Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
May-2018 Volume 15 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2018 Volume 15 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Solanine induced apoptosis and increased chemosensitivity to Adriamycin in T-cell acute lymphoblastic leukemia cells

  • Authors:
    • Ying‑Jie Yi
    • Xiu‑Hong Jia
    • Jian‑Yong Wang
    • Jie‑Ru Chen
    • Hong Wang
    • You‑Jie Li
  • View Affiliations / Copyright

    Affiliations: Department of Pediatrics, The Affiliated Hospital of Binzhou Medical University, Binzhou, Shandong 256603, P.R. China, Department of Biochemistry and Molecular Biology, Key Laboratory of Tumour Molecular Biology, Binzhou Medical University, Yantai, Shandong 264003, P.R. China
  • Pages: 7383-7388
    |
    Published online on: March 12, 2018
       https://doi.org/10.3892/ol.2018.8229
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Solanine is an alkaloid and is the main extract of the traditional Chinese herb, Solanum nigrum Linn. It has been reported that Solanine has anti-inflammatory and antitumor properties. The present study aimed to investigate the antitumor effect of Solanine in Jurkat cells and demonstrate the molecular mechanism of antitumor activity of Solanine. A Cell Counting Kit‑8 assay demonstrated that Solanine inhibited the proliferation of Jurkat cells in a dose‑and time‑dependent manner. Cell apoptosis was measured by flow cytometry. Flow cytometry revealed that Solanine induced apoptosis in a dose‑dependent manner in Jurkat cells. Reverse transcription‑quantitative polymerase chain reaction demonstrated that Solanine modulated the mRNA levels of B‑cell lymphoma‑2 (Bcl‑2) and Bcl‑2‑associated X protein (Bax). Additionally, Bcl‑2 and Bax expression was measured using western blot analysis. Western blot analysis revealed a significant increase in the expression of Bax and decrease in the expression of Bcl‑2. Solanine increased the chemosensitivity of Jurkat cells to Adriamycin. In summary, the present results indicated that the antitumor activity of Solanine was associated with inhibition of cell proliferation, induction of apoptosis and increasing cytotoxicity of Adriamycin. Therefore, Solanine may have potential as a novel agent for the treatment of acute lymphocytic leukemia.

Introduction

Acute lymphoblastic leukemia (ALL) is an aggressive type of blood cancer affecting children and adults, with peak prevalence between 2 and 5 years of age (1). T-cell ALL (T-ALL) is an aggressive hematological cancer that is caused by the malignant transformation of thymocyte progenitors (2). T-ALL accounts for 10–15% of pediatric and 25% of adult ALL cases (2,3). The age of the patient at diagnosis, leukocyte count, ethnicity, gender and immunophenotype are clinical prognostic parameters that classify ALL patients into different risk groups (4). TALL is classified into a high-risk group in ALL (4). The prognosis of T-ALL has improved with the development of high-dose multi-agent chemotherapy, with a cure rate of ~85% in children and ~50% in adults (5). However, the treatment is often accompanied by severe acute toxicities and side effects, such as primary resistance, early relapse and secondary tumors (2,3). The identification of new agents for T-ALL patients is urgently required.

Nightshade, a Chinese herbal medicine, has been used to treat sores, injuries, swelling and fractures (6). Solanine, the main extract of Nightshade, is a trisaccharide glycoalkaloid (7). Solanine has been demonstrated to inhibit the production of cytokine and nitric oxide in stimulated Jurkat cells LPS-stimulated Raw macrophages (8).

