhibitor to induce apoptosis in non-small cell lung carcinoma cells. PLoS One. 10:e01204262015. View Article : Google Scholar : PubMed/NCBI

13 

Liu W, Wang DW, Yu SY, Cao Y, Yang L, E XQ, Yao GJ and Bi ZG: The effect of dihydroartemisinin on the proliferation, metastasis and apoptosis of human osteosarcoma cells and its mechanism. J Biol Regul Homeost Agents. 29:335–342. 2015.PubMed/NCBI

14 

Feng X, Li L, Jiang H, Jiang K, Jin Y and Zheng J: Dihydroartemisinin potentiates the anticancer effect of cisplatin via mTOR inhibition in cisplatin-resistant ovarian cancer cells: Involvement of apoptosis and autophagy. Biochem Biophys Res Commun. 444:376–381. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Park J, Lai HC, Singh M, Sasaki T and Singh NP: Development of a dihydroartemisinin-resistant Molt-4 leukemia cell line. Anticancer Res. 34:2807–2810. 2014.PubMed/NCBI

16 

Chan HW, Singh NP and Lai HC: Cytotoxicity of dihydroartemisinin toward Molt-4 cells attenuated by N-tert-butyl-alpha-phenylnitrone and deferoxamine. Anticancer Res. 33:4389–4393. 2013.PubMed/NCBI

17 

Schmittgen TD and Livak KJ: Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 3:1101–1108. 2008. View Article : Google Scholar : PubMed/NCBI

18 

Zhang D, Wang Q, Zhu T, Cao J, Zhang X, Wang J, Wang X, Li Y, Shen B and Zhang J: RACK1 promotes the proliferation of THP1 acute myeloid leukemia cells. Mol Cell Biochem. 384:197–202. 2013. View Article : Google Scholar : PubMed/NCBI

19 

Zeng C, Wang W, Yu X, Yang L, Chen S and Li Y: Pathways related to PMA-differentiated THP1 human monocytic leukemia cells revealed by RNA-Seq. Sci China Life Sci. 58:1282–1287. 2015. View Article : Google Scholar : PubMed/NCBI

20 

Evans FJ and Hilton JH: Polymyositis associated with acute Nonocytic leukemia: Case report and review of the literature. Can Med Assoc J. 91:1272–1275. 1964.PubMed/NCBI

21 

Wang Y, Ma L, Wang C, Sheng G, Feng L and Yin C: Autocrine motility factor receptor promotes the proliferation of human acute monocytic leukemia THP-1 cells. Int J Mol Med. 36:627–632. 2015. View Article : Google Scholar : PubMed/NCBI

22 

Jain SK, Sahu R, Walker LA and Tekwani BL: A parasite rescue and transformation assay for antileishmanial screening against intracellular Leishmania donovani amastigotes in THP1 human acute monocytic leukemia cell line. Journal of visualized experiments. 70:e40542012.

23 

Tu YY: TU You-you won Lasker Debakey clinical medical research award-for her outstanding achievements in studies on artemisinin. Zhongguo Zhong Xi Yi Jie He Za Zhi. 31:13012011.(In Chinese). PubMed/NCBI

24 

Dong YJ, Li WD and Tu YY: Effect of dihydro-qinghaosu on auto-antibody production, TNF alpha secretion and pathologic change of lupus nephritis in BXSB mice. Zhongguo Zhong Xi Yi Jie He Za Zhi. 23:676–679. 2003.(In Chinese). PubMed/NCBI

25 

Zhang CZ, Zhang H, Yun J, Chen GG and Lai PB: Dihydroartemisinin exhibits antitumor activity toward hepatocellular carcinoma in vitro and in vivo. Biochem Pharmacol. 83:1278–1289. 2012. View Article : Google Scholar : PubMed/NCBI

26 

Feng MX, Hong JX, Wang Q, Fan YY, Yuan CT, Lei XH, Zhu M, Qin A, Chen HX and Hong D: Dihydroartemisinin prevents breast cancer-induced osteolysis via inhibiting both breast cancer cells and osteoclasts. Sci Rep. 6:190742016. View Article : Google Scholar : PubMed/NCBI

27 

Wang Z, Hu W, Zhang JL, Wu XH and Zhou HJ: Dihydroartemisinin induces autophagy and inhibits the growth of iron-loaded human myeloid leukemia K562 cells via ROS toxicity. FEBS Open Bio. 2:103–112. 2012. View Article : Google Scholar : PubMed/NCBI