High concentrations of Solanine result in cytotoxicity-inducing damage of the plasma membrane, which causes disorder of metabolism, including reduced NAD(P)H productivity and the loss or inactivation of NAD(P)H:menadione reductase (9). Solanine was demonstrated to have a proliferation-inhibiting and apoptosis-promoting effect on multiple cancer cells, including prostate cancer, pancreatic carcinoma and melanoma cancer cells (6–9). Studies have also shown that Solanine suppresses proliferation and metastasis, and promotes apoptosis, in pancreatic cancer cells (9,10). Solanine induces apoptosis of HepG2 cells by facilitating the opening of the PT channels in the mitochondria and suppressing the expression of Bcl-2 (11,12). Additionally, Solanine has been reported to inhibit human melanoma cells and human prostate cancer cell invasion at non-toxic doses (6,7). However, to the best of our knowledge, the efficacy and the associated molecular mechanisms of Solanine promoting apoptosis in Jurkat cells have not been explored. In the present study, the effects of Solanine on the inhibition of proliferation and induction of apoptosis in Jurkat cells and the underlying molecular mechanism were investigated. Additionally, the effect of Solanine on the chemosensitivity of Jurkat cells to Adriamycin was assessed. The findings indicated the potential of Solanine to improve the therapeutic outcome of T-ALL.

Materials and methods

Chemicals and reagents

Adriamycin (Melone Pharmaceutical Co. Ltd., Dalian, China) was dissolved to a concentration of 2 g/l in dH2O and divided into 25 aliquots (1.5 ml). Solanine (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) was dissolved in dimethyl sulfoxide (HyClone; GE Healthcare Life Sciences, Logan, UT, USA) to generate a stock solution (100 µg/ml), and diluted to each designated concentration in RPMI-1640 (HyClone; GE Healthcare Life Sciences). The rabbit polyclonal antibodies against B-cell lymphoma-2 (Bcl-2) and Bcl-2-associated X protein (Bax) were obtained from Beijing ZhongShan Golden Bridge Technology Co., Ltd. (Beijing, China). The rabbit polyclonal antibody against GADPH was obtained from Good here Biotechnology Co., Ltd., Hangzhou, China.

Cell lines and cell culture

The human T-ALL Jurkat cells were obtained from Key Laboratory of Tumour Molecular Biology of Binzhou Medical University (Binzhou, China). The cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (HyClone; GE Healthcare Life Sciences) at 37°C in a humidified atmosphere containing 5% CO2.

Cell proliferation assay

Cell Counting Kit 8 (CCK-8; Dojindo Molecular Technologies, Inc., Shanghai, China) was used to determine the cell viability in the presence of Solanine (0, 2, 4, 8 or 16 µg/ml), with/without 0.15 µg/l Adriamycin (4), incubated for 24 h at 37at 24atedci2 in air. Briefly, cells were seeded into 96-well plates at a density of 1×104 cells/well, and, subsequent to treatment with Solamine (0, 2 4, 6, 8 or 16 µg/ml) with/without 0.15 µg/l Adriamycin, 10 µl CCK-8 solution was added to each well and incubated for 4 h at 37°C in a humidified incubator with 5% CO2 in air. Cells in control group were supplemented with the equivalent quantity of DMSO The absorbance was then measured at a wavelength of 490 nm using a fluorescence spectrofluorometer (F-7000; Hitachi Ltd., Tokyo, Japan). A blank well containing only medium and drugs was used as a control.

Flow cytometry analysis

The Jurkat cells (3×105 cells/ml) were seeded into 6 well plates and incubated with various concentrations of Solanine (0, 4 and 16 µg/ml) for 24 h at 37°C in a humidified atmosphere containing 5% CO2 in air. Cells were collected and washed twice with PBS. Cells were then suspended in binding buffer (KeyGen Biotech Co., Ltd., Nanjing, China) and double-stained with annexin V fluorescein isothiocyanate (FITC)/propidium iodide (PI; KeyGen Biotech Co., Ltd.) for 15 min in the dark at room temperature. The cell-associated mean fluorescence intensity (MFI) was detected by flow cytometer using a FACSCalibur (Beckman Coulter, Brea, CA, USA) to analyzed the apoptotic cells.

Determination of gene expression by reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was isolated from Solanine-treated cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA), according to the manufacturer's protocol. Reverse transcription was performed to generate first strand cDNA (Takara Biotechnology Co., Ltd., Dalian, China) using 2 µg of total RNA. The reverse transcription reaction was implemented with PrimeScript™ RT reagent kit with gDNA Eraser (Takara Bio, Shiga, Japan). The primers (Table I) used in this experiment were designed using Primer 5 version 5.6.0 software (PREMIER Biosoft Co., Ltd., CA, USA) and synthesized by Sangon Biotech Co., Ltd., Shanghai, China.

Table I.

Primers used in reverse transcription-quantitative polymerase chain reaction.

Table I.

Primers used in reverse transcription-quantitative polymerase chain reaction.

GenePrimer sequence, 5′-3′Product length, bp
Bax 117
  Forward CCGAGAGGTCTTTTTCCGAG
  Reverse GTGCACAGGGCCTTGAGC
Bcl-2 152
  Forward GGATTGTGGCCTTCTTTGAG
  Reverse TACCCAGCCTCCGTTATCCT
GAPDH 121
  Forward TGACTTCAACAGCGACACCCA
  Reverse CACCCTGTTGCTGTAGCCAAA

[i] Bcl-2, B-cell lymphoma-2; Bax, Bcl-2-associated X protein.

qPCR was performed on an ABI PRISM 7500 qPCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) by using SYBRGreen reaction kit (Takara Bio, Inc., Otsu, Japan). The PCR reaction system consisted of SYBR Green reagent, forward and reverse primers, template cDNA and nuclease-free distilled water. The PCR conditions were 95°C for 30 sec, followed by 45 cycles of 95°C for 5 sec and 60°C for 30 sec. GADPH was used as an internal control. qPCR for each gene of each cDNA sample was assayed in triplicate. The results were calculated using the 2−ΔΔCq method (4). The following equations were used: ΔCq=Cq (target gene)-Cq (GADPH); ΔΔCq=ΔCq (Solanine-treated cells)-ΔCq (untreated control).

Western blot analysis

The Jurkat cells were incubated with Solanine (0, 4 or 16 µg/ml) for 24 h at 37°C. The cells were then harvested. Lysis buffer (100 µl; Beyotime Institute of Biotechnology, Shanghai, China) was added and the protein concentration of the lysate was determined using a bicinchoninic acid protein assay kit (Beyotime Institute of Biotechnology). The lysed samples containing 50 µg total protein were separated on 10–12% SDS-PAGE (Beyotime Institute of Biotechnology), with a constant voltage of 80 V for 0.5 h, and then 100 V for another 1.5 h. The resolved proteins were electrophoretically transferred to polyvinylidene difluoride membranes (Merck KGaA) and blocked with 5% skimmed milk for 2 h at room temperature. Subsequently, the membranes were incubated overnight at 4°C with specific antibodies. The primary antibodies used were rabbit polyclonal antibodies against Bcl-2 (dilution, 1:500), Bax (dilution, 1:500) and GAPDH (dilution, 1:1,000). The following day, the membranes were incubated in horseradish peroxidase-labeled goat anti-rabbit immunoglobulin G (dilution, 1:5,000; catalog no., ZB-5301; Beijing ZhongShan Golden Bridge Technology Co., Ltd.) for 2 h at room temperature. Finally, images were captured using a FluorChem FC2 gel imaging system (ProteinSimple; Bio-Techne, Minneapolis, MN, USA). The intensity of each band was normalized by GADPH for their respective lanes.

Data analysis

Statistical analyses were performed using SPSS 13.0 software (SPSS, Inc., Chicago, IL, USA). Data are expressed as the mean ± standard deviation. Differences between ≥3 groups were evaluated by one-way analysis of variance followed by Student-Newman-Keuls test. Independent two sample t-tests were used to compare the differences between 2 groups. P<0.05 was considered to indicate a statistically significant difference.