28 

Zhao X, Zhong H, Wang R, Liu D, Waxman S, Zhao L and Jing Y: Dihydroartemisinin and its derivative induce apoptosis in acute myeloid leukemia through Noxa-mediated pathway requiring iron and endoperoxide moiety. Oncotarget. 6:5582–5596. 2015.PubMed/NCBI

29 

Lim SG, Suk K and Lee WH: Reverse signaling from LIGHT promotes pro-inflammatory responses in the human monocytic leukemia cell line, THP-1. Cell Immunol. 285:10–17. 2013. View Article : Google Scholar : PubMed/NCBI

30 

Teng CL, Han SM, Wu WC, Hsueh CM, Tsai JR, Hwang WL and Hsu SL: Mechanistic aspects of lauryl gallate-induced differentiation and apoptosis in human acute myeloid leukemia cells. Food Chem Toxicol. 71:197–206. 2014. View Article : Google Scholar : PubMed/NCBI

31 

Shi D, Xu Y, Du X, Chen X, Zhang X, Lou J, Li M and Zhuo J: Co-treatment of THP-1 cells with naringenin and curcumin induces cell cycle arrest and apoptosis via numerous pathways. Mol Med Rep. 12:8223–8228. 2015. View Article : Google Scholar : PubMed/NCBI

32 

Olesen LH, Aggerholm A, Andersen BL, Nyvold CG, Guldberg P, Nørgaard JM and Hokland P: Molecular typing of adult acute myeloid leukaemia: Significance of translocations, tandem duplications, methylation, and selective gene expression profiling. Br J Haematol. 131:457–467. 2005. View Article : Google Scholar : PubMed/NCBI

33 

Ruvolo PP, Qiu Y, Coombes KR, Zhang N, Neeley ES, Ruvolo VR, Hail N Jr, Borthakur G, Konopleva M, Andreeff M and Kornblau SM: Phosphorylation of GSK3α/β correlates with activation of AKT and is prognostic for poor overall survival in acute myeloid leukemia patients. BBA Clin. 4:59–68. 2015. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Cao JT, Mo HM, Wang Y, Zhao K, Zhang TT, Wang CQ, Xu KL and Han ZH: Dihydroartemisinin-induced apoptosis in human acute monocytic leukemia cells. Oncol Lett 15: 3178-3184, 2018.
APA
Cao, J., Mo, H., Wang, Y., Zhao, K., Zhang, T., Wang, C. ... Han, Z. (2018). Dihydroartemisinin-induced apoptosis in human acute monocytic leukemia cells. Oncology Letters, 15, 3178-3184. https://doi.org/10.3892/ol.2017.7644
MLA
Cao, J., Mo, H., Wang, Y., Zhao, K., Zhang, T., Wang, C., Xu, K., Han, Z."Dihydroartemisinin-induced apoptosis in human acute monocytic leukemia cells". Oncology Letters 15.3 (2018): 3178-3184.
Chicago
Cao, J., Mo, H., Wang, Y., Zhao, K., Zhang, T., Wang, C., Xu, K., Han, Z."Dihydroartemisinin-induced apoptosis in human acute monocytic leukemia cells". Oncology Letters 15, no. 3 (2018): 3178-3184. https://doi.org/10.3892/ol.2017.7644
Copy and paste a formatted citation
x
Spandidos Publications style
Cao JT, Mo HM, Wang Y, Zhao K, Zhang TT, Wang CQ, Xu KL and Han ZH: Dihydroartemisinin-induced apoptosis in human acute monocytic leukemia cells. Oncol Lett 15: 3178-3184, 2018.
APA
Cao, J., Mo, H., Wang, Y., Zhao, K., Zhang, T., Wang, C. ... Han, Z. (2018). Dihydroartemisinin-induced apoptosis in human acute monocytic leukemia cells. Oncology Letters, 15, 3178-3184. https://doi.org/10.3892/ol.2017.7644
MLA
Cao, J., Mo, H., Wang, Y., Zhao, K., Zhang, T., Wang, C., Xu, K., Han, Z."Dihydroartemisinin-induced apoptosis in human acute monocytic leukemia cells". Oncology Letters 15.3 (2018): 3178-3184.
Chicago
Cao, J., Mo, H., Wang, Y., Zhao, K., Zhang, T., Wang, C., Xu, K., Han, Z."Dihydroartemisinin-induced apoptosis in human acute monocytic leukemia cells". Oncology Letters 15, no. 3 (2018): 3178-3184. https://doi.org/10.3892/ol.2017.7644
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team