Results

Solanine decreased the viability of Jurkat cells

The ability of Solanine to inhibit Jurkat cell proliferation was assessed. Jurkat cells were treated with various concentrations of Solanine (0, 2, 4, 8 or 16 µg/ml) for 24, 48 and 72 h. Cell viability was determined by CCK-8 assay. The results demonstrated that Jurkat cells were sensitive to Solanine, and Solanine inhibited Jurkat cell proliferation in a dose- and time-dependent manner (Fig. 1; P<0.05).

Figure 1.

Solanine inhibited the proliferation of T-cell acute lymphoblastic leukemia Jurkat cells. Jurkat cells were treated with different concentrations of Solanine (0, 2, 4, 8 and 16 µg/ml) for 24, 48 and 72 h. Growth curves were based on data from Cell Counting Kit-8 assays. Data are expressed as the mean ± standard deviation of triplicate experiments. *P<0.05 vs. 24 h.

Solanine induced Jurkat cell apoptosis

Subsequent to treatment of Jurkat cells with various concentrations of Solanine (0, 4 and 16 µg/ml) for 24 h, the apoptotic rate of Jurkat cells was detected by flow cytometry to confirm that Solanine induces Jurkat cell apoptosis. The results revealed that Solanine promotes Jurkat cell apoptosis in a dose-dependent manner (Fig. 2; P<0.05).

Figure 2.

Solanine induced apoptosis in T-cell acute lymphoblastic leukemia Jurkat cells. Jurkat cells were treated with different concentrations of Solanine (0, 4 and 16 µg/ml) for 24 h. Annexin VFITC/phycoerythirin staining was conducted in order to measure cell apoptosis. Data are expressed as the mean ± standard deviation of triplicate experiments. *P<0.05 vs. 0 µg/ml Solanine. FITC, fluorescein isothiocyanate; PE, phycoerythrin.

Effect of Solanine on mRNA levels of Bcl-2 and Bax

RT-qPCR analysis was performed to assess whether Solanine modulates the expression of Bcl-2 and Bax genes. The results showed that Bcl-2 mRNA level decreased and Bax mRNA level increased subsequent to treatment with various concentrations of Solanine (Fig. 3; P<0.05).

Figure 3.

Effect of Solanine on (A) Bax and (B) Bcl-2 mRNA expression in Jurkat cells. The Jurkat cells were treated with different concentrations of Solanine (0, 4 and 16 µg/ml) for 24 h before Bcl-2 and Bax mRNA levels were determined by reverse transcription-quantitative polymerase chain reaction. Data are expressed as the mean ± standard deviation of triplicate experiments. *P<0.05 vs. vs. 0 µg/ml Solanine. Bcl-2, B-cell lymphoma-2; Bax, Bcl-2-associated X protein.

Effect of Solanine on the expression of Bcl-2 and Bax protein in Jurkat cells

Bcl-2 and Bax are involved in cell apoptosis. The expression of Bcl-2 and Bax was measured to explore the molecular mechanism underlying Solanine-induced apoptosis. The western blot assay showed that the expression of Bcl-2 decreased significantly while the expression of Bax increased subsequent to Jurkat cell incubation with various concentrations of Solanine for 24 h (Fig. 4; P<0.05).

Figure 4.

Effect of Solanine treatment on (A) Bax and (B) Bcl-2 expression in T-cell acute lymphoblastic leukemia Jurkat cells. Jurkat cells were treated with Solanine (0, 4 and 16 µg/ml) for 24 h. (C) Protein expression levels of Bcl-2 and Bax were measured by western blot analysis. GAPDH was used as a positive control. Data are expressed as the mean ± standard deviation of triplicate experiments. *P<0.05 vs. 0 µg/ml Solanine. Bcl-2, B-cell lymphoma-2; Bax, Bcl-2-associated X protein.

Solanine enhanced chemosensitivity of Jurkat cells to Adriamycin

Based on the aforementioned findings, the present study explored whether Solanine could increase the chemosensitivity of Jurkat cells to Adriamycin. The cells were incubated with various concentrations of Solanine (0, 4 and 16 µg/ml) in the presence of Adriamycin for 24 h, and inhibition of cell proliferation was measured by CCK-8 assay. As shown in Fig. 5, Solanine significantly increased the Adriamycin-induced inhibitory rate of Jurkat cell proliferation, which indicated that Solanine enhanced sensitivity to Adriamycin compared to the controls [Cells treated with Adriamycin (0.15 µg/l) in the absence of Solanine].

Figure 5.

Effect of Solanine on the chemosensitivity of Jurkat cells to Adriamycin. Cell viability was measured by Cell Counting Kit-8 assay subsequent to treatment with Solanine in the presence of Adriamycin (2 µg/ml for 24 h). Data are expressed as the mean ± standard deviation of triplicate experiments. *P<0.05 vs. 0 µg/ml Solanine in the presence of 2 µg/ml Adriamycin.

Discussion

Glycoalkaloids are secondary plant metabolites that contain nitrogen and are found in Solanaceous plants and possess anticarcinogenic activity (13). Solanine is a steroidal glycoalkaloid (9). Studies have shown that Solanine has antitumor potency (6–9), and inhibited the proliferation of U937 cells (14). In addition, data has shown that Solanine has antitumor activity in other types of cancer. Solanine has been shown to induce apoptosis of mice breast cancer cells by inducing Bax expression and decreasing Bcl-2 expression (14). Solanine also inhibited the activity of matrix metalloproteinase (MMP)-2 and MMP-9 by suppressing the phosphoinositide 3-kinase/Akt and c-Jun N-terminal kinase signaling pathways at non-toxic doses, causing inhibition of migration and invasion in melanoma cells (7). Additionally, Solanine suppressed pancreatic cancer cell migration and invasion by inhibiting MMP-2 and MMP-9 expression (9,10). Solanine downregulated the Bcl-2/Bax ratio and processed the capase-3 zymogen into an active form, thereby promoting pancreatic cancer cell apoptosis (10). However, to the best of our knowledge, the effect of Solanine on T-ALL cells remains unknown. The present study aimed to investigate the cellular functions of Solanine to elucidate the mechanism by which it contributes to promote apoptosis and inhibit proliferation in T-ALL Jurkat cells in vitro.

The CCK-8 assay showed that Solanine significantly inhibited Jurkat cell proliferation in a time- and dose-dependent manner (Fig. 1). Therefore, the results of the present study demonstrated that Solanine treatment inhibited T-ALL Jurkat cell proliferation in vitro.

Apoptosis, also termed programmed cell death, is characterized by morphological changes, including cell shrinkage, chromatin condensation and membrane blebbing without disruption of the plasma membrane (15). Apoptosis plays an important role in homeostasis (16). Therefore, apoptosis plays a crucial role in cancer treatment (17). In the present study, Solanine induced apoptosis of Jurkat cells, which was demonstrated by flow cytometry (Fig. 2).

Apoptosis is triggered by two pathways; one is the death receptor-mediated extrinsic pathway, and the other is the mitochondrial-dependent intrinsic pathway (17,18). Bcl-2 family members are key components of the mitochondrial-dependent intrinsic apoptosis pathway (19). Bcl-2 family members are classified into three subgroups: The pro-apoptotic proteins, including Bax and Bak; the anti-apoptotic proteins, including Bcl-2, myeloid cell leukemia-1 and Bcl-extra large; and the BH3-only proteins, including BH3 interacting domain death agonist, p53 upregulated modulator of apoptosis and Noxa (20). Bax and Bcl-2 are the most characterized apoptosis regulators in mitochondrial-associated apoptosis (21). Bax was the first identified pro-apoptotic protein member of the Bcl-2 protein family, which is able to promote apoptosis (21). In the presence of apoptotic stimuli, Bax translocates to the mitochondria, promoting the release of cytochrome c into the cytosol, leading ultimately to apoptotic cell death (22). Bcl-2, a major anti-apoptotic protein of the Bcl-2 family inhibits cells apoptosis by protecting mitochondrial membrane integrity and blocking the release of cytochrome c (22). The Bax/Bcl-2 ratio determines whether a cell will survive or undergo apoptosis (18). It has been reported that a reduced level of Bax and increased level of Bcl-2 affect the relapse rate of patients with ALL (21). In the present study, RT-qPCR revealed that Solanine inhibited Bcl-2 and promoted Bax mRNA expression (Fig. 3). In addition, the results of the present study indicated that Solanine increased Bax protein expression and decreased Bcl-2 protein expression in a dose-dependent manner, promoting the apoptosis of Jurkat cells (Fig. 4). Therefore, the results of the present study confirmed that Solanine regulates the expression of apoptosis-associated genes and proteins in the T-ALL Jurkat cell line.

Adriamycin is a highly effective anthracycline that is widely used in chemotherapy treatment of a wide range of cancer, including leukemia. In the present study, it was demonstrated that Solanine significantly enhanced the cytotoxicity of Adriamycin in T-ALL cells. The results indicated that Solanine may sensitize T-ALL cells to Adriamycin. The results from the present study indicated the potential of Solanine as an attractive therapeutic strategy for T-ALL.

In conclusion, the present results indicated that Solanine possesses antitumor activity in Jurkat cells. Additionally, the results showed that the anticancer activity of Solanine in Jurkat cells may be associated with inhibition of proliferation and induction of apoptosis by regulating the expression of apoptosis-associated genes and proteins. Solanine may significantly increase the chemosensitivity of Jurkat cells to Adriamycin. Therefore, these findings may provide a novel approach for the development of T-ALL therapy using Solanine.

Acknowledgements

This study was supported by the Natural Science Foundation of Shandong Province (grant no. ZR2014HL032), Projects of Medical and Health Technology Development Program in Shandong Province (grant no. 2014WS0183) and Shandong Science and Technology Committee (grant no. 2010GSF10264).

Competing interests

The authors declare that they have no competing interests.

References

1 

Chopra A, Soni S, Verma D, Kumar D, Dwivedi R, Vishwanathan A, Vishwakama G, Bakhshi S, Seth R, Gogia A, et al: Prevalence of common fusion transcripts in acute lymphoblastic leukemia: A report of 304 cases. Asia Pac J Clin Oncol. 11:293–298. 2015. View Article : Google Scholar : PubMed/NCBI

2 

Durinck K, Goossens S, Peirs S, Wallaert A, Van Loocke W, Matthijssens F, Pieters T, Milani G, Lammens T, Rondou P, et al: Novel biological insights in T-cell acute lymphoblastic leukemia. Exp Hematol. 43:625–639. 2015. View Article : Google Scholar : PubMed/NCBI

3 

D'Angelo V, Iannotta A, Ramaglia M, Lombardi A, Zarone MR, Desiderio V, Affinita MC, Pecoraro G, Di Martino M, Indolfi P, et al: EZH2 is increased in paediatric T-cell acute lymphoblastic leukemia and is a suitable molecular target in combination treatment approaches. J Exp Clin Cancer Res. 34:832015. View Article : Google Scholar : PubMed/NCBI

4 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

5 

Akahane K, Sanda T, Mansour MR, Radimerski T, DeAngelo DJ, Weinstock DM and Look AT: HSP90 inhibition leads to degradation of the TYK2 kinase and apoptotic cell death in T-cell acute lymphoblastic leukemia. Leukemia. 30:219–228. 2016. View Article : Google Scholar : PubMed/NCBI

6 

Shen KH, Liao AC, Hung JH, Lee WJ, Hu KC, Lin PT, Liao RF and Chen PS: α-solanine inhibits invasion of human prostate cancer cell by suppressing epithelial-mesenchymal transition and MMPs expression. Molecules. 19:11896–11914. 2014. View Article : Google Scholar : PubMed/NCBI

7 

Lu MK, Shih YW, Chien Chang TT, Fang LH, Huang HC and Chen PS: α-solanine inhibits human melanoma cell migration and invasion by reducing matrix metalloproteinase-2/9 activities. Biol Pharm Bull. 33:1685–1691. 2010. View Article : Google Scholar : PubMed/NCBI

8 

Kenny OM, McCarthy CM, Brunton NP, Hossain MB, Rai DK, Collins SG, Jones PW, Maguire AR and O'Brien NM: Anti-inflammatory properties of potato glycoalkaloids in stimulated Jurkat and Raw 264.7 mouse macrophages. Life Sci. 92:775–782. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Lv C, Kong H, Dong G, Liu L, Tong K, Sun H, Chen B, Zhang C and Zhou M: Antitumor efficacy of α-solanine against pancreatic cancer in vitro and in vivo. PLoS One. 9:e878682014. View Article : Google Scholar : PubMed/NCBI

10 

Sun H, Lv C, Yang L, Wang Y, Zhang Q, Yu S, Kong H, Wang M, Xie J, Zhang C and Zhou M: Solanine induces mitochondria-mediated apoptosis in human pancreatic cancer cells. Biomed Res Int. 2014:8059262014. View Article : Google Scholar : PubMed/NCBI

11 

Gao SY, Wang QJ and Ji YB: Effect of solanine on the membrane potential of mitochondria in HepG2 cells and [Ca2+]i in the cells. World J Gastroenterol. 12:3359–3367. 2006. View Article : Google Scholar : PubMed/NCBI

12 

Ji YB, Gao SY, Ji CF and Zou X: Induction of apoptosis in HepG2 cells by solanine and Bcl-2 protein. J Ethnopharmacol. 115:194–202. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Friedman M: Chemistry and anticarcinogenic mechanisms of glycoalkaloids produced by eggplants, potatoes, and tomatoes. J Agric Food Chem. 63:3323–3337. 2015. View Article : Google Scholar : PubMed/NCBI

14 

Friedman M, Lee KR, Kim HJ, Lee IS and Kozukue N: Anticarcinogenic effects of glycoalkaloids from potatoes against human cervical, liver, lymphoma, and stomach cancer cells. J Agric Food Chem. 53:6162–6169. 2005. View Article : Google Scholar : PubMed/NCBI

15 

Kwak CH, Lee SH, Lee SK, Ha SH, Suh SJ, Kwon KM, Chung TW, Ha KT, Chang YC, Lee YC, et al: Induction of apoptosis and antitumor activity of eel skin mucus, containing lactose-binding molecules, on human leukemic K562 cells. Mar Drugs. 13:3936–3949. 2015. View Article : Google Scholar : PubMed/NCBI

16 

Scarfò L and Ghia P: Reprogramming cell death: BCL2 family inhibition in hematological malignancies. Immunol Lett. 155:36–39. 2013. View Article : Google Scholar : PubMed/NCBI

17 

Qi L, Ren K, Fang F, Zhao DH, Yang NJ and Li Y: Over expression of BCL2 and low expression of caspase 8 related to TRAIL resistance in brain cancer stem cells. Asian Pac J Cancer Prev. 16:4849–4852. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Christodoulou MI, Kontos CK, Halabalaki M, Skaltsounis AL and Scorilas A: Nature promises new anticancer agents: Interplay with the apoptosis-related BCL2 Gene Family. Anticancer Agents Med Chim. 14:375–399. 2014. View Article : Google Scholar

19 

Wang S, Zhou M, Ouyang J, Geng Z and Wang Z: Tetraarsenictetrasulfide and arsenic trioxide exert synergistic effects on induction of apoptosis and differentiation in acute promyelocytic leukemia Cells. PLoS One. 10:e01303432015. View Article : Google Scholar : PubMed/NCBI

20 

Subburaj Y, Cosentino K, Axmann M, Pedrueza-Villalmanzo E, Hermann E, Bleicken S, Spatz J and García-Sáez AJ: Bax monomers form dimer units in the membrane that further self-assemble into multiple oligomeric species Introduction. Nat Commun. 6:80422015. View Article : Google Scholar : PubMed/NCBI

21 

Cingeetham A, Vuree S, Dunna NR, Gorre M, Nanchari SR, Edathara PM, Meka P, Annamaneni S, Digumarthi R, Sinha S and Satti V: Influence of BCL2-938C>A and BAX-248G>A promoter polymorphisms in the development of AML: Case-control study from South India. Tumour Biol. 36:7967–7976. 2015. View Article : Google Scholar : PubMed/NCBI

22 

Stamati L, Avgeris M, Kosmidis H, Baka M, Anastasiou T, Piatopoulou D, Scorilas A and Gourgiotis D: Overexpression of BCL2 and BAX following BFM induction therapy predicts ch-ALL patients' poor response to treatment and short-term relapse. J Cancer Res Clin Oncol. 141:2023–2036. 2015. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yi YJ, Jia XH, Wang JY, Chen JR, Wang H and Li YJ: Solanine induced apoptosis and increased chemosensitivity to Adriamycin in T-cell acute lymphoblastic leukemia cells. Oncol Lett 15: 7383-7388, 2018.
APA
Yi, Y., Jia, X., Wang, J., Chen, J., Wang, H., & Li, Y. (2018). Solanine induced apoptosis and increased chemosensitivity to Adriamycin in T-cell acute lymphoblastic leukemia cells. Oncology Letters, 15, 7383-7388. https://doi.org/10.3892/ol.2018.8229
MLA
Yi, Y., Jia, X., Wang, J., Chen, J., Wang, H., Li, Y."Solanine induced apoptosis and increased chemosensitivity to Adriamycin in T-cell acute lymphoblastic leukemia cells". Oncology Letters 15.5 (2018): 7383-7388.
Chicago
Yi, Y., Jia, X., Wang, J., Chen, J., Wang, H., Li, Y."Solanine induced apoptosis and increased chemosensitivity to Adriamycin in T-cell acute lymphoblastic leukemia cells". Oncology Letters 15, no. 5 (2018): 7383-7388. https://doi.org/10.3892/ol.2018.8229
Copy and paste a formatted citation
x
Spandidos Publications style
Yi YJ, Jia XH, Wang JY, Chen JR, Wang H and Li YJ: Solanine induced apoptosis and increased chemosensitivity to Adriamycin in T-cell acute lymphoblastic leukemia cells. Oncol Lett 15: 7383-7388, 2018.
APA
Yi, Y., Jia, X., Wang, J., Chen, J., Wang, H., & Li, Y. (2018). Solanine induced apoptosis and increased chemosensitivity to Adriamycin in T-cell acute lymphoblastic leukemia cells. Oncology Letters, 15, 7383-7388. https://doi.org/10.3892/ol.2018.8229
MLA
Yi, Y., Jia, X., Wang, J., Chen, J., Wang, H., Li, Y."Solanine induced apoptosis and increased chemosensitivity to Adriamycin in T-cell acute lymphoblastic leukemia cells". Oncology Letters 15.5 (2018): 7383-7388.
Chicago
Yi, Y., Jia, X., Wang, J., Chen, J., Wang, H., Li, Y."Solanine induced apoptosis and increased chemosensitivity to Adriamycin in T-cell acute lymphoblastic leukemia cells". Oncology Letters 15, no. 5 (2018): 7383-7388. https://doi.org/10.3892/ol.2018.8229
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team